A novel Variant in GAS2 Is Associated with Non-Syndromic Autosomal Dominant Hearing Impairment in a Chinese Family

doi:10.21203/rs.3.rs-3936432/v1

Download PDF

Research Article

A novel Variant in GAS2 Is Associated with Non-Syndromic Autosomal Dominant Hearing Impairment in a Chinese Family

https://doi.org/10.21203/rs.3.rs-3936432/v1

This work is licensed under a CC BY 4.0 License

Version 1

posted

You are reading this latest preprint version

Mutation in the GAS2 gene, encoding growth arrest-specific protein 2 (GAS2), causes the disorganization and destabilization of microtubule bundles in supporting cells of the cochlear duct, leading to hearing loss in vivo. The expression and function of GAS2 in cochlear duct is confirmed. However, the molecular mechanism of GAS2 mutant resulting in hearing loss is still unknown. Whole exome sequencing (WES) was employed to identify pathogenic variants. The reverse transcription-PCR was used to show the retention of GAS2 intron 6. The wild-type GAS2 and the truncated GAS2 (mimicking GAS2 variant) were constructed. The protein expression level and cellular localization of GAS2 were checked by Western blots and immunofluorescence staining. The cell apoptosis was assayed by Cell Counting Kit-8 and The DeadEnd™ Fluorometric TUNEL System. We identify a novel heterozygous variant in GAS2 (c.616-2A > G) as the only candidate mutation segregating with late-onset and progressive NSHL in a large dominant family by WES. The mutation causes the retention of intron 6 in mature mRNA and a C-terminally truncated protein (named as GAS2mu) due to an in-frame stop codon (TGA) at c.615 + 109–111 in intron 6. Mechanically, GAS2mu enhances its degradation by ubiquitin-proteasome and displays disorganized microtubule bundles. Additionally, GAS2mu further promotes cell apoptosis by upregulating the ratio of Bcl-xS/Bcl-xL, instead of p53-dependent as wild-type, indicating that GAS2mu acts as a toxic molecule to aggravate cell apoptosis. Our findings demonstrate that the novel variant of GAS2 promotes its protein degradation, microtubule disorganization and cell apoptosis, leading to hearing loss in variant carriers. This study expands the spectrum of GAS2 variants and elucidates the underlying pathogenic mechanisms, which provides a foundation for future investigation of new therapeutic strategies to prevent GAS2-associated progressive hearing loss.

GAS2

Autosomal dominant non-syndromic hearing loss

protein degradation

microtubule

apoptosis

Hereditary hearing loss (HL), the most common congenital sensory defect, is caused by the genetic factors(Hoefsloot et al. 2014). According to the clinical manifestations, Hereditary HL can be syndromic (< 30% of cases) and non-syndromic (> 70% of cases) forms. Only one dominant allele of the disease gene on the autosomal chromosome can cause the autosomal dominant non-syndromic hearing loss (ADNSHL), which accounts for roughly 20% of non-syndromic hearing loss cases(Jiang et al. 2023). ADNSHL typically manifests in a late-onset and tends to be less severe(Jiang et al. 2023). Around 63 genes have been recorded for ADNSHL in the Hereditary Hearing loss Homepage database (http://hereditaryhearingloss.org). Among these, mutations in MYO6, TECTA, POU4F3, and KCNQ4 are associated with the most prevalent forms of ADNSHL. Mutations on the deafness genes frequently lead to dysfunction of hair cells and synapses, cochlear supporting cells, and/or cells in the stria vascularis and lateral wall(Zhang et al. 2020b). Identifying crucial pathogenic variants associated with hearing loss in affected families and unraveling the underlying mechanisms are fundamental steps for the development of gene therapy, such as well-known deafness genes MYO6 and KCNQ4(Cui et al. 2022; Noh et al. 2022; Xiao et al. 2022; Xue et al. 2022; Zhang et al. 2020b).

Growth arrest-specific protein 2 (GAS2), encoded by GAS2, is a cytoskeletal regulatory protein(Zhang et al. 2021). It consists the calponin-homology (CH) domain at the N-terminal and the growth arrest-specific related (GAR) domain at the C-terminal, which separately mediate the binding with actin and microtubules. GAS2 is mainly expressed in tissues of liver, pancreas and thymus(Zhang et al. 2021). GAS2 is implicated in the regulation of cell cycle and apoptosis, playing a significant role in various cancers. It arrests the cell cycle by suppressing the G1-to-S transition(Zhu et al. 2019). GAS2 serves as a pro-apoptotic factor, enhancing susceptibility to p53-dependent apoptosis under stress conditions in various cell lines(Asai et al. 2012; Benetti et al. 2001; Brancolini et al. 1997). Furthermore, GAS2 is tightly associated with enhanced apoptosis in vivo(Higgins et al. 2011; Yang et al. 2017). Recently, it was reported that GAS2 could express in cochlear supporting cells, Pillar and Deiter’s cells, and maintain the cells with stiffness properties for the propagation and amplification of the travelling wave through the cochlear partition in response to sound(Chen et al. 2021). The outer hair cell function and vibratory responses to sound were impaired in GAS2-null mice. A homozygous c.723 + 1G > A variant in GAS2 has been shown to co-segregate with autosomal recessive NSHL in one Somalian descent family(Chen et al. 2021). However, the effect of the novel GAS2 variant on GAS2 expression and function was still unknown.

In the present study, we reported a novel heterozygous GAS2 mutation in a Han Chinese family segregating with ADNSHL and performed functional exploration. We found that GAS2mu caused its protein stability decreased, abnormal cytoskeleton and cellular apoptosis. Our study not only expands the spectrum of GAS2 variants, but also elucidates the underlying pathogenic mechanisms. This provides a foundation for future investigations into new therapeutic strategies aimed at preventing progressive hearing loss associated with GAS2.

Patient clinical and audiometry data

Written informed consent was provided from all participating individuals. This study was approved by the informed consent of the subjects and the Ethics Committee of the Affiliated Hospital of Nantong University (2022-L111). All subjects received comprehensive auditory evaluation including pure tone audiometry (PTA), otoscopic examination and temporal bone high-resolution CT scanning. Family history and general physical examination were performed to exclude the possible syndromic hearing loss.

Whole-exome sequencing and verification of the pathogenic variants

Genomic DNAs of the proband (III-1) and three other patients (II-11, II-13 and II-14) in this family were isolated from their peripheral blood samples using the Blood DNA kit (Tiangen Biotech) respectively and subsequently subjected to whole-exome sequencing. To detect the common pathogenic variants from the sequencing data, we adopted a stepwise genetic analysis as previously described(Zhang et al. 2013; Zhang et al. 2023b). To further validate the putative pathogenic variants, we performed Sanger sequencing for the other affected members (II-4, II-7 and II-9) and unaffected members (III-2, III-3, III-6, and III-8).

Plasmids and antibodies

Wild-type GAS2wt and the truncated GAS2mu (including exon 1–6 205 a.a. and intron 6 36 a.a.) were cloned to pCI/neo, and tagged with HA at the N-terminal by GENEWIZ company (China). Monoclonal anti-HA and polyclonal anti-HA were bought from Sigma (St. Louis, MO, USA). Polyclonal anti-α-tubulin and monoclonal anti-β-actin were purchased from Proteintech (Wuhan, China). Polyclonal Bcl-xS was purchased from Thermo Fisher Scientific (Rockford, IL, USA). Polyclonal anti-P53, anti-cleaved caspase 3 (c-caspase 3) and anti-GAPDH were bought from Cell Signalling Technology (Danvers, MA, USA). Monoclonal anti-Bcl-xL was bought from Santa Cruz Biotechnology (Dallas, Texas, USA). Horseradish peroxidase (HRP) conjugated anti-mouse and anti-rabbit IgG were got from Jackson ImmunoResearch Laboratories (West Grove, PA). ECL SuperSignal™ West Pico PLUS kit was got from Thermo Fisher Scientific (Rockford, IL, USA).

Cell culture and transfection

HEK-293T and HeLa cells were cultured in Dulbecco’s modified Eagle’s medium (DMEM) (Invitrogen, Carlsbad, CA, USA) with 10% fetal bovine serum (FBS) at 37 ^oC, 5% CO². All transfections were performed in triplicates with Lipofectamine 3000 (Invitrogen, Carlsbad, CA, USA) and X-tremeGENE HP DNA Transfection Reagent (Roche, St. Louis, MO, USA) according to the manufacturer’s instructions. For serum starvation, the whole culture medium was changed to a medium without FBS for 24 h after transfection. For protein degradation inhibition experiment, 20 µM MG132 (ubiquitin-proteasome inhibitor, Sigma) and 10 mM 3-Methyladenine (3-MA, autophagy-lysosome inhibitor, Sigma) were added to the culture medium for 12 h before harvesting the cell.

Western blot analysis

HEK-293T Cells overexpressing of pCI/HA-GAS2wt and pCI/HA-GAS2mu were harvested respectively. The protein concentration was measured by Modified Lowry Protein Assay Kit (Thermo Fisher Scientific). The same amount of protein from each sample was loaded and analyzed by sodium dodecyl sulfate (SDS)–polyacrylamide gel electrophoresis (PAGE) and electro-blotted onto PVDF membrane. The membrane was blocked with 5% fat-free milk and incubated with primary antibodies, such as anti-α-tubulin (1:1000), anti-GAPDH (1:2000), anti-HA (1:1000), anti-p53 (1:2000), anti-cleaved caspase3 (1:2000) and anti-β-actin (1:2000) in 5% fat-free milk with 0.1% NaN3 overnight at room temperature. After washing with TBST (Tris-HCl, pH 7.4, 150 mM NaCl, 0.05% Tween 20) three times, the membrane was incubated with the corresponding HRP-conjugated secondary antibody for 2 h. After washing with TBST three times, the blot was visualized by enhanced chemiluminescence and quantified by densitometry using Multi Gauge V2.3 software (Fuji Film, Japan).

Cell Viability

Cell Counting Kit-8 (CCK8, Dojindo, Japan) was used to examine cell viability according to the manufacturer’s instructions. Briefly, HEK-293T cells were seeded at a density of 5000 cells/well in 96-well plates in three replicates and transfected with indicated plasmid. After 48 h, 10 µL of CCK8 (Sigma, Saint Louis, USA) was added to each well for 1 h. The optical density (OD) values were measured at 450 nm using a plate reader Synergy4 (Biotek, Vermont, USA).

TUNEL Assay

The DeadEnd™ Fluorometric TUNEL System (Roche) was used to detect and quantitate the cell apoptosis. HEK-293T cells transfected with the indicated plasmid were stained with TUNEL reaction mixture at 37°C for 1 h in a humid atmosphere. After rinsing in PBS three times, nuclei were counterstained with a 40, 6-diamidino-2-phenylindole (DAPI) staining solution. Nuclei of TUNEL positive cells intensely labeled by green were identified as apoptotic cells. Images were captured on a TCS-SP2 confocal microscope (Leica, Bensheim, Germany).

Immunofluorescence staining

HeLa cells were plated on glass coverslips in 24-well plates and transfected with pCI/HA-GAS2wt and pCI/HA-GAS2mu. Two days later, the cells were washed with PBS and fixed with 4% paraformaldehyde in PBS for 30 minutes at room temperature. After washing with PBS, the cells were blocked with 10% goat serum in PBS for 1 h at 37°C, and incubated with mouse anti-HA (1:2000) or/and rabbit α-tubulin antibody (1:2000) overnight at 4°C. After washing and incubating with secondary antibodies plus Hoechst 33342 at room temperature, the cells were washed with PBS, mounted with SlowFade® Gold Antifade Mountant (Invitrogen, Carlsbad, CA, USA), and visualized with a TCS-SP2 confocal microscope (Leica, Bensheim, Germany). The fluorescence intensity of the nucleus and whole cell was measured by ImageJ.

Quantitation of GAS2 intron 6 splicing by reverse transcription-PCR (RT-PCR)The total intracellular RNA were extracted from 1 ml fresh human blood according to E.Z.N.A. Blood RNA Kit. Total cellular RNA was isolated from cultured cells by using RNeasy Mini Kit (Qiagen, GmbH, Germany). The same amount of total RNA was used for first-strand cDNA synthesis with Oligo-(dT)15–18 by using Omniscript Reverse Transcription Kit (Qiagen, GmbH, Germany). PCR was performed by using PrimeSTARTM HS DNA Polymerase (Takara Bio Inc., Otsu, Shiga, Japan) with primers, exon2, 3 (E2-3): 5’GGTGCCTTGCTCTGTCAACT3’ and 5’GAGGACCAAACCTTCCGATT3’, E6I6: 5’AGTACAGGAAACTTACTGGATG3’ and 5’TTAGACTGATACGAGATTGCA3’, GAPDH: 5’GGTGGTCTCCTCTGACTTCAACA3’ and 5’GTTGCTGTAGCCAAATTCGTTGT3’. Measuring GAS2 mRNA under conditions: 98 ºC for 3 m, 98 ºC for 10 s and at 68 ºC for 40 s for 33 cycles, following with 68 ºC 10 m for extension. The PCR products were then resolved on 1.5% agarose gels and quantitated using the Molecular Imager system (Bio-Rad, Hercules, CA, USA).

Statistical analysis

The GraphPad Prism 8.0 software was used for statistical analysis. The data were presented as mean ± S.D. For multiple-group analysis, data points were compared by one-way ANOVA with Bonferroni post-hoc test. For two-group comparison, data points were compared by the unpaired two tailed Student’s t test.

A novel GAS2 mutation is identified and causes the hearing loss in a Chinese family

We identified a novel heterozygous GAS2 mutation as a probable cause for a dominant family (designed as the Family NT33) segregating with non-syndromic hearing loss. This family spanned three generations and at least nine members of which were affected by adulthood-onset hearing impairment (Fig. 1A). In addition to a general physical examination, we also performed a pure tone audiometry for all participants. All affected subjects exhibited non-syndromic, bilateral and progressive hearing loss that was the most predominant in the high frequencies (Fig. 1B). Whole-exome sequencing (WES) was performed using DNA isolated from blood samples of four affected individuals (II-11, II-13, II-14 and III-1) respectively and identified a total of three candidate variants: GAS2 (NM_001143830; c.616-2A > G), ADAM11(NM_002390; c.1451T > C), and CSE1L (NM_001316; c.250A > G). Three variants were further genotyped in seven affected members and four unaffected members by Sanger sequencing. Only a splicing variant (c.616-2A > G in GAS2) segregating with the hearing loss in the Family NT33 was identified (Fig. 1C). To investigate the effect of this splicing variant, RT-PCR on RNA extract from blood samples of the affected members (II-13 and II-14) and unaffected subject (WT) was carried out. As expected, we observed a retained intron 6 of GAS2 in the aberrantly spliced transcript in affected members (II-13 and II-14), indicated by the DNA band amplified with E6I6 (exon 6-intron 6) primers, one of the primers locating at intron 6 (Fig. 1D and 1E). The retention of intron 6 in GAS2 variant transcripts resulted in a new reading frame and generated an in-frame stop codon in retained intron 6, causing the encoded protein with exons 1, 2, 3, 4, 5, 6 and additional 36 amino acids (a.a.) of intron 6, named as GAS2mu (Fig. 1E). In accordance with the guidelines of the American College of Medical Genetics and Genomics (ACMG) for sequence variant interpretation(Richards et al. 2015), GAS2 c.616-2A > G was interpreted as a pathogenic variant.

The GAS2 mutation promotes its protein degradation by ubiquitin-dependent proteasome pathway

Given the previous report of another homozygous variant in GAS2 co-segregating with hearing loss in a Somalian descent family(Chen et al. 2021), we speculated that GAS2 c.616-2A > G identified here may be a cause of progressive, late-onset hearing loss in this family. To interrogate the effect of this pathogenic mutation on its function, we constructed plasmids of GAS2wt and GAS2mu with HA tag at the N-terminal and transfected to HEK-293T cells. The expression of GAS2 protein was barely detectable in GAS2mu and significantly lower than that of GAS2wt by western blotting with anti-HA antibody (Fig. 2A and 2B). Consistent with the Western blots result, the immunofluorescence intensity of GAS2mu was also much lower than that of GAS2wt in Hela cells (Fig. 2C and 2D). Furthermore, GAS2mu mainly located at cytoplasm instead of diffusely distributing in the cell compared with GAS2wt (Fig. 2C and 2E). However, the mRNA levels were comparable between GAS2wt and GAS2mu transfected cells, indicating that this variant in GAS2 has no impact on its mRNA expression (Fig. 2F). We next assess the protein stability of GAS2mu. HEK-293T cells with overexpressing of GAS2wt and GAS2mu respectively were treated with 3-methyladenine (3-MA, autophagy-degradation inhibitor) or MG-132 (ubiquitin-proteasome-degradation inhibitor). In contrast to the wild-type, the protein expression of GAS2mu was markedly increased in the cells treated with MG-132 (Fig. 2G-2J). However, cells treated with 3-MA did not show an elevation in protein levels (Fig. 2E and 2F). Together, these results suggested that GAS2mu could efficiently enhance protein degradation via the ubiquitin-dependent proteasome pathway instead of the autophagy pathway.

The GAS2 mutation could not co-localize with microtubule bundles and cause microtubule disorganized

GAS2wt contains two domains, a CH domain and a GAR domain, with 313 a.a. while GAS2mu producing a C-terminally truncated protein with 241 a.a. contains only a CH domain (Fig. 3A). We then predicted the protein structures of GAS2wt and GAS2mu using AlphaFold2(Jumper et al. 2021). The structures of the N-terminal between GAS2wt and GAS2mu were consistent (Fig. 3B). Notably, five β-sheets and one α-helix were observed at the C-terminal of GAS2wt, but only two α-helices at the C-terminal of GAS2mu (Fig. 3B), suggesting this novel variant may disrupt its binding with microtubule. GAS2 localizes to microtubules of supporting cells in the postnatal cochlea and affords mechanical stiffness to transmit sound energy through the cochlea(Chen et al. 2021). Consistently, we observed that GAS2wt evenly distributed throughout the cells and colocalized with α-tubulin, which is consistent with its biological function as a cross-linker between microtubules and actin filaments. The microtubules, stained by α-tubulin antibody, was tightly bundled in GAS2wt positive cells (Fig. 3C). However, GAS2mu characterized a punctate staining instead of evenly distribution in the cell and caused microtubules disorganized and less tightly bundled (Fig. 3C). The protein level of α-tubulin was dramatically increased in GAS2wt group (Fig. 3D and 3E). However, GAS2mu significantly attenuated the protein level of α-tubulin, which is consistent with sparse microtubule structure (Fig. 3D and 3E). These results demonstrate that the variant GAS2mu affects the protein stability and perturbs its binding with microtubules.

The GAS2 mutation aggravates cell apoptosis via increasing the ratio of Bcl-xS/Bcl-xL

The abnormal surplus apoptosis in inner ear were also observed and play a vital role for progressive ADNSHL (Sha et al. 2009; Zhang et al. 2020a). The deficiency of Thoc1, a ARHL risk gene, unleashes the expression of proapoptotic genes and results in hair cell apoptosis, leading to ARHL in patients(Zhang et al. 2020a). GAS2 could increase cellular susceptibility to apoptosis under physiological or pathological damage through the p53 pathway(Benetti et al. 2001; Wu et al. 2020; Zhu et al. 2015). So, we speculated that the GAS2mu might cause the progressive, late-onset hearing loss via cell apoptosis. The overexpression of GAS2wt decreased cell viability under FBS deprivation in a dose-dependent manner via upregulating the expression of p53 (Fig. 4A-4C). In addition, compared with GAS2wt, overexpression of GAS2mu further reduced cell viability (Fig. 4D) and enhanced cell susceptibility to apoptosis indicated by the increased ratio of TUNEL-positive cells (Fig. 4E and 4F) and cleaved caspase 3 protein level (Fig. 4G) under FBS deprivation in HEK-293T cells. However, unlike in GAS2wt, the p53 expression was down-regulated in GAS2mu under FBS deprivation (Fig. 4G and 4H), revealing that GAS2mu may promote cell apoptosis via p53-independent manner. Bcl-x includes two isoforms, the anti-apoptotic form (Bcl-xL) and the proapoptotic form (Bcl-xS). The overexpression of Bcl-xL could prevent cochlear hair cell death from aminoglycoside ototoxicity and hearing loss in mice(Kashio et al. 2007; Liu et al. 2007). Thus, we further investigated the effect of GAS2mu on the expression of Bcl-xS and Bcl-xL. We found that overexpression of GAS2wt had no impact on Bcl-xS and Bcl-xL level under FBS deprivation (Fig. 4I). However, GAS2mu dramatically increased the level of the pro-apoptotic isoform Bcl-xS and decreased the level of anti-apoptotic Bcl-xL isoform (Fig. 4I-4L), indicating that GAS2mu promote cell apoptosis through regulating the alternative splicing of Bcl-x. Thus, our results demonstrated that GAS2mu exacerbated cell apoptosis by upregulating the ratio of Bcl-xS to Bcl-xL under the serum deprivation, instead of the p53-dependent manner.

This study identified a novel heterozygous pathogenic variant in GAS2 (MIM No. 600840) that co-segregated with ADNSHL in a Chinese family. To our knowledge, it is the second splicing variant reported in GAS2 associated with ADNSHL. This aberrant splicing leads to an intron retention, premature stop and C-terminal truncated GAS2 protein with the loss of microtubule binding domain. We also investigated the effect of the novel GAS2 variant on its biological function to illustrate the pathogenesis for the first time. The results revealed that this mutant induces its protein degradation through the ubiquitin-proteasome pathway, severely disrupts microtubules organization and exacerbates cellular apoptosis by upregulating the expression of Bcl-xS. These mechanisms may underlie the impact of GAS2 mutants on inner ear supporting cell dysfunction, ultimately contributing to hearing loss (Fig. 5).

GAS2 consists of a CH and GAR domain, which cross-link the actin filaments and microtubules. Of which, the GAR domain mediates the interaction of GAS2 with microtubules. The truncated GAS2 identified here only retained the first eight a.a. (197–209 a.a.) of GAR domain (Fig. 3A). Unlike the GAS2wt, GAS2mu congregated and lost the co-localization with α-tubulin (Fig. 3C). A previous study demonstrated that artificial deletion of the C-terminus of GAS2, such as GAS2_Δ276−314 and GAS2_Δ236−314, resulted in changes to cell morphology(Brancolini et al. 1995). Moreover, further deletion of GAS2_Δ200−314 and GAS2_Δ171−314 at the C-terminus, could alter the microfilament system without the changes of cell morphology(Brancolini et al. 1995). Consistent with this observation, we also found that GAS2mu here had no obvious effect on the cell morphology. As is well known, hyperphosphorylation and truncation of tau, a microtubule associated protein, facilitate tau aggregation(Gu et al. 2020). Similar to truncated tau, GAS2mu could also promote self-aggregation, which should be further investigated by cellular and biochemical experiments in the future.

Under stress conditions, such as FBS deprivation and exposure to DNA-damaging agents, GAS2 increases cell susceptibility to p53-dependent apoptosis by inhibiting calpain activity(Benetti et al. 2001). Subsequently, activated caspase-3 and caspase-7 can cleave its death substrate GAS2. The cleaved form of GAS2 induces morphological change during cellular apoptosis(Sgorbissa et al. 1999). We also found that overexpression of wild-type GAS2 could promote cell apoptosis and increase p53 expression under FBS deprivation. The dominant-negative form of GAS2 (GAS2_Δ171−314) is not able to prevent p53 degradation by calpain leading to less susceptibility to apoptosis(Benetti et al. 2001). Strikingly, different from GAS2_Δ171−314, GAS2mu enhanced cell susceptibility to apoptosis upon FBS deprivation. This indicates that GAS2mu gains the function to promote cell apoptosis. Further, we illustrated that the enhanced apoptosis by GAS2mu was associated with the increased ratio of Bcl-xS/Bcl-xL. The alternative splicing of Bcl-x exon 2b can produce two isoforms of Bcl-x: pro-apoptosis Bcl-xS and anti-apoptosis Bcl-xL(Zhang et al. 2023a). Therefore, we have revealed a distinct molecular mechanism underlying enhanced apoptosis by GAS2mu in comparison to the GAS2wt. This finding may provide additional insights into the pathological roles of this novel GAS2 mutant in hearing loss.

Over 80% of protein degradation in mammalian cells is catalyzed by the 26S proteasome. The misfolded and useless proteins are first ubiquitylated and are then transferred to the proteasome to be digested for protein turnover, which is essential for protein homeostasis(Collins and Goldberg 2017). Here, we found that GAS2mu not only lost its physiologic function, but also became a toxic protein that enhanced cell apoptosis. Consequently, the proteasome was engaged in the degradation of GAS2mu, resulting in a reduction in the level of GAS2mu protein. We assume that the affected members in this Chinese family exhibit lower levels of GAS2 protein compared to healthy individuals which may indicate another pathological function of this novel GAS2 mutant in hearing loss.

Taken together, we not only identified a novel GAS2 variant, but also expounded the pathogenesis of this mutant with hearing loss in vitro. Our study not only expands the pathogenic genetic variants, but also provides novel insights into genetic basis of hearing loss, which will greatly contribute to the molecular diagnosis and therapeutic developments for hearing loss. A limitation of this study is that the genetic basis of GAS2mu were explored in vitro and investigation should be conducted in vivo to further elucidate the pathogenic role of GAS2 mutants in hearing loss.

GAS2 growth arrest-specific protein 2

CH calponin-homology

GAR growth arrest-specific related

GAS2wt wild-type GAS2

GAS2mu GAS2 mutant

WES whole exome sequencing

HL hearing loss

ADNSHL autosomal dominant non-syndromic hearing loss

PTA pure tone audiometry

FBS fetal bovine serum

CCK8 Cell Counting Kit-8

OD optical density

ACMG American College of Medical Genetics and Genomics

Supplementary Information

Not available

Acknowledgements

The authors would like to thank Prof. Fei Liu (New York State Institute for Basic Research in Developmental Disabilities) for her guidance and assistance in this study.

Author contributions

N.N.J. and L.P.Z. designed the study idea, experimental protocol and funding support. L.P.Z., D.Y.Z., and S.Q.Z conducted the experiments. J.H.S. conducted protein modelling prediction. L.P.Z., L.X. and N.N.J. wrote the manuscript. N.N.J. revises and reviewed the manuscript.

Funding

This research received funding from the National Natural Science Foundation of China (82171425), Social development project of Jiangsu Provincial Key R&D Program (BE2022764) and Scientific Research Foundation for the high-level talents by the Second Affiliated Hospital of Nantong University (YJRCJJ001).

Availability of data and materials

The datasets provided in this study are available in online repositories.

Ethics approval and consent to participate

All procedures were approved by the informed consent of the subjects and the ethics Committee of the Affiliated Hospital of Nantong University. Informed consent was obtained from all subjects involved in the study.

Consent for publication

Not applicable.

Competing interests

All the authors declare that they have no competing interests.

Author details

¹Institute for translational neuroscience, the Second Affiliated Hospital of Nantong University, Department of Otolaryngology-Head and Neck Surgery, Affiliated Hospital of Nantong University, Nantong University, Nantong, Jiangsu, 226001, China.

Asai T, Liu Y, Di Giandomenico S, Bae N, Ndiaye-Lobry D, Deblasio A, Menendez S, Antipin Y, Reva B, Wevrick R, Nimer SD (2012) Necdin, a p53 target gene, regulates the quiescence and response to genotoxic stress of hematopoietic stem/progenitor cells. Blood 120: 1601–12. doi: 10.1182/blood-2011-11-393983
Benetti R, Del Sal G, Monte M, Paroni G, Brancolini C, Schneider C (2001) The death substrate Gas2 binds m-calpain and increases susceptibility to p53-dependent apoptosis. EMBO J 20: 2702–14. doi: 10.1093/emboj/20.11.2702
Brancolini C, Benedetti M, Schneider C (1995) Microfilament reorganization during apoptosis: the role of Gas2, a possible substrate for ICE-like proteases. EMBO J 14: 5179–90. doi: 10.1002/j.1460-2075.1995.tb00202.x
Brancolini C, Marzinotto S, Schneider C (1997) Susceptibility to p53 dependent apoptosis correlates with increased levels of Gas2 and Gas3 proteins. Cell Death Differ 4: 247–53. doi: 10.1038/sj.cdd.4400232
Chen T, Rohacek AM, Caporizzo M, Nankali A, Smits JJ, Oostrik J, Lanting CP, Kucuk E, Gilissen C, van de Kamp JM, Pennings RJE, Rakowiecki SM, Kaestner KH, Ohlemiller KK, Oghalai JS, Kremer H, Prosser BL, Epstein DJ (2021) Cochlear supporting cells require GAS2 for cytoskeletal architecture and hearing. Dev Cell 56: 1526–1540 e7. doi: 10.1016/j.devcel.2021.04.017
Collins GA, Goldberg AL (2017) The Logic of the 26S Proteasome. Cell 169: 792–806. doi: 10.1016/j.cell.2017.04.023
Cui C, Wang D, Huang B, Wang F, Chen Y, Lv J, Zhang L, Han L, Liu D, Chen ZY, Li GL, Li H, Shu Y (2022) Precise detection of CRISPR-Cas9 editing in hair cells in the treatment of autosomal dominant hearing loss. Mol Ther Nucleic Acids 29: 400–412. doi: 10.1016/j.omtn.2022.07.016
Gu J, Xu W, Jin N, Li L, Zhou Y, Chu D, Gong CX, Iqbal K, Liu F (2020) Truncation of Tau selectively facilitates its pathological activities. J Biol Chem 295: 13812–13828. doi: 10.1074/jbc.RA120.012587
Higgins SE, Wolfenden AD, Tellez G, Hargis BM, Porter TE (2011) Transcriptional profiling of cecal gene expression in probiotic- and Salmonella-challenged neonatal chicks. Poult Sci 90: 901–13. doi: 10.3382/ps.2010-00907
Hoefsloot LH, Feenstra I, Kunst HP, Kremer H (2014) Genotype phenotype correlations for hearing impairment: approaches to management. Clin Genet 85: 514–23. doi: 10.1111/cge.12339
Jiang L, Wang D, He Y, Shu Y (2023) Advances in gene therapy hold promise for treating hereditary hearing loss. Mol Ther 31: 934–950. doi: 10.1016/j.ymthe.2023.02.001
Jumper J, Evans R, Pritzel A, Green T, Figurnov M, Ronneberger O, Tunyasuvunakool K, Bates R, Zidek A, Potapenko A, Bridgland A, Meyer C, Kohl SAA, Ballard AJ, Cowie A, Romera-Paredes B, Nikolov S, Jain R, Adler J, Back T, Petersen S, Reiman D, Clancy E, Zielinski M, Steinegger M, Pacholska M, Berghammer T, Bodenstein S, Silver D, Vinyals O, Senior AW, Kavukcuoglu K, Kohli P, Hassabis D (2021) Highly accurate protein structure prediction with AlphaFold. Nature 596: 583–589. doi: 10.1038/s41586-021-03819-2
Kashio A, Sakamoto T, Suzukawa K, Asoh S, Ohta S, Yamasoba T (2007) A protein derived from the fusion of TAT peptide and FNK, a Bcl-x(L) derivative, prevents cochlear hair cell death from aminoglycoside ototoxicity in vivo. J Neurosci Res 85: 1403–12. doi: 10.1002/jnr.21260
Liu YH, Ke XM, Qin Y, Gu ZP, Xiao SF (2007) Adeno-associated virus-mediated Bcl-xL prevents aminoglycoside-induced hearing loss in mice. Chin Med J (Engl) 120: 1236–40.
Noh B, Rim JH, Gopalappa R, Lin H, Kim KM, Kang MJ, Gee HY, Choi JY, Kim HH, Jung J (2022) In vivo outer hair cell gene editing ameliorates progressive hearing loss in dominant-negative Kcnq4 murine model. Theranostics 12: 2465–2482. doi: 10.7150/thno.67781
Richards S, Aziz N, Bale S, Bick D, Das S, Gastier-Foster J, Grody WW, Hegde M, Lyon E, Spector E, Voelkerding K, Rehm HL, Committee ALQA (2015) Standards and guidelines for the interpretation of sequence variants: a joint consensus recommendation of the American College of Medical Genetics and Genomics and the Association for Molecular Pathology. Genet Med 17: 405–24. doi: 10.1038/gim.2015.30
Sgorbissa A, Benetti R, Marzinotto S, Schneider C, Brancolini C (1999) Caspase-3 and caspase-7 but not caspase-6 cleave Gas2 in vitro: implications for microfilament reorganization during apoptosis. J Cell Sci 112 (Pt 23): 4475–82. doi: 10.1242/jcs.112.23.4475
Sha SH, Chen FQ, Schacht J (2009) Activation of cell death pathways in the inner ear of the aging CBA/J mouse. Hear Res 254: 92–9. doi: 10.1016/j.heares.2009.04.019
Wu J, Ye J, Kong W, Zhang S, Zheng Y (2020) Programmed cell death pathways in hearing loss: A review of apoptosis, autophagy and programmed necrosis. Cell Prolif 53: e12915. doi: 10.1111/cpr.12915
Xiao Q, Xu Z, Xue Y, Xu C, Han L, Liu Y, Wang F, Zhang R, Han S, Wang X, Li GL, Li H, Yang H, Shu Y (2022) Rescue of autosomal dominant hearing loss by in vivo delivery of mini dCas13X-derived RNA base editor. Sci Transl Med 14: eabn0449. doi: 10.1126/scitranslmed.abn0449
Xue Y, Hu X, Wang D, Li D, Li Y, Wang F, Huang M, Gu X, Xu Z, Zhou J, Wang J, Chai R, Shen J, Chen ZY, Li GL, Yang H, Li H, Zuo E, Shu Y (2022) Gene editing in a Myo6 semi-dominant mouse model rescues auditory function. Mol Ther 30: 105–118. doi: 10.1016/j.ymthe.2021.06.015
Yang C, Wu F, Lu X, Jiang M, Liu W, Yu L, Tian J, Wen H (2017) Growth arrest specific gene 2 in tilapia (Oreochromis niloticus): molecular characterization and functional analysis under low-temperature stress. BMC Mol Biol 18: 18. doi: 10.1186/s12867-017-0095-y
Zhang L, Gao Y, Zhang R, Sun F, Cheng C, Qian F, Duan X, Wei G, Sun C, Pang X, Chen P, Chai R, Yang T, Wu H, Liu D (2020a) THOC1 deficiency leads to late-onset nonsyndromic hearing loss through p53-mediated hair cell apoptosis. PLoS Genet 16: e1008953. doi: 10.1371/journal.pgen.1008953
Zhang L, Wu X, Lin X (2020b) Gene therapy for genetic mutations affecting non-sensory cells in the cochlea. Hear Res 394: 107858. doi: 10.1016/j.heares.2019.107858
Zhang LP, Chai YC, Yang T, Wu H (2013) Identification of novel OTOF compound heterozygous mutations by targeted next-generation sequencing in a Chinese patient with auditory neuropathy spectrum disorder. Int J Pediatr Otorhinolaryngol 77: 1749–52. doi: 10.1016/j.ijporl.2013.08.007
Zhang N, Zhao C, Zhang X, Cui X, Zhao Y, Yang J, Gao X (2021) Growth arrest-specific 2 protein family: Structure and function. Cell Prolif 54: e12934. doi: 10.1111/cpr.12934
Zhang S, Zhong J, Xu L, Wu Y, Xu J, Shi J, Gu Z, Li X, Jin N (2023a) Truncated Dyrk1A aggravates neuronal apoptosis by inhibiting ASF-mediated Bcl-x exon 2b inclusion. CNS Neurosci Ther. doi: 10.1111/cns.14493
Zhang T, Xu Z, Zheng D, Wang X, He J, Zhang L, Zallocchi M (2023b) Novel biallelic variants in the PLEC gene are associated with severe hearing loss. Hear Res 436: 108831. doi: 10.1016/j.heares.2023.108831
Zhu R, Mok MT, Kang W, Lau SS, Yip WK, Chen Y, Lai PB, Wong VW, To KF, Sung JJ, Cheng AS, Chan HL (2015) Truncated HBx-dependent silencing of GAS2 promotes hepatocarcinogenesis through deregulation of cell cycle, senescence and p53-mediated apoptosis. J Pathol 237: 38–49. doi: 10.1002/path.4554
Zhu RX, Cheng ASL, Chan HLY, Yang DY, Seto WK (2019) Growth arrest-specific gene 2 suppresses hepatocarcinogenesis by intervention of cell cycle and p53-dependent apoptosis. World J Gastroenterol 25: 4715–4726. doi: 10.3748/wjg.v25.i32.4715

No competing interests reported.

Download PDF

Version 1

posted

You are reading this latest preprint version

A novel Variant in GAS2 Is Associated with Non-Syndromic Autosomal Dominant Hearing Impairment in a Chinese Family

Status:

Version 1

Abstract

Figures

Background

Materials and Methods

Patient clinical and audiometry data

Whole-exome sequencing and verification of the pathogenic variants

Plasmids and antibodies

Cell culture and transfection

Western blot analysis

Cell Viability

TUNEL Assay

Immunofluorescence staining

Statistical analysis

Results

A novel GAS2 mutation is identified and causes the hearing loss in a Chinese family

The GAS2 mutation promotes its protein degradation by ubiquitin-dependent proteasome pathway

The GAS2 mutation could not co-localize with microtubule bundles and cause microtubule disorganized

The GAS2 mutation aggravates cell apoptosis via increasing the ratio of Bcl-xS/Bcl-xL

Discussion and Conclusions

Abbreviations

Declarations

References

Additional Declarations

Status:

Version 1