Drugs and chemicals
DOX, EUG an AST were obtained from Sigma Aldrich Chemical Co. (St. Louis, MO, USA). Each vial of DOX contains one gm powder which was dissolved in DMSO to yield 10 μM then serially diluted in RPMI-1640 medium immediately before use. EUG was obtained in a vial containing 100% pure essential oil. It was dissolved in DMSO and diluted with RPMI-1640 supplemented medium immediately before use. AST was purchased as pink to very dark purple powder stored away from light and dissolved in DMSO to produce stock of 2000 µM. RPMI-1640 Medium, fetal bovine serum, dimethylsulfoxide (DMSO), sodium bicarbonate, Hoechst 3342 solution 1 mg/ml, and rhodamine 123 were all purchased from Sigma Aldrich Chemical Co. (St. Louis, MO, USA). Trichloroacetic acid (TCA) and Triton X-100 were procured from MP Biochemical (Santa Ana, California, USA). All other chemicals and reagents were from standard analytical grade.
Cells and cell culture:
Human breast cancer cell line (MCF7) used in this study was obtained from the American Type Culture Collection (Manassas, USA). The adherent cells were grown as monolayer in RPMI- 1640 supplemented with 10% fetal bovine serum, 2 mM L-glutamine, 1.5 g/l sodium bicarbonate and 1% penicillin/streptomycin, and incubated at 37 ͦ C in 5% CO2 atmosphere.
Assessment of cytotoxic activity:
Cytotoxicity was determined using sulforhodamine B (SRB) assay as previously described by Skehan et al. [29]. Briefly, exponentially growing cells were seeded in 96-well microtitre plates at an initial density of 5x 103/well. After 24 h, cells were incubated with different concentration of EUG (0.125-4 mM), AST (5-80 µM), DOX (0.0625-1 µM) alone and DOX combined with 1mM EUG, or 40 µM AST. For each concentration, three wells were used and incubation was continued for another 48 h. A control wells containing, vehicles DMSO (1 % v/v) were used and the cells were incubated in a humidified, 5% CO2 atmosphere at 37 ͦ C for 48 h. Cells were fixed with 10% trichloroacetic acid for 1 h at 4 ͦ C and stained with 0.4% SRB for 30 min. The wells were then washed four times with 1% acetic acid, air-dried and the dye was solubilized with 10 mM Tris base (pH 10.5). The optical density (O.D.) was measured spectrophotometrically at 570 nm with the microplate reader (Tecan Sunrise™, Ma¨nnedorf, Switzerland). The experiment was repeated in three independent times. IC50 values (the concentration of DOX required to produce 50% inhibition of cell growth) were calculated using sigmoidal dose response curve-fitting models (Graphpad Prizm Software, version 5, GraphPad Software, Inc. Avenida de la Playa La Jolla, USA). The combination index was calculated using CombuSyn software (ComboSyn, Inc., Paramus, NJ., USA).
Cell cycle and apoptosis analysis with flow cytometry:
Control and treated MCF7 cell pellets were stained with DAPI/Triton X-100 staining solution for cell cycle analysis and with propidium iodide for apoptosis analysis [30]. A flow cytometer (Becton and Dickinson San Jose, CA., USA) equipped with electronic doublet-discrimination capability was used to detect stained nuclei and emitted fluorescent light primarily at wavelengths between 580 and 650 nm. The FACscan fluroscence 2 (FL2) detector equipped with a 585/42 band pass filter was used to analyze light emitted between 564 and 606 nm.
RNA extraction, cDNA synthesis and real time PCR:
Total RNA was extracted from control and treated cell pellets with total RNA purification kit (Direct-Zol RNA Kit, Zymo Research, Germany). cDNA synthesis was performed according to the manufacturer’s instructions using Revert Aid First Strand cDNA synthesis kit (ThermoFisher, UK). Quantitative real time PCR was conducted according to manufacturer’s instructions by Applied Biosystems syber green PCR master mix (USA). Reverse and forward sequences of primers genes encoding for mRNA transcript of TNFα, IFNγ, FOXP3, BAX, BCl2 and caspase 8 genes were designed by NCBI- NIH tool and the sequences were summarized in table (1). Fold change of genes expression (2−∆∆Ct) was calculated after normalization to housekeeping gene (β-actin) and genes expression in control samples.
Table (1): Primers for qRT- PCR
Gene
|
Forward Primer
|
Reverse Primer
|
TNFα
|
CTGAACTTCGGGGTGATCG
|
GCTTGGTGGTTTGCTACGAC
|
IFNγ
|
ACTGTCGCCAGCAGCTAAAA
|
TATTGCAGGCAGGACAACCA
|
FOXP3
|
CCCAGGAAAGACAGCAACCTT
|
TTCTCACAACCAGGCCACTTG
|
BAX
|
GCCCTTTTGCTTCAGGGTTT
|
TCCAATGTCCAGCCTTTG
|
BCl2
|
CGGAGGCTGGGATGCCTTTG
|
TTTGGGGCAGGCATGTTGAC
|
caspase 8
|
TTCTCCCTACAGGGTCATGC
|
GCAGGCTCAAGTCATCTTCC
|
β- actin
|
CCAGAGCAAGAGAGGTATCC
|
CTGTGGTGGTGAAGCTGTAG
|
SDS-polyacrylamide gel electrophoresis and immunoblot analysis:
Control and treated cells were harvested, washed twice with ice-cold phosphate buffered saline, centifuged and pelleted at 1200 r/min for 5 min. The cell pellets were then lysed in lysis buffer containing 150 mM sodium chloride, 10 mM Tris, 0.2% Triton X-100, 0.3% NP-40, 0.2 mM sodium vanadiumoxide and protease inhibitor cocktail, pH 7.7. The supernatants were collected after centrifugation at 14,000 r/min for 15 min at 4 ͦ C, and the protein content was determined by the Bradford method [31]. Aliquots of protein supernatants containing equal amounts of protein and sodium dodecyl sulphate (SDS)-reducing buffer were boiled for 5 min, electrophoresed on SDS-polyacrylamide gels and transferred to polyvinylidene difluoride membranes. The membranes were blocked with 5% non-fat drymilk and probed with specific primary antibodies of monoclonal antihuman aromatase (Biospes, Aachen, Germany), EGFR (Sigma Aldrich, USA), CK7 (Bioss, Boston, USA) and LC3B (Invitrogen, USA) antibodies followed by incubation with peroxidase-conjugated secondary antibodies. The blots were developed with Amersham ECL Western Blotting Detection Reagents (GE Healthcare, Amersham Place, Little Chalfont, UK) according to themanufacturer’s protocol. The blots were quantified by Scion image software (Scion Corporation, version 0.4.0.3, Maryland, USA) and protein loading was corrected for β-actin as loading control.
Histones extraction and the determination of global H3 and H4 acetylation:
Cell pellets were suspended in triton extraction buffer (0.5% Triton in phosphate buffered saline, 2 mM phenylmethylsulfonyl fluoride and 0.02% NaN3), and lysed on ice for 10 minutes with gentle stirring. After centrifugation, cell lysate was transferred to a new vial and the residual cells were resuspended in the extraction buffer (0.5N HCl + 10% glycerol) and incubated on ice for 30 minutes. The supernatant fraction was taken to a new vial and 8 volumes of acetone was added and left at − 20 °C overnight. The Protein concentration was quantified in the remaining dry pellet by Coomassie protein assay kit following Bradford method27. The EpiQuik™ Total Histone H3 and H4 Acetylation Detection Fast Kits (Epigentek, Farmingdale, NY, USA) were used according to the manufacturer` protocol. The global content of acetylated histones in treated samples was calculated from the protein calibration curve in ng/ total histones protein, and then the % of histones acetylation in was calculated normalized to the level of acetylated histones in untreated control.
Enzyme-linked immunosorbent assay for caspase 3:
The concentration of executioner caspase 3 active subunit was measured in the lysate of MCF-7 cells using the Quantikine human active caspase-3 immunoassay kit (R&D system, Minneapolis, MN, USA). The amount of caspase-3 was calculated from a standard curve, and the results are presented as relative % of active caspase-3 to untreated control.
Determination of the activity of multidrug resistance (MDR) via rhodamine-123 and Hoechst dyes.
Rhodamine-123 and Hoechst 3342 dyes are substrates for MDR genes and the proteins codified by these genes including p-glycoprotein (P-gp), MDR associated protein, breast cancer resistant protein and lung-resistant related protein. Accumulation of Rhodamine-123 and Hoechst dyes in the cells is inversely related to MDR activity [32]. In brief, adherent control and treated cells were incubated with 5.25 µM of Rhodamine 123 and 5 ug/ml of Hoechst 33342 dye for 30 min at 37 ͦ C in a 5% CO2 incubator. After incubation, cells were washed, scrapper collected, re-suspended and physically lysed in distilled water for immediate fluorescence analysis. Cellular uptake of Rhodamine 123 was detected at excitation 485 nm and emission 535 nm, while cellular uptake of Hoechst 3342 was detected at excitation 360 nm and emission 450 nm using florescence spectroscopy (Kontron SFM25, Tresser Instruments, Rossdorf, Germany).
Statistical analysis:
All data are expressed as mean ± SD of three separate experiments, each performed in triplicates. Differences between groups were tested for statistical significance using one-way analysis of variance (ANOVA) followed by Dunnette for comparing all means with control in the SRB cytotoxicity study and Tukey-kramer for multiple comparison in rest of the experiments. A student t-test was used for comparison between the mean in DOX alone and the corresponding mean in DOX combined with either EUG or AST in SRB cytotoxicity study. Nonparametric ANOVA was carried out for comparison between three blots of Western blotting using the Kruskal–Willis test. The 0.05 level of probability was used as the criterion of significance using GraphPad InStat, version 4.0 (GraphPad, San Diego, California, USA).