2.1 Establishment of animal models
5-week-old male C57BL/6J mice were purchased from the animal experiment center of East China Normal University (Shanghai, China). The mice were housed appropriately (12 h light/dark cycle, 22 ± 2°C temperature, 40–70% relative humidity) with access to food and water ad libitum. Mice were subjected to adaptive feeding for one week and were used for the following experiments.
2.1.1 Diabetes model
The mice were randomly divided into four groups: (1) normal chow diet (CON); (2) normal chow diet + exercise (EX); (3) 45%HFD + STZ (STZ, S0130, Sigma-Aldrich) (DM); and (4) 45%HFD + STZ + exercise (DM + EX). The DM group mice were fed 45%HFD for 4 weeks. After 4-week HFD feeding, the DM group mice were subjected to a single intraperitoneal injection of 100 mg/kg of streptozotocin, which was freshly dissolved in a 0.1 mol/L sodium citrate buffer with a pH of 4.5. Mice with fasting blood glucose (FBG) levels exceeding 11.1 mmol/L were identified as diabetic mice and were continuously fed with 45% HFD for 9 weeks. As a control of DM, mice were fed a normal chow diet for four weeks, then injected with an equal volume of sodium citrate buffer, similar to the DM group, and maintained on the normal chow diet for 9 weeks. Treadmill exercise was conducted one week after intraperitoneal injection of STZ or sodium citrate buffer. The exercise adaption protocol was performed at 5 min for warming up (6 m/min), 30 min for formal training (8 m/min), 5 min for relaxing (6 m/min), and 3 days/week. After 1 week of exercise adaption, mice were subjected to formal exercise training. The training protocol was performed at 5 min for warming up (8 m/min), 50 min for formal training (12 m/min), and 5 min for relaxing (8 m/min), 5 days/week for 8 weeks.
2.1.2 HFD-induced obesity Model
The mice were randomly divided into three groups: (1) normal chow diet (CON); (2) 60%HFD (HFD); and (3) 60%HFD + exercise (HE). The HFD group mice were fed 60% HFD for either 10 or 15 weeks. Simultaneously, the CON group mice were fed a normal chow diet for either 10 or 15 weeks. The exercise adaption protocol was that speed increased from 7 m/min to 13 m/min, and the running duration increased from 15 min/day to 60 min/day for 1 week. The exercise training protocol was 5 min for warming up (7 m/min), 60 min for formal training (13 m/min), and 5 min for relaxing (7 m/min) for 10 or 15 weeks.
2.1.3 Body compositions
One day after the last exercise training session, the body compositions of live mice were measured using the AccuFat MRI system (AccuFat-1050, MAG-MED, China).
2.1.4 Glucose tolerance test (GTT) and insulin tolerance test (ITT)
GTT and ITT experiments were carried out during the last two weeks of the experiment. The mice in each group were assigned to receive GTT and ITT experiments in a random manner. The assay was performed according to the previous study28. Specifically, to test insulin tolerance, mice were given an intraperitoneal injection of insulin (0.75U/kg body weight) after 4 h of fasting. To test glucose tolerance, mice were given an intraperitoneal injection of glucose (1.25 g/kg body weight) after 6 h of fasting. Blood glucose levels were measured from tail venous blood before (0min) and after insulin or glucose injection at 15, 30, 45, 60, 90, and 120 min.
2.1.5 Echocardiography
Echocardiograms were performed in M mode using the Vevo 3100 echocardiography system (VisualSonics Inc., Canada). In brief, mice were lightly anaesthetized with isoflurane (2.5% for induction and 1.5% for maintenance). M-mode echocardiogram was performed on the parasternal long-axis section of the left ventricle (LV) to record the end-systolic and the corresponding end-diastolic LV anterior wall thickness (LVAWs and LVAWd) as well as LV inner diastolic and systolic dimensions (LVIDd and LVIDs). The measurements were obtained from at least three beats at a similar stabilized heart rate and were averaged. All echocardiograms were performed by an experienced investigator blind to the animal treatments.
2.2 Cell culture and experimental treatments
Rat myocardial cell line H9C2 was purchased from the Stem Cell Bank, Chinese Academy of Sciences. H9C2 cells were cultured at 37°C, 5% CO2 in high glucose Dulbecco’s modified eagle medium (DMEM)(Gibico, 11995065, USA) supplemented with 10% (vol/vol) fetal bovine serum, penicillin (100 U/mL), and streptomycin (100 µg/mL). When H9C2 cells had reached 80% confluency, they were seeded and cultured in 6-well or 96-well plates with low glucose DMEM (Gibico, 11885084, USA) for the subsequent experiments.
2.2.1 Drug treatments
H9C2 cells were treated with the indicated concentrations of glucose (Sigma, G7021) and PA (Sigma, P0500) for 24h at a confluency of 80%. The PA was conjugated with 15% BSA solution to prepare a 10 mM stock solution. At the same time, the PA-free 15% BSA was used as control reagents added to cells to ensure that each well received an equal volume of BSA. Mannitol was used to balance the osmolarity of the solution, depending on the glucose concentration. For the AICAR (Selleckchem, S1802, USA) treatment, cells were treated with various concentrations of AICAR (0.1-2mM dissolved in Ultrapure water) for 24 h concurrently with glucose and PA treatment. For the MCC950 (Selleckchem, S7809, USA) treatment, cells were treated with the inhibitors MCC950 (5nM dissolved in DMSO according to the manufacturer’s instruction) 10–20 min prior to glucose and PA treatment. KCl (25 mM) and CaCl2 (0.9 or 1.8 mM) were added together with PA treatment and cultured in a Calcium-free medium (Yuchunbio, YC-2067, China).
2.2.2 Transfection
Cell transfection was performed in 6-well or 24-well plates using Lipo8000 transfection reagent (Beyotime, C0533, China) according to the manufacturer's protocol. H9C2 cells were pre-plated one day before transfection and grew to be 60–70% confluent. Then 3ul liposomes were mixed with 100pmol siRNA (per well of a 6-well plate), or 0.8 µl liposomes were mixed with 20 pmol siRNA (per well of a 24-well plate) incubated at room temperature for 15 min to prepare siRNA/liposome complexes. The complexes were added to the cells and incubated for 6 hours. During the transfection procedure, we utilised a l low glucose DMEM supplemented with 10% FBS, as the presence of serum in the medium would not interfere with the effectiveness of lipo8000. Consequently, cells were in a good growth status and incubated for 6 hours, ultimately achieving a cell confluence of 80–90%. Following this, the transfect medium was aspirated and replenished with low glucose DMEM or treated with PA and glucose for another 24 h.
Rat P2X7 siRNA, rat P2X4 siRNA, and nontargeting control siRNA were custom-designed and synthesized by RiboBio. The sequences of control and target siRNAs against rat genes are listed in Table 1.
Table 1
Designation | species | Sequence (5'-3') |
si-negative control | Rat | TTCTCCGAACGTGTCACGT |
si-P2rx4-1 | Rat | CCTGATAAGACCAGCATTT |
si-P2rx4-2 | Rat | CCCTCTTGGTAAAGAACAA |
si-P2rx4-3 | Rat | TCTACTGCATGAAGAAGAA |
si-P2rx7-1 | Rat | GGATGGACCCACAAAGTAA |
si-P2rx7-2 | Rat | GAGGAAAGTTTGACATCAT |
si-P2rx7-3 | Rat | GTGCAGTGAATGAGTACTA |
2.3 ATP content/Cell viability
Cells were seeded at a concentration of 5×103 cells per well in 96-well plates in triplicate and cultured for 24 h. After treatment, cell viability was assessed by CellTiter-Lumi™ Luminescent Cell Viability Assay Kit (Beyotime, C0058, China) based on ATP content, representing the number of active cells. Detail operation steps were followed as previously described 29. The luminescence levels were detected using a microplate reader (TECAN Infinite M200, Switzerland).
2.4 LDH release assay
LDH release was quantified using the LDH Cytotoxicity Assay Kit (Beyotime, C0017, China) according to the manufacturer’s protocol. In brief, after 24 h treatment, cellular supernatants were replaced with DMEM containing 1%FBS and cultured for another 6 hours to collect LDH released by the cells, as the medium containing 10%FBS and BSA may affect the LDH value. A volume of 120 µl of 1%FBS DMEM supernatant from each well was transferred to a separate 96-well plate. Subsequently, the detection buffer was mixed with the supernatant and incubated at room temperature for 30 min avoid light. Finally, the mixed liquor was detected at a wavelength of 490 nm by a microplate reader (TECAN Infinite M200, Switzerland). A wavelength of 690 nm was employed as the reference wavelength for dual-wavelength determination.
2.5 Caspase 1 activity assay
The activity of Caspase 1 was measured with a Caspase 1 Activity Assay Kit (Beyotime, C1101, China) according to the manufacturer’s instructions. Briefly, H9C2 cells were harvested and lysed on ice using the lysis buffer provided in the assay kit. Subsequently, the cell lysates were incubated with a substrate of Caspase 1 (Ac-YVAD-pNA, acetyl-Tyr-Val-Ala-Asp p-nitroanilide) to produce the yellow formazan product pNA at 37°C for 1 hour. The pNA levels were detected at a wavelength of 405 nm by a microplate reader (TECAN Infinite M200, Switzerland). The protein concentration of cell lysate was measured using the Bradford Protein Assay Kit (Beyotime, P0010, China) at a wavelength of 595 nm.
2.6 NADPH oxidase (NOX) activity assay
NOX activity of cells was collected by a spectrophotometer (Specord Plus 210, Analytic Jena AG, Jena, Germany) following the instruction of the commercial NOX activity kit (Solarbio, BC0630, China).
2.7 Reactive oxygen species (ROS) detection
After treatment, cellular ROS generation was measured by ROS Assay Kit (Beyotime, S0033, China) utilizing a fluorescent probe DCFH-DA. H9C2 cells were preincubated with 10 µM DCFH-DA at 37°C for 20 min, then cellular ROS was quantified using a microplate reader (TECAN Infinite M200, Switzerland) at the exciting light was 488 nm, and the emitted light was 525 nm. Moreover, the accumulation of ROS in H9C2 cells was also verified microscopically (IX71, Olympus, Japan).
2.8 Measurement of MDA levels
The contents of MDA in the heart tissue were detected using a commercial kit (Beyotime, S0131, China) according to the instructions. The sample and MDA detection working solution were mixed and performed as described before 30, and the absorbance was measured at 532 nm using a microplate reader (TECAN Infinite M200, Switzerland).
2.9 HE and Masson staining
Heart tissues were fixed with 4% paraformaldehyde and embedded in paraffin. Next, the organ was sectioned at 3–5 µm thickness and stained separately with HE (Solarbio, G1120, China) and Masson’s trichrome (Servicebio, G1006, China). For both stains, slides were blindly observed and photographed with a microscope (XSP-C204, COIC, China).
2.10 Immunohistochemistry
The heart tissue sections were stained with primary antibodies against NLRP3 (Servicebio, GB114320-100, China, 1:600), Caspase 1 (Servicebio, GB11383-100, China, 1:500), and IL 1β (Servicebio, GB11113-100, China, 1:250) at 4°C overnight, followed by secondary antibodies incubated for 50min at room temperature. All sections were visualized with diaminobenzidine and blindly observed and photographed with a microscope (XSP-C204, COIC, China).
2.11 Immunofluorescence
TUNEL and immunofluorescence double staining of heart tissue sections and fixed cells were performed to evaluate pyroptosis. TUNEL/GSDMD positive can be regarded as a possible indicator of pyroptosis 31 (In the gasdmin family, only GSDMD is expressed in cardiomyocytes32). Tissue sections were obtained as described above. While H9C2 cells were seeded in 6-well culture plates plated with cell-climbing slices. After the treatment, cell-climbing slices were washed with PBS twice and then fixed with 4% paraformaldehyde for 20 min. After that, the cell-climbing slices or tissue sections were treated with a primary antibody against the N terminal of GSDMD (Bioss, BS-14287R, China,1:200) at 4°C overnight, followed by incubation with a secondary antibody for 50 min at room temperature. The nuclei were stained with DAPI for 10 min at room temperature. Finally, the slices and tissue sections were blindly observed and photographed with a microscope (DP74, Olympus, Japan).
GSDMD is present in each cardiomyocyte and is therefore difficult to count. However, subsequent to the cleavage of GSDMD, the GSDMD-N terminal will undergo oligomerization and locate to the plasma membrane, nuclear membrane and mitochondrial membrane to form membrane pores. Consequently, we lowered the laser power so that the cells displayed only the stronger GSDMD fluorescent signals and considered them as oligomerized GSDMD-N.
2.12 ELISA
Circulating cTn-I in serum was quantitatively analyzed using ELISA kits for mice cTn-I (Mlbio, ml092662, China). The levels of IL 1β in cell supernatants were measured by Rat IL 1β ELISA Kit (MultiSciences Biotech, EK301B, China) according to the manufacturer's instructions. Typically, we incubate samples overnight at four degrees for improved results.
2.13 Protein extraction and Western blotting (WB)
Cell and Heart tissue lysis were performed as described before 33. In brief, a small chunk from the left ventricle at the apex of the heart (30 mg) and H9C2 cells were lysed in RIPA/cell lysis buffer (Beyotime, P0013B, China) supplemented with PMSF (Beyotime, ST506, China), phosphatases inhibitors (Beyotime, P1081, China) and protease inhibitors (Beyotime, P1005, China). Heart tissue was then loaded and homogenized using the bead ruptor (BeadRuptor24, OMNI, USA) at a frequency of 3.55 m/s for 30 s, repeated 3 times. Cells were lysed on ice for 10min. Tissue homogenates and cell lysates were further centrifuged at 4°C for 10 min at 12000×g. After collecting the supernatant, the protein concentration of total homogenate was determined using the BCA method (Beyotime, P0010, China).
For the WB experiment, protein lysates in the SDS-PAGE Sample Loading Buffer were boiled for 5 min at 10℃. The samples were separated on 10–12% SDS-PAGE gel and transferred to the PVDF membrane (IPVH00010, Millipore). The membranes were then blocked in QuickBlock™ Blocking Buffer for Western Blot (Beyotime, P0252, China) for 2 h at room temperature and then incubated with primary antibodies directed against PANX1 (12595-1-AP, Proteintech, China), IL 1β (sc-12742, Santa Cruz, USA), P2X7 (A10511, abclonal, China), Caspase1 (A0964, abclonal, China), GSDMD (BS-14287R, Bioss, China), P2X4 (66416-1-Ig, proteintech, China), NLRP3 (DF7438, affinity, China), TXNIP (sc-166234, Santa, USA), NF-κb p65 (WL01980, wanleibio, China), p-NF-κb (WL02169, wanleibio, China), β-tubulin (AF7011, affinity, China), HSP90 (ab13492, abcam, USA), and GAPDH (sc-47724, Santa, USA) and horseradish peroxidase-conjugated secondary antibodies (115-035-003, 111-035-003, Jackson Lab, USA). The protein bands were captured by the ChemiDoc MP Imaging System (Chemidoc mp, BIORAD, USA), and protein intensity was measured using Image J (Image J 1.8.0, NIH, USA).
2.14 RNA isolation and quantitative realtime-PCR (qRT-PCR)
Total RNA was extracted from the left ventricle at the apex of the heart (20mg) and H9C2 cells using trizol lysis buffer (Invitrogen, Thermo Fisher Scientific, USA), as per the manufacturer’s instruction. The RNA was reverse-transcribed into cDNA using a cDNA reverse transcription kit (FSQ-101, TOYOBO). For real-time PCR analysis, the gene expression levels were detected by using a real-time system with Hieff qPCR SYBR Green Master Mix (Low Rox Plus) (YEASEN, 11202ES03). The primer sequences of mice and rat samples are found in Table 2.
Table 2
Primer | species | Sequence (5'-3') | Product length (bp) |
P2X7 | mouse | Forward | GGCCAAGAAGTTCCAACCTA | 130 |
Reverse | CCATTGAGAGCATGGCTTCTTG |
NLRP3 | mouse | Forward | AAGGCTGCTATCTGGAGGAACT | 133 |
Reverse | ACGGACACTCGTCATCTTCAG |
Caspase 1 | mouse | Forward | CCAGGAGGGAATATGTGGGAC | 159 |
Reverse | ACTCCTTGTTTCTCTCCACGG |
PANX 1 | mouse | Forward | GTGGATTCATACTGCTGGGCT | 101 |
Reverse | AGGATGTAGGGGAAGAACTTGTG |
IL 1β | mouse | Forward | TGCCACCTTTTGACAGTGATG | 136 |
Reverse | ATGTGCTGCTGCGAGATTTG |
IL 18 | mouse | Forward | GACTCTTGCGTCAACTTCAAGG | 169 |
Reverse | CAGGCTGTCTTTTGTCAACGA |
P2X1 | mouse | Forward | CTACCATCGGCTCTGGGATTG | 149 |
Reverse | GTCACGTTCACCCTCCCCAG |
P2X2 | mouse | Forward | TACGAGACGCCCAAGGTGAT | 106 |
Reverse | CGATGAAGACGTACCACACGA |
P2X3 | mouse | Forward | CTACGAGACTACCAAGTCGGTG | 108 |
Reverse | TGCAAGAAAACCCACCCCACA |
P2X4 | mouse | Forward | CACCCACAGCAGTGGAATTG | 145 |
Reverse | GGTGAAGTTTTCTGCAGCCTTT |
P2X5 | mouse | Forward | CAGCTCACCATCCTGTTGTACT | 196 |
Reverse | AGAAAACGTTCTCCCCCTGAG |
P2X6 | mouse | Forward | GTGCTGTGCCCAGATCCAAT | 192 |
Reverse | TGCAATCCCAGTGAATGCTGA |
TXNIP | mouse | Forward | CCCACTTACACTGAGGTGGAT | 196 |
Reverse | CCCATCTTGAGGAGTCAGCG |
GAPDH | mouse | Forward | CCTCGTCCCGTAGACAAAATG | 133 |
Reverse | TGAGGTCAATGAAGGGGTCGT |
P2X7 | rat | Forward | AAACAGAGTGAGCCTGTCGC | 164 |
Reverse | TCGCTCATCAAAGCAAAGCTAAC |
P2X4 | rat | Forward | CCTTCCTGTTCGAGTACGACA | 118 |
Reverse | ACGAACACCCACCCGATGA |
NLRP3 | rat | Forward | CGGACTGACCCATCAATGCT | 172 |
Reverse | GCAGCTGACCAACCAGAGTT |
GAPDH | rat | Forward | CTGGAGAAACCTGCCAAGTATG | 138 |
Reverse | GGTGGAAGAATGGGAGTTGCT |
2.15 PPI network construction and module analysis
The PPI network of functional interaction between P2X proteins and PANX1 and NLRP3 inflammasome was analyzed by STRING (Search Tool for the Retrieval of Interacting Genes/Proteins) website (http://string-db.org) 34. The results were visualized using Cytoscape software. The top 15 high-degree proteins were identified using the cytoHubba plugin; the degree of the protein is represented via the size and colour of nodes, and the combined interaction score (threshold of 0.4) is shown through the edges' width.
2.16 Single-cell expression profile analysis
Single-cell expression profile data of P2X1, P2X2, P2X3, P2X4, P2X5, P2X6, P2X7 in heart tissue were obtained from Tabula Muris ( https://tabula-muris.ds.czbiohub.org/) 35.
2.17 Statistical analysis
Data are presented as mean ± SEM and statistical analysis was performed using Prism 9.5 (GraphPad Software Inc). For the comparison of two groups, a 2-tailed unpaired Student t-test was used; for comparison between more than two groups, one-way ANOVA with Sidak’s multiple comparisons was used as appropriate. Two-way ANOVA with Sidak’s multiple comparisons to test the difference among groups with various factors (e.g., exercise or HFD/STZ treatment). P values < 0.05 were considered to indicate statistically significant differences.