Materials
Dulbecco’s modified Eagle’s medium (DMEM) was purchased from Thermo Fisher Scientific (Waltham, MA). Eagle’s minimum essential medium, alpha modification (α-MEM), and fetal bovine serum (FBS) were obtained from GE Healthcare Life Sciences (Pittsburg, PA, USA). Recombinant human/mouse/rat bone morphogenetic protein 2 (BMP-2) was obtained from R&D systems, Inc (McKinley Place, NE, USA). L-ascorbic acid, dexamethasone, and β-glycerophosphate were purchased from Millipore (Burlington, MA, USA). Mouse M-CSF was purchased from PeproTech (Rocky Hill, NJ, USA). Mouse RANKL was obtained from R&D Systems, Inc. Type I collagenase was purchased from Millipore (Billerica, MA). The fluorescent mounting medium was obtained from Dako (Santa Clara, CA, USA). Tissue-Tek® O.C.T compound was purchased from Sakura Finetek (Torrance, CA, USA). Antibodies against SPHK1 (G-11) and COX-2 were purchased from Santa Cruz Biotechnology (Dallas, TX, USA).
Ethics statement for animal study
We adhered to the essential procedures specified in the Animal Research: Reporting of In Vivo Experiments (ARRIVE) guidelines to minimize suffering for the experimental animals and ensure appropriate care and welfare. The animal studies were approved by the Ethics Committee of Animal Experiments at Korea University (KUIACUC-2021-0095), and all procedures were performed in strict accordance with the Korea University Guide for the Care and Use of Animals in Laboratory Experiments. The mouse strain C57BL6 were used for the animal study. Mice were purchased from Gyerim experimental animal resource center (Seoul, South Korea) and maintained at 22 ± 2°C and 50 ± 10% humidity under a 12 h light-dark regimen. In all animal studies, mice were anesthetized with isoflurane following the AVMA (American Veterinary Medical Association) guidelines for abdominal laparotomy. Animals were euthanized in strict accordance with ethical guidelines. CO2 was injected into the chamber at a rate of 30–70% charging per minute. After visual confirmation of death, complete euthanasia was induced by exposing the mice to CO2 for an additional minute and death was confirmed by monitoring their heartbeats.
Isolation of primary mouse ADSCs
Primary mouse ADSCs were isolated as previously described51. Briefly, 8-week-old mice were euthanized by cervical dislocation. After sterilization with 70% ethanol, the abdominal cavity was opened and the desired fat pad was removed. Fat was incubated with collagenase type I buffer for 60 min. After collagenase digestion, the samples were centrifuged at 300 ⋅ g for 5 min at 25°C. Pellets were washed with 1% BSA and centrifuged at 300 ⋅ g for 5 min. Collected ADSCs were resuspended in DMEM containing 10% FBS, 100 U/mL penicillin, and 100 µg/mL streptomycin. Cells were plated on a culture dish and cultured in a 37°C humidified incubator containing 5% CO2. The medium was changed every 2 days until the cells reached 80% confluence.
Isolation of primary mouse BMMs
Mice aged 8–12 weeks were euthanized by cervical dislocation. After sterilization with 70% ethanol, the skin near the femur was clipped outward to expose the hind legs. All muscle tissues were removed from the isolated femurs and tibias. Superior and inferior ends of the isolated bones were cut, and bone marrow cells were flushed out with α-MEM containing 10% FBS, 100 U/mL penicillin, and 100 µg/mL streptomycin using a 10 mL syringe and 24-gauge needle. A single-cell suspension was created by pipetting, and cells were passed through a cell strainer with a 100 µm pore size (SPL Life Science Co., Pocheon, South Korea) to remove other bone components. After centrifugation at 200 × g for 3 min at 25°C, cells were resuspended in fresh medium and cultured at 37°C in a humidified incubator containing 5% CO2.
Cell culture and differentiation
Mouse ADSCs were isolated via sequential collagenase digestion of the fat pad obtained from 8-week-old mice and grown in DMEM containing 10% FBS, 100 U/mL penicillin, and 100 µg/mL streptomycin. For OB differentiation, when the cells reached confluence, differentiation was initiated with DMEM containing 50 µg/mL ascorbic acid and 10 mM β-glycerophosphate for 7–14 days. The differentiation medium was replaced every 2–3 days. Primary BMMs were isolated from long bone-derived bone marrow of mice and maintained in α-MEM containing 10% FBS, 100 U/mL penicillin, and 100 µg/mL streptomycin. After 24 h, floating mouse primary bone marrow cells were separated into two 100 mm culture dishes and treated with 50 ng/mL M-CSF for 3 days. To generate OCs from BMMs, cells were seeded in 12- or 96-well plates containing 50 ng/mL M-CSF for 24 h. Cells were then treated with 30 ng/mL M-CSF and 50 ng/mL RANKL. The media and cytokines were replaced every 2 days.
RNA isolation and quantitative RT-PCR
Mouse primary BMMs at a density of 1.5 × 105 cells/well were seeded on 12-well plates. After RANKL treatment, the cells were rinsed with PBS and detached. Mouse ADSCs were seeded at the density of 8 × 105 cells/well in 12-well plates and were differentiated into OBs for 7 days when the cells reached 80% confluence. Total RNA was isolated using the TaKaRa miniBEST universal RNA extraction kit (Takara Bio Inc., Shiga, Japan), and cDNA was synthesized from the total RNA using PrimeScript™ RT master mix (Takara Bio Inc.) according to the manufacturer’s instructions. Quantitative RT-PCR (qRT-PCR) was performed on a LightCycler 480 II (Roche, Basel, Switzerland) using Evagreen-express master mix (Applied Biological Materials, Vancouver, BC, Canada). Semi-qRT-PCR was performed on a T100™ thermal cycler (Bio-Rad, Hercules, CA, USA) using Pfu Plus 5× PCR Master Mix (Elpis Biotech, Inc., Daejeon, South Korea). The primer sequences used for PCR are listed in Table 1.
Table 1
Primer sequences used for qRT-PCR.
mRNA | Primer sequence (Forward) | Primer sequence (Reverse) |
mRUNX2 | AGGGACTATGGCGTCAAACA | GGCTCACGTCGCTCATCTT |
mALP | GGACAGGACACACACACACA | CAAACAGGAGAGCCACTTCA |
mCol1a1 | GCTCCTCTTAGGGGCCACT | ATTGGGGACCCTTAGGCCAT |
mOsterix | GAAAGGGAAGCAGAACCATACTATTTG | TCAGTGGTGTGCCTTCATATTCA |
mSHPK1 | TGGGCTGTCCTTCAACCTCATACA | AACAGCAGTGTGCAGTTGATGAGC |
mSPHK2 | AAGCAAGAGAAAGCTGGTCATC | AGTGACAATGCCTTCCCACTCACT |
mSEMA4D | CCTGGTGGTAGTGTTGAGAAC | GCAAGGCCGAGTAGTTAAAGAT |
mEphrinB2 | TCTGTGTCATCGGTTGGCTACGTT | ACAGACGCACAGGACACTTCTCAA |
mTRAP | CTGTGCGACATCAACGAAAGG | CCTTGGGAGGCTGGTCTTAAA |
msLZIP | GAAGCTCTTGGAGAAGGA | TTCAAGACCCTGCTCTCC |
sLZIP | AGCAGCAGCATGTACTCCTCT | AGGCAGCTCCAGCTGGTAAG |
mβ-Actin | AACCCTAAGGCCAACCGTGAAAA | AGGATGGCGTGAGGGAGAGCATA |
Alizarin red S and alkaline phosphatase staining and activity assay
Mouse ADSCs were differentiated in osteogenic medium for 14 days. Differentiated OBs were fixed with 4% formaldehyde solution for 10 min at 25°C and stained with alizarin red S (ARS) and alkaline phosphatase (ALP) staining solutions. For ARS staining, cells were washed with PBS, and evaluated cell matrix mineralization by staining with 2% ARS solution (Millipore Sigma). For ALP staining, the cells were washed with PBS and stained using a TRACP/ALP double staining kit (Takara Bio Inc.) according to the manufacturer’s instructions. For ALP activity analysis, cells were seeded at a density of 4 × 104 cells/well in a 96-well culture plate and cultured in osteogenic medium in a time-dependent manner. The cells were evaluated using a TRACP/ALP assay kit (Takara Bio, Inc.).
Tartrate-resistant acid phosphatase activity and bone resorption assays
For the TRAP activity assay, BMMs were seeded in 96-well culture plates at a density of 1 × 104 cells/well. Three days after OB differentiation, the cells were washed with PBS and evaluated using a TRACP/ALP assay kit (Takara Bio Inc.) according to the manufacturer’s instructions. For the bone resorption assay, the same number of cells was seeded on Corning® osteo assay surface 96-well plates (Corning, NY, USA). Five days after OC differentiation, cells were detached using 10% bleach solution for 5 min at 25°C. After washing several times with DDW, the plates were placed in an incubator for 24 h. To quantify resorption activity, the resorption area (pixels)/total well area (pixels) for five random fields was determined.
Conditioned medium collection
For conditioned medium (CM) collection, mouse BMMs were seeded in 12-well plates at a density of 1.25 × 105 cells/well. The cells were differentiated into OCs for 5–7 days using RANKL (50 ng/mL) and M-CSF (30 ng/mL). After OC differentiation, supernatants were collected and centrifuged at 200 × g for 3 min. To collect the OB-CM, mouse ADSCs were seeded in 12-well culture plates at a density of 8 × 104 cells/well. The cells were then differentiated into OBs for 7 days. The supernatant was centrifuged at 300 × g for 3 min.
Transwell cell migration
Mouse ADSCs (2 × 104 cells/100 µL) were seeded on the top chamber of 24-transwell plates (8 µm pore size; BD Biosciences, San Diego, CA, USA). After 5 h, OC-CM was added to the bottom chamber for 18 h. Mouse BMMs (8 × 104 cells/100 µL) were seeded on the top chamber of transwell plates with M-CSF (30 ng/mL). OB-CM was added to the bottom chamber for 24 h. Cells on the lower surface of the membrane were stained with 0.05% crystal violet according to the manufacturer’s protocol. The cell counts of the adherent cells were obtained from five randomly selected fields per well, and the values were expressed as the average of the counts.
Cell proliferation
The cell proliferation assay was performed using EZ-cytox DoGenBio (Gyeonggi, South Korea), according to the manufacturer’s protocol. Mouse ADSCs were in 96-well plates seeded at a density of 3 × 103 cells/100 µL. After 24 h, the cells were incubated with OC-CM for the indicated times. After the medium was removed, the cells were treated with 10 µL of EZ-cytox solution and incubated at 37°C for 30 min. Cell viability was determined by measuring the absorbance at 450 nm.
Sphingosine kinase 1 activity assay
Sphingosine kinase 1 activity was determined using a sphingosine kinase activity assay kit (Echelon, Salt Lake City, UT, USA), according to the manufacturer’s instructions. Mouse BMMs were seeded in 12-well culture plates at a density of 1.5 × 104 cells/well. After 24 h, BMMs were differentiated into OCs in α-MEM media containing 30 ng/mL M-CSF and 50 ng/mL RANKL for 7 days. The media and cytokines were replaced every 2 days. Protein extracts (30 µg) were incubated with reaction buffer, 100 µM sphingosine, and 10 µM ATP for 30 min at 37°C. Sphingosine kinase 1 activity was measured using SpectraMax®i3x (Molecular Devices, CA, USA).
Co-culture of OBs and OCs
Mouse BMMs and ADSCs were co-cultured either indirectly or directly. To examine the crosstalk between OBs and OCs, an indirect co-culture was performed using either OB-CM or OC-CM. The CM of each cell line was transferred to WT ADSCs or BMMs for 10–13 days. Indirect co-culture models were evaluated using ALP and TRAP staining. For direct co-culture, ADSCs were co-cultured with BMMs in 96-well plates in DMEM containing M-CSF (30 ng/mL) at an OBs: OCs = 1:1.5. The co-culture models were added to OB or OC medium at 80% confluence. After 7–10 days of co-culture, the cells were evaluated using ALP or TRAP staining.
Enzyme-linked immunosorbent assay (ELISA)
Bone marrow macrophages (BMMs) were isolated from WT and sLZIP TG mice and differentiated for 7 days. OC-CM was collected and S1P levels were measured using a mouse S1P ELISA Kit (MyBioSource, Inc., San Diego, CA, USA) according to the manufacturer’s instructions.
sLZIP-overexpressing levtivirus generation and transduction
The sLZIP-overexpressing lentivirus was obtained from Sirion Biotech (Martinsried, Germany). The codon-optimized sequences of mouse CXCR4 and human sLZIP were cloned into the pcLV-CMV-eGFP-T2A-Puro-WPRE plasmid. LV-containing supernatants were produced by the transient transfection of HEK-293T cells. The titer was 109 TU/mL. For transduction, ADSCs were seeded in 100 mm culture plates at a density of 1 × 106 cells/plate. After 24 h, cells were incubated in 5% FBS DMEM with 8 µg/mL polybrene and LV-CXCR4/sLZIP. Medium was changed after 16–24 h and infected ADSCs were selected following continuous incubation in DMEM with 10 µg/mL puromycin for 24 h. Prior to experiments, MSCs were cultured 48 h without puromycin.
OVX surgery mouse model
Eight-week-old female mice were randomly divided into two groups: sham control (n = 4–5) and OVX surgery (n = 6–7). Female mice were ovariectomized under inhalation anesthesia. Anesthesia was induced using 1.8% isoflurane at a rate of 50 mL/min with 1–2% vaporization in the nose. After shaving the hair in the dorsal mid-lumbar area, the dorsal skin was incised and the bilateral ovaries were removed. The wounds were closed with sutures. Sham control mice underwent the same procedure, but the ovaries were not removed. After 6 weeks, the OVX mice were euthanized for further analysis.
Bone-defect mouse model
A bone defect model was generated using 6–8-week-old mice. Prior to surgery, anesthesia was induced using a Somnosuite low-flow anesthesia system (Kent Scientific Co., Torrington, CT, USA) and isoflurane (Hana Pharm Co., Ltd., Seoul, South Korea). Isoflurane was used at 150–200 mL/min with 2.5% vaporization in the induction chamber. Anesthetized mice were maintained using isoflurane at 50 mL/min and 1–2% vaporization in the nose. The right thigh was epilated and sterilized with 70% ethanol and the skin was incised over the lateral femoral aspect to expose muscle. Blunt dissection of the quadriceps was performed to expose the femoral bone. The posterior and anterior cortices of the middle of the femur were perforated (0.6 mm in diameter) by using a drill bit and hand drill (Jeungdo Bio&Plant Co., LTD, Seoul, South Korea), while chilled PBS was irrigated to the site to avoid heat damage. After perforation, the muscle and skin tissues were repositioned using sutures. The surgical field was disinfected with povidone. The mice were then returned to their cages and administered an analgesic (30 mg/mL ibuprofen diluted in drinking water).
ADSC intravenous injection
For ADSC-based therapeutic experiments, ADSC form WT and TG were collected at 1 × 106 cells/100 µL PBS immediately before intravenous injection. For LV-CXCR4/SLZIP ADSC-based therapeutic experiments, ADSC form WT and ADSC infected with LV-CXCR4 and LV-CXCR4/sLZIP were collected at 1 × 106 cells/100 µL PBS immediately before intravenous injection.
Micro-CT scanning
Mouse femurs were collected after anesthesia. Whole muscles and connective tissues were removed, and the samples were fixed in a 4% paraformaldehyde solution over 1 week at 4°C. Mouse femur was subjected to µCT scanning using SkyScan1172 (Bruker, MA, USA) under the conditions of a source 70 kV voltage, 135 µA current, 0.5 mm Al filter, and 680 ms exposure time. Images were processed using reconstruction software (NRecon v1.6, Data Viewer v1.5) and three-dimensional visualization software (CTvox v2.6), and data analysis was performed using analysis software (CTAn v1.14). After three-dimensional reconstruction, the bone volume/tissue volume (BV/TV) of a 1.604 mm length of cortical bone containing the defect region was automatically calculated using built-in software.
Histological analysis
Mouse femurs were fixed in 4% paraformaldehyde (Sigma-Aldrich) solution at 4°C. After fixation, the samples were decalcified at 4°C for 2 weeks using 5 mL Osteosoft solution (Sigma-Aldrich). However, the samples used for OB staining were not decalcified. The solution was changed every 2–3 days. Samples were soaked in a 30% sucrose (Sigma-Aldrich) solution at 4°C for 24 h and transferred to optimal cutting temperature compound (Tissue-Tek, Sakura Finetek, South-Holland, Netherlands). Samples were then cryo-sectioned into 10 µm-thick slices in the proximal to distal vertical direction and transferred to glass slides. The optimal cutting temperature compound was removed using ethanol, and the samples were subjected to TRAP and ALP staining. After mounting the medium and applying cover slips, the samples were observed and analyzed under a light microscope.
Statistical analysis
All data are presented as the mean ± SEM. Statistical analyses were performed using GraphPad Prism 5 (GraphPad Software, La Jolla, CA, USA). Two-tailed Student’s t-test results of P < 0.05 were considered statistically significant.