Luciferase reporter assays
The filtered human S100A12 promoter regions (S100A12-1~6) were amplified via PCR and subsequently cloned and inserted into the Mul and XhoI restriction sites of the pGL3Basic vector (pGL3-BV). The ligated products were subsequently transformed into competent DH5 alpha cells, which were subsequently plated on lysogeny broth (LB) agar plates supplemented with 100 μg/mL ampicillin (Amp). Promoter-containing pGL3-BV plasmids were transfected into HaCaT cells using Lipofectamine 2000 transfection reagent. Thirty-six hours later, the Dual-Luciferase Reporter Assay System (Promega) was used to measure the luciferase activity of S100A12.
Chromatin immunoprecipitation (ChIP) assays
Chromatin immunoprecipitation (ChIP) assays were used to assess the binding of transcription factors to the promoter regions of S100A12. Formaldehyde was added to the medium for crosslinking of DNA and proteins, and unreacted formaldehyde was neutralized by glycine. The crosslinked chromatin was then sonicated and immunoprecipitated with 10 μg of an anti-KLF5 polyclonal antibody and a normal mouse IgG antibody as a negative control. After elution and purification, the recovered DNA‒protein complexes were analyzed via PCR.
The primer sequences are listed in Supplementary Information Table 1.
Immunostaining and Western blot
Epidermal cells were fixed in 10% formalin, embedded in paraffin and cut into 5 µm sections. The sections were deparaffinized and incubated in antigen retrieval buffer (pH 6.0, DAKO, Carpinteria, CA) in a steamer for 20 minutes. Immunofluorescence staining was performed on 4% paraformaldehyde (PFA)-fixed cells. The samples were incubated with Alexa Fluor 594- or Alexa Fluor 488-conjugated secondary antibodies (Thermo Fisher Scientific, Rockford, IL) after they were incubated with the primary antibodies. Nuclei were stained with 4’,6-diamidino-2 phenylindole (DAPI; Sigma‒Aldrich, MO) in each experiment. The primary antibodies used were as follows: anti-S100A12(abcam,1:100); anti-KLF5(abcam,1:500); anti-CD31(abcam,1:200); anti-VE-cadherin(abcam,1:200). Images were taken under a fluorescence microscope (BX51 WI Olympus).
For western blotting, proteins from all the cells were prepared with RIPA buffer (50 mM Tris, 150 mM NaCl, 1% Triton X-100, 0.1% SDS, and 0.5% sodium deoxycholate, pH 7.5). Equal amounts of protein were separated via SDS‒PAGE and subsequently transferred onto a polyvinylidene difluoride‒nitrocellulose membrane. The membranes were blocked with 5% milk and incubated overnight at 4 °C with primary antibodies as follows: anti-S100A12(abcam,1:1000); anti-KLF5(abcam,1:1000); anti-GAPDH(abcam,1:5000). The membranes were washed and incubated with a horseradish peroxide (HRP)-conjugated secondary antibody (1:5,000 dilution, Vector Laboratories, Burlingame, CA). The protein bands were detected with an enhanced chemiluminescence (ECL) detection kit (GE Healthcare Bio-Sciences, Piscataway, NJ).
ELISA
Secreted S100A12 was detected by enzyme-linked immunosorbent assay (ELISA). After being blocked with blocking buffer (phosphate-buffered saline (PBS) + 0.05% Tween 20 + 2% bovine serum albumin (BSA)), the cells were incubated with 100 μl of sample mixture in highly bound 96-well plates. A standard curve was generated using the purified human recombinant S100A12 protein. Then, the plates were incubated with 0.25 μg/ml rabbit anti-human S100A12 and HRP-conjugated anti-rabbit antibodies (Jackson ImmunoResearch, West Grove, PA, 1:2,000 dilution). The signal was visualized by TMB (3,3′,5,5′-tetramethylbenzidine) substrate (SurModics, Eden Prairie, MN), and the reaction was stopped by 2 M H2SO4. The optical density was measured with a microplate reader (BioTek Instruments, Winooski, VT) at 450 nm.
Gene knockdown
S100A12 knockdown was induced by lentiviral transduction. Short hairpin RNAs (shRNAs) were designed using the RNAi consortium database (Moffat et al., 2006). The sequences for the S100A12 shRNAs used were as follows: forward
5’-CCGGGCTTACAAAGGAGCTTGCAAACTCGAGTTTGCAAGCTCCTTTGTAAGCTTTTTG-3’ and reverse 5’-AA TTCAAAAAGCTTACAAAGGAGCTTGCAAACTCGAGTTTGCAAGCTCCTTTGTAAGC-3’. The double-strand shRNA sequences were synthesized by Integrated DNA Technologies (IDT, Coralville, IA). The double-strand shRNA oligos were cloned and inserted into the pLKO.1 puro vector (Addgene, Cambridge, MA), and lentiviruses were prepared according to the protocol provided by Addgene. In the presence of 2 μg/ml puromycin, lentivirus-transduced HaCaT cells were selected. Western blotting analysis was used to confirm the effectiveness of the gene knockdown.
Endothelial cell function
Scratch assay: An in vitro scratch assay was used to analyze the migration ability of endothelial cells from stratified cultured Hacat cells. A straight line was scratched in the middle of the cells cultured for 24 h and then observed under an inverted microscope. Cell migration ability was assessed by the percentage of wound-healing cells (distance migrated/original wound distance × 100%).
Tube formation assay: The tube-forming activity of endothelial cells was evaluated via a tube formation assay. Matrigel (BD Biosciences) was plated on precooled 24-well plates and incubated at 37 °C for 30 min. Then, a total of 2×105 cells were seeded into the matrix-coated wells and incubated for 8 hours at 37 °C. All the cells were fixed and photographed under a light microscope (Olympus). ImageJ software (National Institutes of Health) was used to quantify the number of tube branches.
Animal experience
Protocol for rabbits with diabetes.
All animal experiments were performed in accordance with procedures approved by the Ethical Committee for the Care and Handling of Experimental Animals of the First Affiliated Hospital of Sun Yat-sen University. New Zealand female rabbits weighing 4-5 kg were purchased from the Experimental Animal Research Laboratory at Sun Yat-sen University in China. The rabbits were housed individually in cages at suitable temperature (22 °C) and humidity (30-70%) and were provided with ad libitum access to water and standard rabbit food. After mild anesthesia, 5% alloxan (50 g/L) was intravenously injected into the rabbits via the marginal ear vein at a dose of 100 mg/kg body weight within 2 minutes. To avoid hypoglycemic shock, 10 ml of glucose (5%) was administered subcutaneously 5 and 10 hours after alloxan injection. One week after the first alloxan injection, the rabbits received a second alloxan injection (100 mg/kg) if the blood glucose level was <16 mmol/L to maintain a blood glucose level above 16 mmol/L. Subcutaneous insulin was necessary if the rabbit blood glucose level (BGL) was >20 mmol/L. The dose of insulin was as follows: (1) BGL 20~22.2 mmol/L received 1 U/kg; (2) BGL 22.3~27.7 mmol/L received 2 U/kg; (3) BGL 27.8~33.3 mmol/L received 3 U/kg; and (4) BGL >33.3 mmol/L received 4 U/kg. Blood glucose levels were measured in the morning daily for the first 4 weeks and then weekly.
Induction of cutaneous wounds.
To evaluate the rate of wound healing in vivo, full-thickness skin wounds were generated on each rabbit ear as described previously. Briefly, seven 6-mm full thickness wounds were made down to the bare cartilage on the ventral side of each rabbit ear using a biopsy punch. The ventral side of the rabbit ear was covered by the semiocclusive dressing Tegaderms (3M Health Care, St. Paul, MN) to prevent desiccation of the wounds. siS100A12 diluted in 30 ng/ml PBS (Li Rui Biological Technology Co., Ltd., Shanghai, China) was applied to the wound to knock down the expression of S100A12, and PBS containing vector alone was used as a control. All wounds were bandaged with sterile gauze and treated with the experimental solutions daily. The wound dressings were changed, and digital photographs were taken daily to record wound healing.
Analysis of wound healing
The wounds were digitally photographed at specified intervals. In double-blind conditions, Image-Pro Plus v. 6.0 (Media Cybernetics) was used to analyze wound closure. The wound areas were standardized by comparison with the original wound size, and the healing rate was expressed as a percentage of wound closure using the following formula: [(Day 0 area – day n area)/(Day 0 area)] ×100% (n= 0, 7 or 14).
The microvessel density (MVD) was quantified to determine the capacity of endothelial cells to form blood vessels. Endothelial cells were labeled with CD31, and CD31-positive endothelial cells and vessels of all morphologies were counted in 10×20 power fields.
Statistics
Statistical analyses were performed with SPSS software (version 17.0, SPSS, Chicago, IL, USA). All data were represented as mean ± SEM. Unpaired Student’s t test was used for two-group comparisons, and One-way ANOVA followed by the Tukey-Kramer’s post hoc test was used for multiple group comparisons. P <0.01 was considered significant in all the experiments.