Patients and tissue samples. The present study was approved by the Medical Ethics Committee of the Northern Theater General Hospital (Shenyang China). HS (deep red, thickened, itchy and painful HS at 3–6 months following burn injuries or wound healing) tissues were obtained at the surgery from patients with HS, and the surrounding normal skin tissues were selected as the normal controls (12 cases; average age, 32.39 ± 18.42 years; 4 females and 8 males). All the scar tissues were located on either the arms or legs. None of the patients had received any hormone, drug, radiotherapy or other treatments prior to surgery. All participants had no systemic diseases, were able to function independently and were thus able to cooperate to complete the study. Every participant signed a written informed consent form.
The epidermis and subcutaneous tissue were removed under the sterile surgical platform, and the samples were divided into three sections: The first section was placed in RNAstore solution (Beyotime Institute of Biotechnology) to extract total RNA. The second section was place in protein lysis buffer (Beyotime Institute of Biotechnology) to extract total protein, and the third section was used to extract fibroblasts.
miRNA array analysis. miRNA arrays 3.0 (Affymetrix; Thermo Fisher Scientific, Inc.) was used to analyze the extracted RNAs. A total of 84 miRNAs were examined with the Affymetrix array.
Through website( https://starbase.sysu.edu.cn/ )Predict the proteins that miRNA may bind to.
Fibroblast isolation The excised scar tissue was cultured on an ultra-clean bench within 1 h of removal. The tissue was washed repeatedly with phosphate buffer, cut into very small sections resembling thick mud, and digested with 0.1% type I collagenase at 37˚C for 2 h. DMEM (Dulbecco's modification of Eagle's medium Dulbecco) with 10% fetal bovine serum medium was used for culture.
RNA extraction. Total RNA Extraction Kit (Tiangen biochemical technology (Beijing) Co., Ltd) was used to lyse the tissues or cells, followed by the addition of 0.2 ml chloroform(Tiangen biochemical technology (Beijing) Co., Ltd). The solution was then mixed well and allowed to stand at room temperature for 2 min. The mixture was then centrifuged at 10000 x g at 4˚C for 10 min. Subsequently, 200 µl absolute ethanol was added, followed by centrifugation at 10000 x g at 4˚C for 1 min. The solution was air-dried for 2 min and 50 µl DEPC-treated water (Tiangen biochemical technology (Beijing) Co., Ltd) was then added to the RNA.
Quantitative polymerase chain reaction (qPCR). The real-time reaction kit (Beijing Dingguo Changsheng Biotechnology Co., Ltd, qPCR001) was used to reverse transcribe the RNA into cDNA (Promega Corporation). Reaction was conducted for 15 min at 42°C followed by 5 min at 98°C and the reaction volume was 20 µl. The Mx3000P Real-Time PCR system was used to perform qPCR (Applied Biosystems; Thermo Fisher Scientific, Inc.). Conditions were: 95°C for 30 sec followed by 40 cycles at 95°C for 5 sec and 60°C for 30 sec and the reaction volume was 25 µl. The sequences of the primer used were: TGF-β1 forward, 5’-GGGACTATCCACCTGCAAGA-3’ and reverse, 5’-CCTCCTTGGCGTAGTAGTCG-3’; GAPDH forward, 5’-AGCCACATCGCTCAGACAC-3’ and reverse, 5’-GCCCAATACGACCAAATCC-3’; miR-361 forward, 5’-CGCGCTAGCAGCACGTAAAT-3’ and reverse, 5’-GTGCAGGGTCCGAGGT-3’; and U6 forward, 5’-CGCTTCGGCAGCACATATAC-3’ and reverse, 5’-TTCACGAATTTGCGTGTCA-3’. 2−ΔΔCq method was used to calculate the relative gene expressions[10]
Transfection. Serum-free medium was added to a transfection tube and DNA or small-strand DNA was then added, followed by shaking and the addition of Lipofectamine 2000 (Shanghai SiGe Biotechnology Co., Ltd). The mixture was then added to the fibroblasts. The cells were transfected with the following: miR-361 negative control(UUGUACUACACAAAAGUACUG), miR-361(UUAUCAGAAUCUCCAGGGGUAC), miR-361 inhibitor(GUACCCCUGGAGAUUCUGAUAA), 2µl negative control (NC, Shenggong Bioengineering (Shanghai) Co., Ltd), 2µl si-TGF-β1 (Shenggong Bioengineering (Shanghai) Co., Ltd), 2µl vector (Shenggong Bioengineering (Shanghai) Co., Ltd) or 2µl TGF-β1 (Shenggong Bioengineering (Shanghai) Co., Ltd). 100 nM of miR-361 negative control, miR-361 or miR-361 inhibitor (Guangzhou RiboBio Co., Ltd.) was mixed and incubated for 30 min, and then added into microglia with complete medium containing 15% FBS. After 24 h following transfection, cells were harvested for further study.
Luciferase assays. The 3’-UTR of TGF-β1 was cloned into a modified pGL3 luciferase vector (Promega Corporation). The products were also inserted into the pGL3 vector with primers to generate point substitutions in miRNA binding sites (pGl3-TGF-β1-UTR-MUT). Following amplification and DNA sequencing verification, the constructed DNA was used for luciferase reporter assays. HS-derived cells were grown and transfected with 1 µg luciferase gene, pGl3-TGF-β1-UTR, pGl3-TGF-β1-UTR-MUT, miR-361 or negative controls (control) for 24 h by Lipofectamine 2000 (Shanghai SiGe Biotechnology Co., Ltd). After transfection for 24 h, the cells were lysed and the activity of firefly luciferase and Renilla luciferase was measured by using dual-luciferase reporter assay (Promega Corporation). The ratio of the two identified the relative activity of luciferase.
3-(4,5-Dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT) assay. A total of After transfection for 0, 12, 24, 36 and 48 h, 5 mg/ml MTT solution (Beijing kangruina Biotechnology Co., Ltd) was added to the cells followed by incubation at 37°C for 4 h. The medium was then replaced with 150 µl DMSO (Beijing kangruina Biotechnology Co., Ltd). Optical densities were read at 490 nm using a microplate reader (Bio-Rad Laboratories Co., Ltd.) ([11]).
Western blot analysis. Tissues and cells were lysed using protein lysis buffer (Beijing YITA Biotechnology Co., Ltd) and centrifuged at 10000 x g for 20 min at 4˚Cand the protein concentration was measured using a BCA Protein Assay kit (Thermo Fisher Scientific, Inc.). A total of 30 µg protein was separated using SDS-PAGE gel and then transferred onto a nitrocellulose membrane by electro blotting. After blocking the membrane with 5% sealing solution for 1 h, it was incubated with antibodies to TGF-β1 (1:1,000, cat. no. ab92486, Abcam) and GAPDH (1:1,000, cat. no. 60004, Cell Signaling Technology, Inc.) overnight at 4˚C. The membrane was then incubated with the secondary antibody (goat anti-rabbit IgG HRP; 1:5,000, ab97051, Abcam) at room temperature for 1 h. Protein bands were detected by Pierce ECL western blot substrate (Thermo Fisher Scientific, Inc.) with ECL detection system (Thermo Fisher Scientific, Inc.).
Rabbit ear scar model. A total of nine healthy New Zealand white rabbits (weighing 2-2.5 kg, with an average age of 3 months) were selected and divided into three groups as follows: The control (n = 3), the scar (n = 3) and the miR-361 group (n = 3). The HS model using rabbit ears was established as previously described [12, 13]). A clear ear marginal vein was selected and pentobarbital (40 mg/kg) was then slowly injected from the distal end for anesthesia. After the anesthesia took effect, moving up at a radius of 5 mm in the rabbit ear, the surface skin was peeled off using a scalpel. At 3 weeks post-surgery, scars appeared on the rabbit ears. At this time, in the miR-361 group, 10 µl miR-361 agomir was slowly injected into the scar tissue using a micro syringe. After 60 days, the animals were anesthetized using pentobarbital (i.v., 40 mg/kg) and sacrificed by exsanguination (blood volume, ~ 85 ml each). Specimens with a diameter of ~ 1 cm was obtained from the rabbit ears.
All experimental procedures involving animals were conducted in accordance with the Guide for the Care and Use of Laboratory Animals (NIH publication no. 80 − 23, revised 1996) and were performed according to the institutional ethical guidelines for animal experiment.
Hematoxylin and eosin (H&E) staining. The tissues were fixed in 4% paraformaldehyde, dehydrated in a gradient ethanol series, and then embedded in paraffin. The sections were then sliced into serial sections at a thickness of 5 µm, and finally processed for H&E staining(Beijing YITA Biotechnology Co., Ltd) as previously described[14].
Masson’s staining. The tissues were fixed in 4% paraformaldehyde, dehydrated in a gradient ethanol series, and embedded in paraffin. They were then sliced into serial sections at a thickness of 5 µm, and finally processed for Masson’s staining (Beijing YITA Biotechnology Co., Ltd) as previously described[15].
Immunohistochemical staining. The dewaxed tissue slides were placed into 3% H2O2 and allowed to stand at room temperature for 5 min. They were then removed and rinsed under distilled water, and then placed in PBS solution for 5 min. The soaking liquid completely submerged the tissue slides. All sections were sealed in goat serum at room temperature for 10 min. The remaining sealing liquid on the slice was gently and carefully shaken off. Primary antibody(TGF-β1,1:1, 00, cat. no. ab92486, Abcam, VEGF,1:1, 00, cat. no. ab46154, Abcam) was then added in a drop-wise manner to all scar tissue sections, and then placed in a wet box containing an appropriate amount of water and incubated in a low-temperature refrigerator overnight, with the refrigerator temperature set to 4˚C. The PBS solution was then completely washed off, and the residual PBS solution was gently removed. This was followed by the addition of secondary antibody (HRP-conjugated anti-rabbit IgG secondary antibody, 1:200, cat. no. 31460; Invitrogen; Thermo Fisher Scientific, Inc.) in a drop-wise manner and the specimens were placed in an incubator at 37˚C for 30 min. Following treatment with PBS solution again, horseradish enzyme-labeled streptomycin (hz-2037R-HRP, Shanghai Huzhen Industrial Co., Ltd, ) was then added to the tissue slides in a drop-wise manner, followed by incubation in a constant temperature box at 37˚C for 30 min. Sections were visualized using DAB and counterstained using hematoxylin (DA1010-3, Beijing solabao Technology Co., Ltd). Positive staining was indicated by brown and yellow.
Statistical analysis. All experiments were repeated three times. The data are expressed as the mean ± standard error of the mean. Statistical analysis was performed using GraphPad Prism 7. A Student’s t-test or one-way/two-way ANOVA with Bonferroni corrections were used for specific comparisons. P < 0.05 was considered to indicate a statistically significant difference.