Cell isolation and culture
hHFMSCs were isolated and identified as described in our previous work [3, 4]. hHFMSCs were cultured in H-DMEM/F12 (Gibco) supplemented with 10% FBS (Gibco), 10 ng/ml bFGF (Acro Biosystems), and 100 U/ml penicillin‒streptomycin (Solarbio). The hHFMSCs were frozen in a cryopreservation solution composed of 50% H-DMEM/F12 medium, 40% FBS and 10% dimethyl sulfoxide and stored in liquid nitrogen at passages 0–2. The cells were thawed and expanded for experimentation at passages 2–3. hHFMSCsOCT4, floating hHFMSCsOCT4, and adherent hHFMSCsOCT4 were maintained in hHFMSCs medium on Matrigel (Corning)-coated culture plates.
Lentivirus transduction and prestimulation with haematopoietic cytokines
hHFMSCs were transduced with the lentiviral vector pLV-EF1-OCT4-IRES-EGFP as previously described [4]. In brief, hHFMSCs seeded onto Matrigel-coated plates were infected with lentivirus expressing OCT4 in the presence of polybrene and expanded for 7 days in hHFMSC medium. The transduced hHFMSCs (hHFMSCsOCT4) were induced in prestimulation medium supplemented with 100 ng/ml FLT3, 100 ng/ml SCF, 10% FBS (Gibco), and 100 U/ml penicillin‒streptomycin (Solarbio) for 7 days, and the medium was replaced with hHFMSC medium to continually expanded. The subpopulation of floating cells emerged and was harvested from the upper medium of adherent cells (800 rpm, 5 minutes), seeded onto Matrigel-coated. When the cells proliferated to 70%-80%, they were digested with 0.25% trypsin-ethylene diamine tetra-acetic acid (EDTA) and subsequently subcultured.
Dissociation assay
Cell‒cell adhesion was assayed through a dispase disassociation assay as previously described [5]. Cells were seeded on Matrigel-coated 24-well plates at a density of 2×105 cells/well and cultured overnight until the cells reached confluence. The percentage of single cells relative to the total number of cells was calculated after treatment with dispase II (2.4 U/mL; Sigma-Aldrich) and staining with 0.1% crystal violet. Each sample was tested three times, and three counts were taken per well.
Cell adhesion assay
Cell-extracellular matrix adhesion was assayed as previously reported with minor modifications [5]. The cells were plated in 24-well plates at a density of 2×105 cells/well and cultured until the hHFMSCs adhered to the plates and fully expanded. The plates were washed with digestive enzyme-free PBS, and the remaining cells were stained with 0.1% crystal violet. The percentage of remaining cells relative to the total number of cells was proportional to the cell-extracellular matrix adhesion. Each sample was tested three times, and three counts were taken per well.
Immunofluorescence (IF)
Cells were seeded on glass slides in 24-well plates at a density of 104 cells/well, fixed with 4% paraformaldehyde (Solarbio) for 20 minutes, and subsequently permeabilized with 0.1% Triton X-100 (Solarbio) for 20 minutes at room temperature (RT). BSA/PBS (1%) was used to block nonspecific binding. The cells were then incubated with primary antibody (mouse anti-human OCT3/4 antibody, ready-to-use, Maxim), mouse anti-human β-catenin antibody (1:150 dilution, Maxim) or PBS (as a negative control) at 4°C overnight. The next day, Alexa Fluor 594-conjugated goat anti-mouse IgG (1:200 dilution, Abcam) was added to the slides and incubated for 1 hour at RT. The nuclei were counterstained with 5 µg/ml DAPI (Solarbio) for 5 minutes in the dark, and the cells were visualized with a fluorescence microscope (Olympus).
RT‒qPCR
Total RNA was isolated using TRIzol Reagent (Sparkjade, China). cDNA was synthesized with the Prime Script RT reagent Kit (+ gDNA Eraser) and then subjected to qPCR using TB Green® Premix Ex Taq™ II (TaKaRa). The gene mRNA levels were determined using 50 ng of cDNA on an Applied Biosystems 7500 real-time PCR system, and the samples were normalized to GAPDH with the autoset baseline. The relative expression was calculated as 2−ΔΔCt. The primer sequences are provided in Table 1.
Table 1
Gene | Forward primer | Reverse primer |
OCT4 | CTGAAGCAGAAGAGGATCAC | GACCACATCCTTCTCGAGCC |
ZO-1 | CAACATACAGTGACGCTTCACA | CACTATTGACGTTTCCCCACTC |
ACTN2 | GACATCGTGAACACCCCTAAAC | CCGCAAAAGCGTGGTAGAA |
β-catenin | CTGGTCCTTTTTGGTCGAGGA | GCAAGGCTAGGGTTTGCTAAAT |
E-cadherin | ACCACGGGCTTGGATTTTGA | GGAGGTGGTGAGAGAGACCT |
Cyclin D1 | CAAGGCCTGAACCTGAGGAG | GATCACTCTGGAGAGGAAGCG |
GAPDH | CCATGTTCGTCATGGGTGTGA | CATGGACTGTGGTCATGAGT |
Western blot analysis
The cells were harvested and lysed in ice-cold radioimmunoprecipitation assay lysis buffer (Solarbio) supplemented with 1% phenylmethylsulfonyl fluoride (Solarbio) and then centrifuged at 12,000 × g at 4°C for 30 minutes to remove cell debris. The protein concentration was determined by using a BCA Protein Assay Kit (Solarbio). Equal amounts of proteins were subjected to sodium dodecyl sulphate‒polyacrylamide gel electrophoresis (SDS‒PAGE), after which the proteins were transferred to polyvinylidene fluoride membranes (Millipore). The membrane was incubated with 5% non-fat milk and then incubated with primary antibodies at 4°C overnight. Then, the membrane was incubated with an HRP-conjugated secondary antibody at RT for 2 hours. The membranes were finally stained with an enhanced chemiluminescence (ECL) Western blot system (Millipore). The optimal dilutions of antibodies used for Western blot analysis are provided in Table 2.
Table 2
Optimal dilutions of antibodies used for Western blot analysis
Antibodies | Dilution rates | experiment |
Mouse Anti-Human β-Actin antibody (Bioss) | 1:5000 | Western blot |
Rabbit Anti-Mouse ZO-1 antibody (Cell Signaling Technology) | 1:2500 | Western blot |
Mouse Anti-Human OCT3/4 Ready-to-Use antibody (Maxim) | 1:4 | Western blot |
Goat Anti-Rabbit IgG/HRP (Bioss) | 1:3000 | Western blot |
Goat Anti-Mouse IgG (H + L) (Elabscience) | 1:10000 | Western blot |
Mouse Anti-Human ACTN2 antibody Ready-to-Use (Maxim) | 1:4 | Western blot |
Mouse Anti-Human E-cadherin antibody (Maxim) | 1:1500 | Western blot |
Mouse Anti-Human β-catenin antibody (Maxim) | 1:1500 | Western blot |
Wright-Giemsa staining
Cells were seeded on glass slides in 24-well plates at a density of 104 cells/well and fixed with methanol for 10 minutes. The cells were stained with Wright-Giemsa dye for 20 minutes, soaked in PBS for 10 minutes and quickly washed in distilled water.
Coomassie brilliant blue staining
Cells were seeded on glass slides in 24-well plates at a density of 104 cells/well and treated with 0.1% Triton X-100 for 20 minutes. Then, the cells were fixed with 3% glutaraldehyde for 15 minutes and stained with 0.2% Coomassie Brilliant Blue R250 (Beyotime) for 40 minutes.
Phalloidin staining
Cells were seeded on glass slides in 24-well plates at a density of 104 cells/well and fixed in 4% paraformaldehyde for 20 minutes. Then, the cells were treated with 0.1% Triton X-100 for 30 minutes. Next, the cells were incubated with Alexa Fluor® 555 Phalloidin (Beyotime) for 20 minutes, and the nuclei were counterstained with 5 µg/ml DAPI for 5 minutes in the dark at RT.
Cell Counting Kit-8 (CCK-8) assay
Cells were seeded in Matrigel-coated 96-well plates at a density of 1000 cells/well and monitored for 7 days at 37°C in a 5% CO2 atmosphere with one change of fresh medium on day 4. CCK-8 working solution was added to each well, and the cells were incubated for 2 hours. The absorbance at 450 nm was measured.
Colony formation assay
Cells were seeded in Matrigel-coated 6-well plates at a density of 20 cells/cm2 and were allowed to grow for 5 to 7 days until colonies were visible. The cells were washed with PBS, fixed with 4% paraformaldehyde for 15 minutes and then stained with 0.1% crystal violet for 30 minutes. The stained clones were counted, and the rate of clone formation was calculated as follows:
(number of stained clones/number of seeded cells) × 100%.
Immunocytochemistry (ICC)
Cells were seeded on glass slides in 24-well plates at a density of 104 cells/well, fixed with 4% paraformaldehyde (Solarbio) at RT for 20 minutes, and subsequently permeabilized with 0.1% Triton X-100 (Solarbio) for 20 minutes at RT. ICC staining was performed using a standard immunoperoxidase staining procedure (mouse anti-human Ki67 antibody, 1:150 Maxim) and PBS (as a negative control) at 4°C overnight. Haematoxylin was used as a counterstain.
RNA sequencing and GO enrichment analysis
The expression profiles of mRNAs from hHFMSCs, adherent hHFMSCsOCT4, and floating hHFMSCsOCT4 were determined by next-generation sequencing (NGS) as previously described [5]. The filtered clean reads were mapped to the reference genome database (accession number: GCF_000001405.38) by Hisat2, v2.2.1.0 (http://ccb.jhu.edu/software/hisat2/index.shtml). The fold change (FC) and significant difference were used to screen the DEGs. DEGs with FC values greater than 2 or lower than − 2 and a P value lower than 0.05 were considered significant. For each group of cells, three independent biological replicates were sequenced. GO enrichment analysis of the DEGs was carried out via functional annotation in the DAVID database (https://david.ncifcrf.gov/), and the P value and false discovery rate (FDR) were ultimately obtained. Significant genes were visualized by the Search Tool for the Retrieval of Interacting Genes/Proteins (STRING) database (http://string-db.org/), and the network was constructed using Cytoscape software (https://cytoscape.org/).
RNA interference (RNAi)
The siRNA sequences used for ZO-1 in our experiments were designed and generated by RiboBio. Cells were seeded on glass slides in 24-well plates at a density of 1×105-5×105 cells/well and treated with ribo FECT™ CP compound (RiboBio) at 37°C in a 5% CO2 atmosphere when the cell density reached 30%-50%. Floating hHFMSCsOCT4 were transfected with siRNA or negative control (NC) for 24–96 h to determine the optimal silencing conditions. The expression of Cy3 was observed via fluorescence microscopy. The plasmid vector information used for siRNA transfection is provided in Table 3.
Table 3
The plasmid vector information for siRNA transfection
Product identification | Name of commodity | Target sequences of ZO-1 |
stB0002562A | genOFFTM st-h-TJP-1_001 | GTAGGAGATTCTTTCTATA |
stB0002562B | genOFFTM st-h-TJP-1_002 | GCAAAGACATTGATAGAAA |
stB0002562C | genOFFTM st-h-TJP-1_003 | GGATCCATATCCCGAGGAA |
Statistical analysis
All the numerical data from the disassociation assay, cell adhesion assay, RT‒qPCR, Western blot, IF, and ICC are presented as the means ± standard deviations. Comparisons between two groups were performed with Student’s t tests (GraphPad Prism 8.0.2). The results were considered significant at P < 0.05.