USP10 activates the FAK pathway by stabilizing RIOK3 in pancreatic ductal adenocarcinoma

doi:10.21203/rs.3.rs-3941004/v1

Download PDF

Research Article

USP10 activates the FAK pathway by stabilizing RIOK3 in pancreatic ductal adenocarcinoma

https://doi.org/10.21203/rs.3.rs-3941004/v1

This work is licensed under a CC BY 4.0 License

Version 1

posted

You are reading this latest preprint version

Background

The aberrant activation of FAK (Focal Adhesion Kinase) serves as a critical mechanism leading to heightened invasiveness and metastatic potential in pancreatic ductal adenocarcinoma (PDAC). FAK inhibitors have entered clinical trials, underscoring the significance of targeting FAK in treating PDAC. Further exploration of the regulation mechanism of FAK is crucial for advancing FAK inhibitors. Our previous study suggests that RIO Kinase 3 (RIOK3) facilitates the invasiveness and metastasis of PDAC cells by stabilizing FAK protein expression and upregulating its phosphorylation.

Methods

We used bioinformatics and IHC to measure Ubiquitin-specific protease 10 (USP10) mRNA and protein expression in PDAC based on TCGA and GTEx PDAC mRNA databases and two PDAC tissue chips from independent medical centers, and survival analysis was performed. Stable knockdown and overexpression experiments were performed on three different PDAC cells to elucidate the carcinogenic effect of USP10 through both in vivo and in vitro experiments. Co-IP and laser confocal experiments were carried out to confirm the interaction modes between USP10, FAK, and RIOK3. Deubiquitination experiments further validated the deubiquitination effect of USP10 on RIOK3. Finally, a prognostic model incorporating co-expression of USP10 and RIOK3 along with other factors influencing PDAC survival was established and validated using COX regression analysis.

Results

USP10 was associated with a poor prognosis in PDAC. In vitro experiments found that USP10 significantly promotes the proliferation, invasion, and migration of PDAC cells. Xenografted tumor and lung metastasis models in nude mice demonstrated that USP10 promoted the growth and metastasis of PDAC cells. Mechanically, USP10 interacts with FAK and RIOK3. RIOK3 acts as a bridge between USP10 and FAK. USP10 deubiquitinates and stabilizes RIOK3. In addition, RIOK3 overexpression can significantly compensate for the USP10 knockdown-mediated decline in FAK protein expression. Moreover, USP10 and RIOK3 co-expression is a significant factor associated with poor survival in the PDAC prognostic model.

Conclusion

USP10 deubiquitinates and stabilizes RIOK3 and activates the FAK signaling pathway, thereby inhibiting PDAC tumorigenesis, indicating that it may be a potential drug target for cancer treatment.

USP10

FAK

Deubiquitination

RIOK3

PDAC

Pancreatic ductal adenocarcinoma (PDAC) is a highly aggressive malignancy, frequently diagnosed at advanced stages^[1]. Conventional cytotoxic chemotherapy has shown limited efficacy due to a lack of targeting^[2]. Given its apparent tendency towards aggressive and distant metastases and low treatment effectiveness, PDAC has a poor prognosis, with a 5-year survival rate of less than 7%^{[3, 4]}. Consequently, there is a pressing need to thoroughly explore specific molecular mechanisms and discover innovative therapeutic strategies.

Focal Adhesion Kinase (FAK) emerges as a scaffolding and tyrosine kinase protein that binds to itself and cellular partners through its four-point-one, ezrin, radixin, and moesin (FERM) domain^{[5, 6]}. FAK plays a pivotal role in propelling the migration and invasion processes of tumor cells by regulating focal adhesions, and cytoskeletal dynamics, and modulating the surface expression of matrix metalloproteinases (MMPs)^[7–9]. Furthermore, FAK participated in intracellular signaling pathways within the tumor microenvironment, thereby fostering tumor progression^{[10, 11]}. Activation of FAK also triggers endothelial cell migration, proliferation, and survival, stimulates tumor angiogenesis, and regulates endothelial cell permeability, thereby impacting tumor metastasis^[12–15]. Small-molecule FAK inhibitors (FAKi) in PDAC clinical trials are currently underway, such as the combination of CT-707 with PD-1 inhibitors and gemcitabine, as well as the utilization of AMP945 to enhance the efficacy of first-line treatment for unresectable or metastatic PDAC^{[16, 17]}. Research findings underscore the capability of FAKi to mitigate tumor growth and metastasis, coupled with manageable adverse events^{[18, 19]}. Therefore, the function and specific molecular mechanisms of FAK are imperative for advancing the development of targeted FAKi and optimizing their efficacy.

RIO Kinase 3 (RIOK3) is a member of the RIO atypical protein kinase family, expressed in multicellular eukaryotes^[19]. In recent years, RIOK3 has been reported to promote the invasion and metastasis of various solid tumors through oxygen deficiency regulation, changes in the cytoskeleton, and activation of the Akt/mTOR signaling pathway^{[20, 21]}. Notably, our recent findings indicate that RIOK3 promotes PDAC invasion and metastasis via binding and stabilizing FAK expression and upregulating its phosphorylation^[22].

Ubiquitination and ubiquitin imbalance stand out as hallmarks in the development of cancer. Ubiquitin-specific protease 10 (USP10) is a member of the deubiquitinase family, interacting with various substrate proteins and performing deubiquitination modifications^{[23, 24]}. USP10 plays a crucial role by deubiquitinating substrate proteins, such as YKi, MDM2, P53, and NICD1, involved in multiple key biological processes, including cellular signal transduction and gene expression regulation^[24–28]. Additionally, USP10 deubiquitinates integrins β1 and β5, especially αvβ5 and αvβ1, leading to the accumulation of integrins on the cell surface and subsequent localized TGF-β activation^[29]. However, the relationship between USP10 and FAK protein and the specific mechanism of action in PDAC are still unclear.

This study reveals that USP10 expression is significantly associated with a poor prognosis in PDAC. Through function experiments, we found that USP10 promotes the malignant phenotype of PDAC cells. Further mechanistic investigations reveal the interaction between USP10, FAK, and RIOK3, forming a protein complex. Within this complex, the knockdown of RIOK3 markedly impedes the binding of USP10 to FAK. Subsequent findings demonstrate that USP10 deubiquitinated and stabilized the RIOK3 protein expression, activated the FAK signaling pathway, and promoted the malignant phenotype of PDAC cells.

2.1. Clinical specimens

Human PDAC tissue microarrays were obtained from Shanghai Outdo Biotech Company (Shanghai, China) (Group 1 n = 90) and Dalian Medical University biobank (Dalian, China) (Group 2 n = 46), and all samples were collected with the informed consent of the patients. The experiments were approved by the Research Ethics Committee of Shanghai Outdo Biotech Company and the First Affiliated Hospital of Dalian Medical University. All human samples included in the study were handled by the tenets of the Declaration of Helsinki.

2.2. Antibodies and Inhibitors

The following antibodies and reagents were used:

Anti-USP10 (MA5-25766), anti-RIOK3 (PA5-28585), and Anti-Beta Actin (MA1-410) were purchased from ThermoFisher (Invitrogen, Carlsbad, CA, USA). Ubiquitin antibody (#3933S), anti-FAK (71433S), anti-Phospho-FAK (Tyr397) (8556), anti-Phospho-FAK (Tyr925) (3284), anti-Integrin β1 (9699), anti-Integrin β4 (14803) and anti-Integrin β5 (3629) were purchased from Cell Signaling Technology (CST, Danvers, MA, USA). Anti-RIOK3 (13593-1-AP) and anti-Flag tag (20543-1-AP) were purchased from ProteinTech (ProteinTech Group, Inc., Rosemont, IL, USA). Anti-Vinculin (sc-73614) and anti-HA tag (sc-7392) were purchased from Santa Cruz Biotechnology (Santa Cruz, CA, USA). The proteasome inhibitor MG132 (S2619) was purchased from Selleckchem (Houston, TX, USA). The protein synthesis inhibitor cycloheximide (CHX; #2112S) was purchased from CST.

2.3 Cell culture

The human PDAC cell lines PANC-1, AsPC-1, and BxPC-3 cells were obtained from the Cell Bank of the Chinese Academy of Sciences (Shanghai, China); HEK293T cells were stored in the lab; PANC-1, ASPC-1, and HEK293T cells were cultured in DMEM (GIBCO, USA); and BxPC-3 cells were cultured in RPMI-1640 (GIBCO, USA). Cell lines were maintained in culture supplemented with 10% FBS (GIBCO, USA) and 1% penicillin/streptomycin (Thermo Fisher, USA) at 37°C with 5% CO2 in a humidified incubator (Thermo Fisher, USA).

2.4 Plasmids

Lentiviral shRNAs were cloned in pLKO.1 within the AgeI/EcoRI sites at the 3rd end of the human U6 promoter. The targeted sequences were:

shUSP10-1: 5’-CCCATGATAGACAGCTTTGTT-3’

shUSP10-2: 5’-CCTATGTGGAAACTAAGTATT-3’

shFAK-1: 5’-CCAGGGATTATGAGATTCAAA-3’

USP10, USP10 C424A, and RIOK3 were subcloned into Flag-tagged or HA-tagged expression vectors and pBoBi expression vectors.

2.5 Cell colony formation

We used DMEM (PANC-1 and AsPC-3) and RPMI-1640 (BxPC-3) plated in six-well plates at a density of 500 cells/well and cultured for another 14 days. Then cell colonies formed and were fixed with 4% paraformaldehyde (P0099, Beyotime, China) for 15 minutes and stained using crystal violet (C8470, Solarbio, China) for 5 minutes. Images were photographed, and the cell colony formation rate was calculated. Repeat it three times for each cell line.

2.6 Migration and invasion assays

Transwell chambers (8-uM pore size; Corning, NY, USA) were used in the Transwell migration assay. After transfection, cells were seeded in the upper chamber at a density of 5 × 10⁵ with a complete culture medium and supported a culture medium without 10% FBS in the lower chamber. Invasion assays need to be Matrigel-coated (AWM, Shanghai, China) in the upper chamber. Following a 48 h (for PANC-1 and AsPC-1 cells) or 24 h (for BxPC-3 cells) incubation, we fixed the invaded cells in crystal violet solution for staining. Three random fields of each membrane were viewed under the inverted microscope, and the number of cells was counted.

2.7 Cell Counting Kit-8 (CCK-8) assay

CCK-8 (Beyotime, China) was used to measure the viability of PANC-1 and BxPC-3 cells. After synchronizing the cells at the M phase, we seeded the PDAC cells into 96-well plates. After 24h of cultivation, cells were stained with 100ul of CCK-8 reagent for 2h at 37°C. Absorbance readings for each well were measured at 450nm using a microplate reader. The absorbance of cells in each group was detected after 24, 48, 72, and 96h cultivation, respectively. The IC50 values were analyzed. Repeat it three times for each cell line.

2.8 RNA isolation and quantitative real-time PCR

Trizol reagent (Takara, 9109, China) was used to isolate RNA from tumor cells. Concentrations of RNAs were measured by Microplate Reader (BioTek, CYT5MFV, America). The Revert Aid First Strand cDNA synthesis kit (Fermentas; K1622 Thermo Fisher Scientific, Inc.) was used for cDNA generation according to the protocol. RT-qPCR was performed using the ChamQ Universal SYBR (Roche Applied Science, Penzberg, Germany) qPCR Master Mix. The relative expression levels of RNAs were calculated using the delta Ct method. Three biological replicates and three technical replicates were each used to measure all relative gene expression levels. All primers used in our study were:

USP10:

F 5’- ATTGAGTTTGGTGTCGATGAAGT − 3’

R 5’- GGAGCCATAGCTTGCTTCTTTAG − 3’

RIOK3:

F 5’- CACAATCTCGCAAGAATGCAGA − 3’

R 5’- TCAGCATGGACAAGCGTACAT − 3’

FAK:

F 5’- GCTTACCTTGACCCCAACTTG − 3’

R 50- ACGTTCCATACCAGTACCCAG − 3’

ACTB:

F 5’- CATGTACGTTGCTATCCAGGC − 3’

R 5’- CTCCTTAATGTCACGCACGAT − 3’

2.9 Western blot

Western blot analysis was performed with standard methods. Briefly, cells were lysed in radioimmunoprecipitation assay (RIPA) buffer containing protease inhibitors (Sigma, St. Louis, MO, USA) and phosphatase inhibitors (Roche, Sigma, St. Louis MO, USA). Proteins were separated by SDS/PAGE and blotted onto a PVDF membrane (Bio-Rad, Hercules, CA, USA). Membranes were probed with specific primary antibodies and then with peroxidase-conjugated secondary antibodies. Equal protein-sample loading was monitored using the Actin antibody. The bands were visualized by chemiluminescence.

2.10 Immunofluorescence

After seeding 5×10⁶ cells on the 8-chamber slide, cells were fixed with 4% paraformaldehyde and permeabilized with 0.1% Triton X-100 for 10 min. After being blocked with 10% goat serum, the permeabilized cells were incubated with anti-USP10 (1:100) and anti-RIOK3 (1:100) overnight at 4°C. Then the cells were washed in PBS, and stained with secondary antibodies (goat anti-mouse Alexa 488 and goat anti-rabbit Alexa 555) for 2 h at room temperature, followed by counterstaining with DAPI. Images were taken with a scanning confocal microscope.

2.11 Coimmunoprecipitation (Co-IP) and Flag bead pulldown assay

Briefly, cells were lysed in NETN lysis buffer. Antibodies against RIOK3 and USP10 were used for immunoprecipitation. For the Flag bead pulldown experiment, HEK 293T cells were transfected with Flag-tagged protein and lysed in NETN buffer for 20 min at 4°C. Crude lysates were subjected to centrifugation at 14500 g for 15 min at 4°C. Supernatants were incubated with Anti-Flag Affinity Gel (Bimake, B23102, Houston, TX, USA) for 6 h. The agaroses were washed three times with NETN buffer. Proteins were eluted by boiling in 19 SDS running buffers and subjected to SDS/PAGE for immunoblotting.

2.12 In vivo ubiquitination assay

In vivo deubiquitination assay: Cells were treated with 10 µM MG132 for 6 h before being harvested. Then lysis was performed with RIPA buffer containing 1% SDS, followed by mild sonication and a final boil at 95°C for 10 min. The SDS concentration of the cell lysates was diluted to 0.2% using an SDS-free lysis solution. Immunoprecipitation was carried out with the RIOK3 antibody at 4°C, and the ubiquitination level was further analyzed through Western blot.

2.13 Immunohistochemistry

Standard immunohistochemical (IHC) staining procedures were performed according to the instructions of the IHC Kit (KIHC-5; ProteinTech, Wuhan, China). USP10 antibody (1: 500), RIOK3 antibody (1:500), and FAK antibody (1:500) were used as the primary antibodies. EDTA and citrate solutions were used for antigen retrieval, depending on the antibody instructions. The H-score was used to assess the staining intensity ((H-score=∑(pi×i) = (percentage of weak intensity×1) + (percentage of moderate intensity×2) + (percentage of strong intensity×3)).

2.14 In vivo tumorigenesis study

All work performed with animals was approved by the Institutional Animal Care and Use Committee of Dalian Medical University. Pathogen-free female athymic nude mice (4–5 weeks old; 18–22 g) were purchased from the Beijing Vital River Laboratory Animal Technology Co., Ltd. (Beijing, China). All mice were housed in specific pathogen-free (SPF) environments at the Institute of Genome Engineered Animal Models for Human Disease of Dalian Medical University. A total of 1×10⁷ cells were injected subcutaneously into the nude mice. The tumor volumes were measured using a caliper every other day. At 21 days (BxPC-1) or 15 days (PANC-1), all mice were euthanized, and tumors were isolated. A total of 1×10⁶ cells were injected into nude mice's tail veins. At 28 days (AsPC-1), all mice were euthanized, and their lungs were isolated.

2.15 GSEA pathway enrichment analysis

The Log2 FC of all mRNA expression differences between USP10 and all other genes is based on the RNA-seq expression matrix of the database tumor tissues. Then, the genes were ranked based on the correlation coefficients and utilized as the input for the gene set enrichment analysis (GSEA) based PID database pathway enrichment analysis (PID, http://pid.nci.nih.gov). GSEA was performed by the ClusterProfiler R package.

2.16 Protein interaction analysis

Based on the Y2H-AOS platform, the possibility of protein binding was analyzed according to the protein CDS sequence. When the confidence score was > 0.7, the possibility of the two molecules binding was high (Ruiyuan Biological Corporation, Nanjing, China).

2.17 Statistical analysis

The Spearman correlation coefficient was used to evaluate the relationship between USP10 and RIOK3 protein expression levels in human PDAC tissues. We used the R studio and R packages (version 3.6) to analyze PDAC tissue RNA-seq data through the Toil process from The Cancer Genome Altas (TCGA) and The Genotype-Tissue Expression (GTEx) in TPM format (https://xenabrowser.net/datapages/). The mean value of the two groups was compared using paired Students t-test and paired Wilcoxon test. The One-way ANOVA test was used to compare the mean values of the two groups, while the Kaplan–Meier test was used to calculate the differences in survival. All of the relative protein expression was normalized by ImageJ (version no.: 1.8.0_112; https://imagej.nih.gov/ij/). Bars and errors represent the mean ± standard deviation (SD) of replicate measurements. *p < 0.05, **p < 0.01, and ***p < 0.001 indicate statistical significance. The SPSS 18.0 software package (SPSS, Inc., Chicago, IL, USA) was used for statistical analysis. Kaplan–Meier curves were conducted on GraphPad Prism 9.0. The difference was statistically significant at p < 0.05.

USP10 is associated with poor prognosis in PDAC

In order to investigate the expression of USP10 in PDAC tissues, we initially performed bioinformatics analysis of the TCGA and GTEx PDAC transcriptome databases. The results validated that the expression of USP10 mRNA in PDAC was significantly higher than in normal pancreatic tissues (Fig. 1A). Further Kaplan-Meier survival analysis indicated a relationship between elevated USP10 mRNA expression and worse overall survival (OS) in PDAC patients (Fig. 1B).

To further clarify the clinical significance of USP10 in PDAC, we collected two PDAC tissue microarrays from two independent medical centers (Group 1: 90 cases and Group 2: 46 cases) (Table 1). Subsequently, we performed IHC to identify the protein expression of USP10 in PDAC tissues (Fig. 1C-D). Subsequent survival analysis revealed that patients in both Group 1 and 2 with high USP10 expression had a shorter overall survival (MST: 15.0m vs. 21.8m, P = 0.007; 14.0m vs. 20.0m, P = 0.047) (Fig. 1E-F). Furthermore, there was a significant correlation between elevated USP10 expression and the occurrence of lymph node metastasis and distant metastasis, as indicated in Table 2. Overall, these results indicate that the elevated USP10 expression in PDAC tissues is associated with invasion, metastasis and poor survival.

Table 1

Baseline characteristics of patients with PDAC
Characteristics	Group 1 (n = 90)	Group 2 (n = 46)
Age
≥ 65	22 (32.4%)	22 (47.8%)
< 65	68 (67.6%)	24 (52.8%)
Gender
Male	53 (58.9%)	22 (47.8%)
Female	37 (41.1%)	24 (52.8%)
CA19-9
≥ 27U/ml	72 (80.0%)	40 (87.0%)
< 27U/ml	18 (20.0%)	6 (13.0%)
Tumor size
≥ 3cm	74 (82.2%)	36 (78.3%)
< 3cm	16 (17.8%)	10 (21.7%)
Stage
I	24 (26.7%)	15 (32.6%)
II	28 (31.1%)	21 (45.7%)
III	10 (11.1%)	3 (6.5%)
IV	28 (31.1%)	7 (15.2%)

Table 2

Correlation between USP10 expression and clinical characteristics in patients with PDAC
Characteristics	Group 1 (n = 88)			Group 2 (n = 46)
	USP10 High (n = 45)	USP10 Low (n = 45)	p	USP10 High (n = 21)	USP10 Low (n = 25)	p
Age
≥ 65	10	12	0.624	9	13	0.536
< 65	35	33	0.624	12	12	0.536
Gender
Male	25	28	0.643	9	13	0.536
Female	20	27	0.643	12	12	0.536
CA19-9
≥ 27U/ml	32	40	0.035	16	24	0.079
< 27U/ml	13	5	0.035	5	1	0.079
Tumor size
≥ 3cm	37	37	1.000	19	17	0.084
< 3cm	8	8	1.000	2	8	0.084
Node Metastasis
Yes	35	23	0.008	15	10	0.042
No	10	22	0.008	6	15	0.042
Metastasis
Yes	8	20	0.012	5	2	0.220
No	37	25	0.012	16	23	0.220

USP10 promotes a malignant phenotype in pancreatic cancer cells

To clarify the role of USP10 in the proliferation, invasion, and metastasis of PDAC cells, we stably knocked down USP10 in BxPC-3 and AsPC-1 cell lines and stably overexpressed USP10 in PANC-1 cell lines (Fig. 2A). Firstly, the results of colony formation and subcutaneous tumor formation assays indicated that overexpression of USP10 significantly promoted colony formation and tumorigenesis of PDAC cells, while USP10 knockdown had a significant inhibitory effect (Fig. 2B-E). Cell invasion and migration experiments further revealed that overexpression of USP10 significantly upregulated the invasion and migration capacity of PDAC cells, while knockdown had an inhibitory effect as well (Fig. 2F-G). In summary, these results suggest that USP10 can significantly promote tumorigenesis, invasion, and migration of PDAC cells.

USP10 was involved in the FAK signaling pathway

To clarify the specific mechanisms by which USP10 promotes the malignant phenotype of PDAC cells, we initially performed GSEA analysis using the PAAD-TCGA transcriptome database. The results revealed a significant association between USP10 and the FAK signaling pathway (Fig. 3A). To further explore the above bioinformatics analysis results, we subsequently analyzed FAK pathway-related protein expression in stable cell lines. The results showed that overexpression of USP10 promoted the protein expression and phosphorylation of FAK, as well as integrins α5, β3, and β4. Knockdown of USP10 had an inhibitory effect on the expression of these proteins (Fig. 3B). However, changes in USP10 did not affect FAK mRNA expression (Fig. 3C). Subsequently, we established stable cell lines with knockdown of FAK and knockdown of FAK followed by overexpression of USP10 and conducted phenotype experiments. The results showed that when overexpressing USP10 on the basis of FAK knockdown, it did not exhibit a significant enhancing effect on cell proliferation and invasion compared to the sole overexpression of USP10 (Fig. 3D-E). Therefore, the activation of the FAK signaling pathway plays a crucial role in USP10's promotion of the malignant phenotype of PDAC cells.

USP10 interacts with FAK and RIOK3

USP10 is a deubiquitinating enzyme, and its basic function is to stabilize the expression of substrate proteins through deubiquitination. The results have shown that overexpression of USP10 upregulates FAK protein expression but not mRNA. Following the finding that RIOK3 binds to and stabilizes FAK protein expression, we speculated that USP10, FAK, and RIOK3 interact. Endogenous co-IP tests with USP10 antibodies in PANC-1, BxPC3, and AsPC-1 cell lines showed that USP10 interacts with FAK and RIOK3 (Fig. 4A). Subsequently, co-IP experiments using RIOK3 antibodies also confirmed interactions between RIOK3 and USP10 as well as FAK (Fig. 4B). To further validate whether the interaction between USP10 and FAK depends on RIOK3, we stably knocked down the expression of RIOK3 in PANC-1 and BxPC-3 cells. The results demonstrated that RIOK3 knockdown eliminated USP10-FAK binding (Fig. 4C). This suggests that the interaction between USP10 and FAK may depend on RIOK3. Subsequently, we performed exogenous immunoprecipitation experiments in 293T cells using tagged antibodies, which verified USP10-RIOK3 interaction (Fig. 4D). Further confocal microscopy tests showed that USP10 and RIOK3 co-localize in the cell membrane and cytoplasm (Fig. 4E). Protein interaction prediction analysis of the CDS sequences of USP10 and RIOK3 also suggested the possibility of their binding (Fig. 4F). In summary, our research suggests that USP10 forms a protein complex with RIOK3 and FAK, with RIOK3 acting as a bridge between USP10 and FAK.

USP10 deubiquitinates and stabilizes RIOK3 expression

To assess whether USP10 deubiquitinated RIOK3, we first examined the protein and mRNA expression of RIOK3 in stable cell lines. The results showed that USP10 knockdown decreased RIOK3 protein expression while overexpression increased it (Fig. 5A). However, RIOK3 mRNA levels did not change (Fig. 5B). This suggests that USP10 may deubiquitinate and stabilize RIOK3 protein. Subsequent deubiquitination assay showed that USP10 knockdown increased RIOK3 ubiquitination, while overexpression decreased it. Notably, overexpressing USP10 with enzymatic active site mutation did not affect the RIOK3 ubiquitination level (Fig. 5C). To determine whether USP10 regulates RIOK3 protein stability, we conducted the cycloheximide (CHX) experiment. Results demonstrated that knocking down USP10 decreased RIOK3's protein half-life, while overexpression extended it. Additionally, overexpression of USP10 with mutated enzymatic activity sites did not affect the protein stability of RIOK3 (Fig. 5D). Furthermore, the IHC study of USP10 and RIOK3 in PDAC patients from Groups 1 and 2 indicated a significant positive correlation in protein expression between USP10 and RIOK3 (Fig. 5E-F). Overall, in PDAC, USP10 deubiquitinates and stabilizes RIOK3.

RIOK3 plays a key role in USP10-driven PDAC tumorigenesis

To further elucidate whether USP10 activates the FAK signaling pathway and promotes pancreatic cancer cell invasion, migration, and tumorigenesis via RIOK3, we overexpressed RIOK3 in stable USP10 knockdown BxPC-3 and AsPC-1 cells. Firstly, Western blot results showed that RIOK3 could re-activate the FAK pathway inhibition caused by the USP10 knockdown (Fig. 6A). Subsequent colony formation and Transwell assays confirmed that the overexpression of RIOK3 could reverse USP10 knockdown-induced cell colony formation and invasion inhibition (Fig. 6B-C). The results of subcutaneous tumor formation and lung metastasis models further clarified the critical role of RIOK3 in reversing the inhibition of tumorigenesis and invasion by USP10 knockdown in PDAC cells (Fig. 6D-E). Additionally, IHC staining results of subcutaneous tumor tissues showed that the protein expression of both RIOK3 and FAK decreased after USP10 knockdown, but the expression of FAK was upregulated in the RIOK3 overexpression group compared to the USP10 knockdown group (Fig. 6F). The above results suggest that RIOK3 plays an important role in the activation of the FAK pathway and tumorigenesis mediated by USP10 in PDAC cells.

USP10 and RIOK3 co-expression is significantly associated with poor prognosis in PDAC

In order to further reveal the correlation between USP10-RIOK3 protein expression and the development of pancreatic cancer, we further detected RIOK3 protein expression in the TMAs. The results showed that high expression of RIOK3 in PDAC patients in both Group 1 and 2 was associated with poorer OS (MST: 13.3m vs. 20.0m, P = 0.0002; 14.0m vs. 20.0m, P = 0.019) (Fig. 7A-B). Importantly, patients with high expression of both USP10 and RIOK3 had significantly worse OS (MST: 12.0m vs. 21.0m, P = 0.027; 14.0m vs. 20.0m, P = 0.005) (Fig. 7C-D). Decision curve analysis (DCA) for other factors that may affect the OS of PDAC patients showed that the net benefit of the combined expression of USP10 and RIOK3 was the highest (Fig. 7E). Therefore, we constructed a Nomogram prognostic model based on the Cox multivariate regression results of these factors and conducted Calibration analysis. The model's predicted survival rates were highly consistent with the observed survival rates, indicating that this prognostic model has a high level of accuracy (Fig. 7F-G). In conclusion, high expression of the USP10-RIOK3 protein can serve as an adverse prognostic factor for PDAC.

USP10 is the biomaker of FAK inhibitor efficacy in PDAC

Our study found that USP10 activated the FAK pathway in PDAC, so we speculated that USP10 could predict the efficacy of FAKi. We performed subcutaneous tumors in nude mice with PANC-1 cell line. USP10 overexpression and Control group received FAKi treatment on 15th d (Fig. 8A). The results showed that USP10 high expression mice changed more significantly compared with the control group receiving FAKi treatment (Fig. 8B-C). Moreover, the tumors size of the high USP10 expression group mice continued to shrink, and the tumors size of the Control group begined slowly to increase at 35th dt (Fig. 8B-C). In conclusion,USP 10 high expression may be an effective biomarker for FAKi treatment of PDAC.

PDAC is one of the most challenging malignant tumors, characterized by high invasiveness and a lack of reliable therapeutic targets^[30]. Given the crucial role of the FAK pathway in PDAC, further exploration of the regulatory mechanism of FAK protein may provide a basis for targeted therapy with FAK. In this study, we found that USP10 binds and stabilizes RIOK3, thereby activating the FAK pathway, and promoting PDAC tumorigenesis in vitro and in vivo. It can also serve as a biomarker for predicting patient prognosis.

USP10 is a crucial member of the deubiquitinase family, reversing substrate ubiquitination by removing ubiquitin molecules from the C-terminus of ubiquitin-bound target proteins^{[24, 25]}. It plays diverse roles in maintaining cellular protein homeostasis, contributing to various functions in tumor initiation and progression^[25]. The role of USP10 in promoting or inhibiting tumors is determined by its interaction with substrates in different tumor backgrounds. USP10 interacts with YAP/TAZ and SMAD4, stabilizing them to promote hepatocellular carcinoma proliferation^{[31, 32]}. Another study suggests that USP10 inhibits the polyubiquitination of AMPKα and PTEN to suppress hepatocellular carcinoma progression^{[33, 34]}. In lung cancer, conflicting reports exist, with some indicating that USP10 enhances PTEN stability and activity to inhibit non-small cell lung cancer cell proliferation^[35], while another study suggests that USP10 deubiquitinates the oncogenic protein HDAC6, conferring cisplatin resistance in non-small cell lung cancer^[36]. These contradictory conclusions may stem from different cellular contexts in tumors. In this study, we found that USP10, as a deubiquitinase, is enriched in the FAK pathway in the TCGA-PAAD database and is associated with a poor prognosis. In vitro and in vivo experiments confirmed that USP10 activates the FAK pathway and promotes the malignant phenotype of PDAC cells. However, while in vivo experiments showed an interaction between USP10 and FAK, no direct interaction was observed in vitro, suggesting the possible existence of a "bridge protein" between them.

RIOK3 plays a crucial role in the invasion and metastasis of PDAC. RIOK3 activates the small G protein Rac, changes the cell cytoskeleton structure, and promotes the migration and invasion of pancreatic cancer cells^{[21, 22]}. Our previous studies found that RIOK3 binds to FAK in PDAC cells and promotes the phosphorylation and protein expression of tyrosine 397 and 925 sites of FAK^[22]. The biological function of RIOK3 in increasing the invasion and migration of PDAC cells depends on the activation of FAK. Our study found that USP10, RIOK3, and FAK can interact to form a protein complex. Knocking down RIOK3 significantly inhibits the protein binding of USP10 and FAK, as well as the activation of FAK and the tumorigenic ability of PDAC cells brought about by the overexpression of USP10. This also suggests that RIOK3 may be the crucial "bridge protein" between USP10 and FAK. Further research found that USP10 deubiquitinates and stabilizes RIOK3, and the co-expression of USP10 and RIOK3 is associated with a worse prognosis in PDAC patients. In addition, we conducted COX regression analysis on the positive co-expression of USP10 and RIOK3 and other factors affecting PDAC survival, establishing a predictive model for PDAC prognosis, that was validated to have high accuracy.

Our study confirms that USP10 promotes the activation of the FAK pathway in PDAC cells by deubiquitinating and stabilizing RIOK3. The co-expression of USP10 and RIOK3 can be a potential prognostic factor for PDAC. And USP10 can be the FAKi efficacy biomaker in PDAC. Overall, the results of this study are expected to provide a theoretical basis for the treatment of PDAC targeting USP10/RIOK3/FAK and to offer potential clues for the development of therapeutic strategies targeting FAK (Fig. 9).

FAK Focal Adhesion Kinase

PDAC Pancreatic ductal adenocarcinoma

RIOK3 RIO Kinase 3

USP10 Ubiquitin-specific protease 10

FERM Four-point-one, ezrin, radixin, and moesin ()

MMPs Matrix metalloproteinases

FAKi FAK inhibitors

CCK-8 Cell Counting Kit-8

RIPA Radioimmunoprecipitation assay

Co-IP Coimmunoprecipitation

IHC Immunohistochemical

TCGA The Cancer Genome Altas

GTEx The Genotype-Tissue Expression

OS Overall survival

CHX Cycloheximide

Ethics approval and consent to participate

The experiments were approved by the Research Ethics Committee of Shanghai Outdo Biotech Company and the First Affiliated Hospital of Dalian Medical University. All human samples included in the study were handled by the tenets of the Declaration of Helsinki.

Consent for publication

All contributing authors agreed to the publication of this article.

Competing interests

The authors announced no conflicts of interest.

Availability of data and materials

The data used in this study for gene expression profiling interactive analysis(http://gepia2.cancer-pku.cn) are available in TCGA (https://tcga-data.nci.nih.gov/). Other datasets used and/or analyzed during the current study are available from the corresponding author upon reasonable request.

Authors' contributions

H.Q., Z.N., A.W., and J.L. devised and coordinated the project. R.S. and P.Y. supervised the project. H.Q., R.S., and Z.N. performed most of the experiments. H.Q., A.W., P.Y., X.G., and Z.K. analyzed data. W.Z., S.L., Y.T., L.F. and X.M. provided significant intellectual input. H.Q., A.W., P.Y., and J.L. wrote the manuscript with input from all other authors.

Formatting of funding sources

This study is supported by the National Natural Science Foundation of China grants (No. 82172793, No. 81802272 and 81502024).

Acknowledgments

Not applicable.

Mizrahi JD, Surana R, Valle JW, et al. Pancreat cancer[J] Lancet. 2020;395(10242):2008–20.
Wood LD, Canto MI, Jaffee EM, et al. Pancreatic Cancer: Pathogenesis, Screening, Diagnosis, and Treatment[J]. Gastroenterology. 2022;163(2):386–402e381.
Siegel RL, Miller KD, Wagle NS, et al. Cancer statistics, 2023[J]. CA Cancer J Clin. 2023;73(1):17–48.
Rahib L, Smith BD, Aizenberg R, et al. Projecting cancer incidence and deaths to 2030: the unexpected burden of thyroid, liver, and pancreas cancers in the United States[J]. Cancer Res. 2014;74(11):2913–21.
Zhou J, Yi Q, Tang L. The roles of nuclear focal adhesion kinase (FAK) on Cancer: a focused review[J]. J Exp Clin Cancer Res. 2019;38(1):250.
Lim ST, Mikolon D, Stupack DG, et al. FERM control of FAK function: implications for cancer therapy[J]. Cell Cycle. 2008;7(15):2306–14.
Mitra SK, Hanson DA, Schlaepfer DD. Focal adhesion kinase: in command and control of cell motility[J]. Nat Rev Mol Cell Biol. 2005;6(1):56–68.
Chen JS, Huang XH, Wang Q, et al. Sonic hedgehog signaling pathway induces cell migration and invasion through focal adhesion kinase/AKT signaling-mediated activation of matrix metalloproteinase (MMP)-2 and MMP-9 in liver cancer[J]. Carcinogenesis. 2013;34(1):10–9.
Lu H, Hu L, Yu L, et al. KLF8 and FAK cooperatively enrich the active MMP14 on the cell surface required for the metastatic progression of breast cancer[J]. Oncogene. 2014;33(22):2909–17.
Schaller MD. Cellular functions of FAK kinases: insight into molecular mechanisms and novel functions[J]. J Cell Sci. 2010;123(Pt 7):1007–13.
Zhao J, Guan JL. Signal transduction by focal adhesion kinase in cancer[J]. Cancer Metastasis Rev. 2009;28(1–2):35–49.
Fan T, Chen J, Zhang L, et al. Bit1 knockdown contributes to growth suppression as well as the decreases of migration and invasion abilities in esophageal squamous cell carcinoma via suppressing FAK-paxillin pathway[J]. Mol Cancer. 2016;15:23.
Skinner HD, Giri U, Yang L, et al. Proteomic Profiling Identifies PTK2/FAK as a Driver of Radioresistance in HPV-negative Head and Neck Cancer[J]. Clin Cancer Res. 2016;22(18):4643–50.
Balsas P, Palomero J, Eguileor Á, et al. SOX11 promotes tumor protective microenvironment interactions through CXCR4 and FAK regulation in mantle cell lymphoma[J]. Blood. 2017;130(4):501–13.
Nader GP, Ezratty EJ, Gundersen GG. FAK, talin and PIPKIγ regulate endocytosed integrin activation to polarize focal adhesion assembly[J]. Nat Cell Biol. 2016;18(5):491–503.
Pomella S, Cassandri M, Braghini MR et al. New Insights on the Nuclear Functions and Targeting of FAK in Cancer[J]. Int J Mol Sci, 2022, 23(4).
Blair AB, Wang J, Davelaar J, et al. Dual Stromal Targeting Sensitizes Pancreatic Adenocarcinoma for Anti-Programmed Cell Death Protein 1 Therapy[J]. Gastroenterology. 2022;163(5):1267–1280e1267.
Jiang H, Liu X, Knolhoff BL, et al. Development of resistance to FAK inhibition in pancreatic cancer is linked to stromal depletion[J]. Gut. 2020;69(1):122–32.
Zhao XK, Cheng Y, Liang Cheng M, et al. Focal Adhesion Kinase Regulates Fibroblast Migration via Integrin beta-1 and Plays a Central Role in Fibrosis[J]. Sci Rep. 2016;6:19276.
Singleton DC, Rouhi P, Zois CE, et al. Hypoxic regulation of RIOK3 is a major mechanism for cancer cell invasion and metastasis[J]. Oncogene. 2015;34(36):4713–22.
Zhang T, Ji D, Wang P, et al. The atypical protein kinase RIOK3 contributes to glioma cell proliferation/survival, migration/invasion and the AKT/mTOR signaling pathway[J]. Cancer Lett. 2018;415:151–63.
Xu M, Fang L, Guo X, et al. RIOK3 promotes pancreatic ductal adenocarcinoma cell invasion and metastasis by stabilizing FAK[J]. Heliyon. 2022;8(8):e10116.
Luo P, Qin C, Zhu L, et al. Ubiquitin-Specific Peptidase 10 (USP10) Inhibits Hepatic Steatosis, Insulin Resistance, and Inflammation Through Sirt6[J]. Hepatology. 2018;68(5):1786–803.
Tao L, Liu X, Jiang X et al. USP10 as a Potential Therapeutic Target in Human Cancers[J]. Genes (Basel), 2022, 13(5).
Bhattacharya U, Neizer-Ashun F, Mukherjee P, et al. When the chains do not break: the role of USP10 in physiology and pathology[J]. Cell Death Dis. 2020;11(12):1033.
Gao Y, Zhang X, Xiao L et al. Usp10 Modulates the Hippo Pathway by Deubiquitinating and Stabilizing the Transcriptional Coactivator Yorkie[J]. Int J Mol Sci, 2019, 20(23).
Jochemsen AG, Shiloh Y. USP10: friend and foe[J]. Cell. 2010;140(3):308–10.
Lim R, Sugino T, Nolte H, et al. Deubiquitinase USP10 regulates Notch signaling in the endothelium[J]. Science. 2019;364(6436):188–93.
Gillespie SR, Tedesco LJ, Wang L, et al. The deubiquitylase USP10 regulates integrin β1 and β5 and fibrotic wound healing[J]. J Cell Sci. 2017;130(20):3481–95.
Cai J, Chen H, Lu M, et al. Advances in the epidemiology of pancreatic cancer: Trends, risk factors, screening, and prognosis[J]. Cancer Lett. 2021;520:1–11.
Yuan T, Chen Z, Yan F, et al. Deubiquitinating enzyme USP10 promotes hepatocellular carcinoma metastasis through deubiquitinating and stabilizing Smad4 protein[J]. Mol Oncol. 2020;14(1):197–210.
Zhu H, Yan F, Yuan T, et al. USP10 Promotes Proliferation of Hepatocellular Carcinoma by Deubiquitinating and Stabilizing YAP/TAZ[J]. Cancer Res. 2020;80(11):2204–16.
Deng M, Yang X, Qin B, et al. Deubiquitination and Activation of AMPK by USP10[J]. Mol Cell. 2016;61(4):614–24.
Lu C, Ning Z, Wang A, et al. USP10 suppresses tumor progression by inhibiting mTOR activation in hepatocellular carcinoma[J]. Cancer Lett. 2018;436:139–48.
He Y, Jiang S, Mao C, et al. The deubiquitinase USP10 restores PTEN activity and inhibits non-small cell lung cancer cell proliferation[J]. J Biol Chem. 2021;297(3):101088.
Hu C, Zhang M, Moses N, et al. The USP10-HDAC6 axis confers cisplatin resistance in non-small cell lung cancer lacking wild-type p53[J]. Cell Death Dis. 2020;11(5):328.

No competing interests reported.

Download PDF

Version 1

posted

You are reading this latest preprint version

USP10 activates the FAK pathway by stabilizing RIOK3 in pancreatic ductal adenocarcinoma

Status:

Version 1

Abstract

Background

Methods

Results

Conclusion

Figures

1. Introduction

2. Materials and Methods

2.1. Clinical specimens

2.2. Antibodies and Inhibitors

2.3 Cell culture

2.4 Plasmids

2.5 Cell colony formation

2.6 Migration and invasion assays

2.7 Cell Counting Kit-8 (CCK-8) assay

2.8 RNA isolation and quantitative real-time PCR

2.9 Western blot

2.10 Immunofluorescence

2.11 Coimmunoprecipitation (Co-IP) and Flag bead pulldown assay

2.12 In vivo ubiquitination assay

2.13 Immunohistochemistry

2.14 In vivo tumorigenesis study

2.15 GSEA pathway enrichment analysis

2.16 Protein interaction analysis

2.17 Statistical analysis

3. Results

4. Discussion

Abbreviations

Declarations

References

Additional Declarations

Status:

Version 1