Bioinformatic analyses
Gene Expression Profiling Interactive Analysis (GEPIA), an online platform used for customizing and visualizing data using TCGA and GTEx data, was used to perform overall survival (OS) or disease free survival (DFS, also called relapse-free survival and RFS) analysis based on gene expression18.
The University of Alabama at Birmingham Cancer data analysis Portal (UALCAN) is an effective website for online analysis and mining of cancer data based on the relevant cancer data in TCGA database19. We analyzed the expression of genes in CRC by UALCAN.
We used RNAseq technology to detect the mRNA expression profile of sh-SDHC HCT116 cells and scrambled control HCT116 cells. The Deseq2 R Package was used to identify DEGs between scrambled control groups and sh-SDHC groups using the following criteria: (i) |log2FC (sh-SDHC/scramble) |>0; (ii) p < 0.05.
Gene Ontology (GO) is a community-based bioinformatics resource that provides information about gene product function using ontologies to represent biological knowledge which covers three aspects of biology: biological processes, cellular components, and molecular functions20.
Kyoto Encyclopedia of Genes and Genomes (KEGG) is a knowledge base that stores high-level functions and utilities of biological systems21. We performed GO and KEGG on DEGs. P-value < 0.05 was considered significant.
Gene Set Enrichment Analysis (GSEA) is a threshold-free method that analyzes all genes based on their differential expression rank or other score without any prior gene filtering22. GSEA was used to carry out KEGG pathway enrichment analysis using all genes of the RNAseq data.
Clinical tissue specimens
We also used clinical CRC specimens and paired peri-tumor tissues to detect the expression of SDHC. Clinical CRC specimens and paired normal
tissues were collected from 62 patients who underwent surgical treatment for CRC at Nanfang Hospital of Southern Medical University after obtaining informed consent. A diagnosis of CRC was histopathologically confirmed for each patient sample. Cancer tissues and matched normal tissues were stored at -80℃ until use. The protocols used in this study were approved by Nanfang hospital’s Protection of Human Subjects Committee.
Cell culture, plasmid construction, lentiviral construction and cell transfections
The human normal colon epithelial cell line, human colorectal cancer cell lines, SDHC knockdown and control cell lines (sh-SDHC and sh-NC), SDHC overexpressing and empty vector cell lines (SDHC and EV) were described previously in detail23.
qRT-PCR
RNA extraction, reverse transcription as well as quantitative reverse transcription polymerase chain reaction (qRT-PCR) were performed as described previously23. The sequences of the primers used were as follows:
SDHC mRNA (sense): 5′- CTGTTGCTGAGACACGTTGGT-3′,
SDHC mRNA (antisense): 5′- ACAGAGGACGGTTTGAACCTA-3′,
ACOX1 mRNA (sense): 5′- ACTCGCAGCCAGCGTTATG-3′,
ACOX1 mRNA(antisense): 5′-AGGGTCAGCGATGCCAAAC-3′,
CPT1A (sense): 5′-TCCAGTTGGCTTATCGTGGTG-3′,
CPT1A (antisense): 5′-TCCAGAGTCCGATTGATTTTTGC-3′,
ALDH3A2 (sense): 5′- AAACCAGTTAAGAAGAACGTGCT-3′,
ALDH3A2 (antisense): 5′- CGAAGGGGTAATTCCAAGCTC-3′.
β-actin (sense): 5′- CTCGCCTTTGCCGATCC − 3′,
β-actin (antisense): 5′- GGGGTACTTCAGGGTGAGGA − 3′.
Western blot analysis and immunohistochemistry analysis
Western blotting (WB) was performed as described previously23. The primary antibodies used were as follows: anti-β-actin (66009-1-Ig, Proteintech, 1:10000), anti-SDHC (ab155999, Abcam,1:10000), anti-ACOX1 (10957-1-AP, Proteintech, 1:1000), anti-CPT1A (15184-1-AP, Proteintech, 1:1000), anti-ALDH3A2 (15090-1-AP, Proteintech, 1:1000), anti-P-AKT (66444-1-Ig, Proteintech, 1:1000), anti-P-PI3K (4228, Cell Signaling, 1:1000), anti-PI3K (T40115, Abmart, 1:1000), and anti-AKT (T55561, Abmart, 1:1000). Image J software was employed to analyze relative protein expression.
For immunohistochemistry (IHC) analysis, CRC specimens were fixed with 10% formaldehyde and then embedded in paraffin. After preparing 4-µm-thick continuous paraffin sections, deparaffinization and antigen retrieval were performed following the manufacturer’s instructions. These sections were incubated with anti-SDHC (ab155999, 1:250, Abcam) antibodies. After incubated with secondary antibodies (PV-6001, ZSGB-BIO), the sections were visualized with a DAB chromogenic agent (ZLI-9017, ZSGB-BIO) and observed under a microscope.
Transwell assay and Wound healing assay
Transwell assay and wound healing assay were performed as described previously23.
Application of inhibitors
For the application of the fatty acid synthetase inhibitor orlistat (T0686, TargetMol), a concentration of 20µmol/L orlistat was used to treat CRC cells for 48 hours when necessary. Additionally, the AKT inhibitor MK-2206 (T1952, TargetMol) was employed at a concentration of 1µmol/L to treat CRC cells for 48 hours when necessary.
Drug screening and cell viability measurement.
Anti-cancer Metabolism Compound Library containing 237 anti-cancer metabolism compounds was purchased from TargetMol(L2130). Each compound was arranged in 384-well plates in an 8-dose format, ranging from 22.9nM to 50µM of final concentrations. HCT116-sh-NC or HCT116-sh-SDHC cells were plated at 2000 cells per well in these plates with a diluted compound library and incubated for 72 hours. Cell survival was assessed using the Resazurin sodium salt assay (R8150, Solarbio) following the manufacturer's instructions. A 1/10 volume of resazurin solution was added to the cell and incubated at 37°C for 2 hours in the dark. After incubation, the fluorescence intensity at Ex/Em of 530/590 nm was measured to analyze cell survival. Using GraphPad Prism 7, the IC50 values for each compound were calculated. The Selectivity Index (SI) was determined using the formula: SI = IC50sh − SDHC/IC50sh − NC. Compounds with an SI greater than 2 were chosen as potential candidates.
Quantification of triacylglycerol and neutral lipids
For the quantitative estimation of triglycerides in cells, we used a Triglyceride Assay Kit (BC0625, Solarbio) following the manufacturer’s protocols. We applied the lipophilic fluorescence dye BODIPY 493/503(GC42959, Glpbio) to stain the neutral lipid droplets. Flow cytometry was conducted to quantify the neutral lipid content, while confocal microscopy was used for visualizing the staining. The nucleus was counterstained with DAPI (P0131, Beyotime). And we quantified the fluorescence intensity of lipid droplets and cell numbers using Image-J software.
FAO quantification
The mitochondria of cells were isolated using the Cell Mitochondria Isolation Kit (C3601, Beyotime). After measuring the protein concentration of the mitochondria, they were subjected to the FAO rate assay using the Colorimetric Fatty Acid Oxidation Rate Assay Kit (HL50679, Haling), following the manufacturer’s protocol.
In vivo experiments
Male athymic 4-week-old BALB/c nude mice were purchased from the Central Laboratory of Animal Science, Nanfang Medical University and maintained in a specific pathogen-free facility. For the liver metastasis model, mice were divided into two groups (n = 4 for each group) and were anaesthetized with pentobarbital sodium by intraperitoneal injection. A 1-cm incision was formed on the left side and the spleen was separated, a total of 5×106 HCT116-sh-SDHC or HCT116-sh-NC cells were suspended in 0.05ml PBS and then injected into the spleen with an insulin needle. The spleen was returned to the abdominal cavity, and the wound was sutured. After 4 weeks, the mice were sacrificed, and their livers were removed and carefully dissected to evaluate the metastatic lesions.
In the in vivo experiments involving orlistat, mice were divided into three groups, with three mice in each group. A liver metastasis model was constructed. After three days, Orlistat was administered in a 100µl vehicle, which consisted of 10% ethanol, 50% PEG 300, 5% tween80, and 35% normal saline. The animals received a dosage of 240 mg/kg/day of orlistat or a control solvent. After 4 weeks, the mice were sacrificed, and their livers were carefully dissected to evaluate the presence of metastatic lesions.
For lung metastasis model, mice were divided into two groups (n = 3 for each group) and 5×106 HCT116-sh-SDHC or HCT116-sh-NC cells in 0.15 ml PBS were injected into the tail vein of male BALB/c nude mice. After 4 weeks, the mice were sacrificed, and their lungs were removed and carefully dissected to evaluate the metastatic lesions. Animals was approved by the Nanfang hospital animal ethic committee.
Statistical analysis
Quantitative data in this study were presented as mean ± standard deviation from at least three replicates were analyzed by the two-tailed unpaired Student's t-test to compare the difference between groups. Significant differences were displayed as follows: *P < 0.05, **P < 0.01, and ***P < 0.001.