gRNA designing and plasmid construction
Banana homologs of the E3 ubiquitin-protein ligase MusaPUB22 gene (Ma07_g03320 and Mba07_g3220) sequences and MusaPUB23 gene (Ma07_g03310 and Mba07_g3240) were downloaded from banana genome A (Musa accuminata) and genome B (Musa balbisiana) through the banana genome hub (http://banana-genome-hub.southgreen.fr), respectively. To identify the conserved region, the four gene sequences were aligned using Multalin (http://multalin.toulouse.inra.fr/multalin/). Two gRNAs, spaced 57 bp apart, were designed and selected with minimal possibility of off-target effects using Alt-R Custom Cas9 crRNA Design Tool (https://eu.idtdna.com/site/order/designtool/index/CRISPR_CUSTOM).
The editing target was sequenced to eliminate the potential impact of single nucleotide polymorphisms (SNPs) on gRNA activity. Genomic DNA was extracted from the leaves of the banana cultivar ‘Sukali Ndiizi’ using cetyltrimethylammonium bromide (CTAB) method15. The PUB fragment was amplified using a pair of primers (PUB_seq_F and PUB_seq_R, Table S1), flanking the gRNAs. The PCR was carried out in a final reaction volume of 20 µL, comprising 2 µl 10X PCR buffer, 0.4 µl dNTP mix, 0.5 µl of 10 mM of each primer, 0.1 µl Hotstar Taq DNA polymerase, 1 µl DNA and 15.5 µl nuclease-free water. The PCR program was 95°C for 5 min, then 30 cycles of 94°C for 30 s, 53°C for 30 s and 72°C for 1 min, followed by 72°C for 7 min. The PCR products were visualized on a 1% agarose gel, stained with GelRed, purified, and sequenced. SnapGene software (WWW.snapgene.com) was used for sequence alignment, confirming the absence of SNPs in the gRNAs.The PCR products were resolved on 1% agarose gel, stained with gel red, and subsequently purified and sequenced. The sequences were aligned using SnapGene software (WWW.snapgene.com). As there were no SNPs in the gRNAs, gRNA1: AGTCAGGATACTGCACTCGG and gRNA2: ACTGTGCCTGGTGCTCCAAG, with their corresponding reverse sequences, were synthesized as oligos after adding the appropriate adaptors to the 5' end (Table S1) and cloning was performed16. Briefly, the synthesized oligos were annealed and inserted into the BsmBI sites of the plasmids pYPQ131 (gRNA1) and pYPQ132 (gRNA2). After sequencing and confirmation, the gRNAs were assembled by Golden Gate reaction into the plasmid pYPQ142. The insert containing the gRNA sequences alongside the Cas9 entry vector pYPQ167 was cloned into the Gateway binary vector pMDC32 by LR clonase™ (Invitrogen, New Zealand) recombination reaction to yield pMDC32_Cas9_MusaPUB. Subsequently, the plasmid construct was transformed into Agrobacterium strain EHA105 by electroporation and selected on LB medium containing kanamycin (50 mg/l) and rifampicin (25 mg/l). The transformed Agrobacteium was checked by PCR for the presence of plasmid construct and used for editing experiments.
Generation of the gene-edited events
The gene-edited events were generated by delivering the pMDC32_Cas9_MusaPUB plasmid into the ECS of ‘Sukali Ndiizi’ using the Agrobacterium-mediated transformation system14 with minor changes. Agrobacterium tumefaciens strain EHA105 harboring plasmid construct pMDC32_Cas9_MusaPUB with hygromycin selection marker gene was used for transformation. The Agro-infected cells were regenerated on a selective medium containing hygromycin (25 mg/l). The regenerated edited events were maintained and multiplied by sub-culturing every 6–8 weeks on proliferation medium for further analysis.
PCR analysis to confirm the presence of the Cas9 gene
Genomic DNA was extracted from 100 mg of freshly collected leaf samples collected from putative edited and wild-type plantlets using cetyltrimethylammonium bromide (CTAB) method15. The presence of the transgene in all hygromycin-resistant events was assessed through PCR analysis, utilizing the primers 35S_F and Cas9_R (refer to Table S1). The PCR was performed in a 20 µl reaction volume comprising of 1 µl genomic DNA (100 ng/µl), 2 µl of 10X PCR buffer, 0.4 µl of dNTP mix, 0.5 µl of 10 mM of each primer, 0.1 µl HotStar Taq polymerase, and 15.5 µl nuclease-free water. PCR amplification conditions were initial denaturation step at 95˚C for 5 min, followed by 34 cycles of denaturation at 94˚C for 30 s, annealing at 55˚C for 30 s, extension at 72˚C for 1 min, and final extension at 72˚C for 10 min. After amplification, 10 µl of the amplicon was resolved on 1% agarose gel stained with gel red.
Growth analysis of pub22/23 edited events
Thirteen gene-edited events were randomly selected to assess their plant growth. Three replicates of well-rooted plantlets for each independent edited event, along with wild-type control, were transferred to sterile soil in small plastic disposable cups (size 150 ml) and acclimatized for 4 weeks in a humidity chamber. Following acclimatization, the plants were transitioned to bigger pots (10 liters in size) and grown in the greenhouse under controlled conditions for a duration of 90 days, maintaining a temperature range of 25–30°C17.
At the end of the 90-day growth period, various parameters were recorded, including plant height, pseudostem girth, total number of functional fully opened green leaves, and length and width of the fully developed second leaf from the top. The total leaf area (TLA) was calculated17,18.
Total leaf area = 0.8 🞨 L🞨 W 🞨N
In which L = Length of the middle leaf, W = width of the middle leaf, and N = total number of leaves in the plant.
Disease evaluation of pub22/23 edited events under greenhouse conditions
To assess the resistance to BXW disease, three-month-old plants of 13 edited events and wild-type control plants were evaluated under greenhouse conditions. Three replicates of each edited event and control non-edited plants were injected with 100 µl of the bacterial culture in the midribs of the second fully opened leaf starting from the top. The onset of disease symptoms, including leaf drooping, wilting, necrosis, and complete wilting of plantlets, was diligently recorded over 60 days post-inoculation (dpi). Disease severity was quantified on a scale of 0–5, where 0 denoted no symptoms, and subsequent ratings reflected increasing levels of severity: 1 indicated only the inoculated leaf wilting, 2 denoted 2 to 3 leaves wilting, 3 represented 4 to 5 leaves wilting, 4 signified all leaves wilting but the plant remaining alive, and 5 indicated the entire plant succumbing to the disease. The relative resistance of edited events to BXW disease was calculated17.
DSI (%) = [Σ (Disease severity scale) X no. of plants in each scale)/(total number of plants) X (maximal disease severity scale) X100
Resistance (%) = (Reduction in wilting in event /Proportion of leaves wilted in control) X 100
Sequence analysis to detect targeted mutations in MusaPUB22/23 genes
Genomic DNA from the Cas9 positive events and wild-type plants were used for PCR amplification of the target regions using the primers PUB_seq_F and PUB_seq_R flanking the target sites (Table S1). The PCR was performed following the conditions as described under the gRNA design and plasmid construction section. PCR amplicons obtained were prepared for Sanger sequencing using the BigDye Terminator v3.1 sequencing system from Thermo Fisher. Before sequencing, the PCR products were purified with a QIAquick PCR purification Kit (Qiagen). The sequencing reaction was set up as follows: a reaction mixture containing 2.5 µl PCR product, 1.5 µl of 5X sequencing buffer, 0.5 µl of Big Dye Terminator, 1µl of 10 mM of either PUB_seq_F or PUB_seq_R primer (Table S1) and 4.5 µl of nuclease-free water was prepared. The reaction was amplified in a thermal cycler using the following conditions: initial denaturation step at 95˚C for 2 min, followed by 40 cycles of denaturation at 94˚C for 10 s, annealing at 50 ˚C for 10 s, extension at 60˚C for 4 min, and final extension at 72˚C for 4 min. Following amplification, the sequencing product was purified, resuspended in 10 µl HiDi formamide, and sequenced using an ABI 3130 DNA sequencer (Applied Biosystems, California, USA). The sequence chromatograms were analyzed using SnapGene software (WWW.snapgene.com). Ten replicates per edited event were sequenced.
To further confirm the stability of mutations in the edited events, four selected events (P2, P35, P39 and P50), which showed enhanced resistance to BXW in greenhouse evaluation, were resequenced. The suckers of these events from the potted plants were initiated into the tissue culture19. The target site was amplified, and PCR products were cloned to pCR™8/ GW/TOPO® (Invitrogen) according to the manufacturer’s instruction, transformed to DH5α chemical competent E. coli cells, and selected on LB plates containing spectinomycin.. Ten colonies from each event were randomly selected and sequenced.
Relative expression of MusaPUB transcript in edited events
Total RNA was extracted from leaf tissues of both edited events and wild-type plantlets using the Qiagen Plant RNeasy Kit in accordance with the manufacturer’s instruction. Subsequently, cDNA was synthesized from 1µg of total RNA using LunaScript® RT SuperMix cDNA Synthesis Kit (New England BioLabs inc, Cat. E3010L) according to the instructions in the user manual. The cDNA was diluted 10 times, and 5µl was used for qRT-PCR with primers PUB22_qPCR_F and PUB22_qPCR_R and PUB23_qPCR_F and PUB23_qPCR_R (Table S1) using SYBR Green Master Mix (Applied Biosystems; www.lifetechnologies.com). The qRT-PCR analysis was performed in a QuantStudio5 real-time PCR system (Applied Biosystems, Thermo Fisher Scientific). Musa primers, Musa 25S_F and Musa 25S_R (Table S1) were used as the internal control. The 2−ΔCt method was used to calculate the relative gene expression levels20.
Reactive oxidative burst analysis in pub22/23 edited events
To investigate hydrogen peroxide production in edited plants following Xcm infiltration, a histochemical staining assay using DAB (3,3'-diaminobenzidine) solution was performed21,22. Fully opened green leaves of six-weeks-old in vitro plantlets of the edited events and wild-type control plants were infiltrated with 100 µl of fresh Xcm culture. The infiltrated leaves were incubated for 12 hr post infection (hpi), after which they were cut and incubated in DAB solution in 15 ml falcon tubes wrapped with aluminum foil for 12 h on a shaker (70 rpm) at room temperature. After incubation, the DAB solution was removed, and samples were washed with a bleaching solution (ethanol: acetic acid: glycerol in the ratio of 3:1:1) for 30 min in a water bath at 95 0C to remove chlorophyll. The bleaching solution was refreshed, and the samples were further incubated for 30 min at room temperature. Subsequently, the samples were removed from the bleaching solution, stored in 70% ethanol, and photographed using an SMZ1500 stereomicroscope (Carlsbad, CA, USA) equipped with a high-zoom Nikon camera. ImageJ software (National Institutes of Health, USA) was employed to analyze the pixel intensity of browning in the photographs.
Relative expression of defense genes in pub22/23 edited events
One month-old selected edited events (# 2, 5, and 50) and wild-type control plants were inoculated with a fresh culture of Xcm. Leave tissues were collected at 12 hpi. Total RNA was extracted, and cDNA was synthesized as described above. qRT-PCR was performed in a QuantStudio5 real-time PCR system (Applied Biosystems, Thermo Fisher Scientific) with primers for Pathogenesis related R protein (PR1), antimicrobial peptide (AMP) (vicilin), Respiratory burst oxidase homolog A and C (Rboh-A and Rboh-C), Oxidative Signal-Inducible1 (Oxi1), MYB family transcription factor 4 (MYB4), Leucine-rich repeat (LRR), Polyamine oxidase-like and Phosphatidylinositol 4-phosphate 5-kinase 6-like (PPKL) (Table S1). The relative expression levels of the defense genes were calculated as mentioned above, providing insights into the molecular responses of the edited events and wild-type controls to Xcm inoculation.