2.1. Animals
Male C57BL/6J mice aged 7 ~ 8 weeks were procured from the SPF Biotechnology Co., ltd (Beijing, China). All mice had free access to standard chow and water under a temperature and humidity room on a 12 h light/dark cycle. All procedures for animal studies were reviewed and approved by the Ethics Committee of Jiangnan University (JN.No20220915c1081231[360]). All animal experiments took place in Jiangnan University. The experiments were complied with the Care and Use of Laboratory Animals published by the US National Institutes of Health (NIH Publication, revised 2011), and the ethical standards in the 1964 Declaration of Helsinki. All mice were randomly divided into eight groups: Control (Con) group, ischemia/reperfusion (I/R) group, Dexmedetomidine preconditioning (DEX)group, Dexmedetomidine preconditioning + ischemia/reperfusion (I/R + DEX) group, BAT ablation + Dexmedetomidine preconditioning + ischemia/reperfusion (I/R + DEX + BAT ablation),FGF21 neutralizing antibody + Dexmedetomidine preconditioning + ischemia/reperfusion (I/R + DEX + FGF21-Ab) group, Compound C + Dexmedetomidine preconditioning + ischemia/reperfusion (I/R + DEX + Compound C),SR-18292 + Dexmedetomidine preconditioning + ischemia/reperfusion (I/R + DEX + SR-18292) group. Only sham surgery was performed in the Con group, the DEX group was subjected to daily intraperitoneal injection of Dexmedetomidine (100 µg/kg) for 7 days before the sham operation or I/R. The I/R + DEX + BAT ablation group received iBAT resection for 48 h, and treated with intraperitoneal injection of Dexmedetomidine (100 µg/kg) for 7 days before the I/R operation. The I/R + DEX + FGF21-Ab group received FGF21 neutralizing antibody (0.3mg/kg body weight) and Dexmedetomidine (100 µg/kg) for 7 days before the I/R operation. The I/R + DEX + Compound C group was intraperitoneally injected with Coumpound C at a dose of 25mg/kg for 48 h, and and treated with intraperitoneal injection of Dexmedetomidine (100 µg/kg) for 7 days before the I/R operation. I/R + DEX + SR-18292 group received SR-18292 at a dose of 45 mg/kg and Dexmedetomidine (100 µg/kg) for 7 consecutive days by intraperitoneal injection, and MI/R surgery was performed 3 h after injection on day 7 [31]. For euthanasia, animals were anesthetized with 5% isoflurane, anaesthesia was confirmed via tail pinch, and then sacrificed by cervical dislocation before cardiac tissue removal.
2.2. Myocardial ischemia/reperfusion injury model
The mice was anesthetized with sevoflurane and the MI/R surgery was established as previously described[32]. Following left thoracotomy at the fourth intercostal, the left main descending coronary artery(LAD) was ligated using a 6 − 0 silk suture. Ligation was considered successful when the anterior wall of the left ventricle turned pale. Whereafter, the heart is immediately placed back in the chest followed by closing the chest in layers. After 30 minutes of ischemia, the slipknot was released. The control group underwent the same surgical procedure without ligation of the LAD.
2.3. Surgical BAT ablation
Mice was exposed to euthanasia by 1% pentobarbital Sodium (50 mg/kg body weight) and fixed in a prone position. An approximate 1.5 cm incision was cut in the interscapular region, and the iBAT was carefully removed and the incision was sutured loosely. Sham control underwent all the surgical procedures except the surgical ablation of BAT. The mice recovered for 48 hours and received the sham or MI/R surgery.
2.4. Evaluation of echocardiography
Mice was anesthetized with 1.5% isoflurane 24 hours after the reperfusion, and echocardiography was performed using the Vevo high-resolution imaging system (Fujifilm, Japan). A two-dimensional M-mode image was used to evaluate the left ventricular function. The ejection fraction (EF%) and fractional shortening (FS%) parameters were calculated using the computerized algorithms. The results were averaged from the five consecutive cardiac cycles measured from the M-mode images.
2.5. Determination of myocardial infarct size
Once the reperfusion reached an end,the heart was removed quickly, rinsed with normal saline and frozen at -20°C for 30min.Then,the heart was equally sliced into four pieces from tip to bottom.The slices were dyed by 2% diphenyltetrazolium chloride (TTC) solution at 37°C for 15 min without light and the active myocardial was represented as brick red.After fixation with a 4% paraformaldehyde solution for 24 h, the heat sections were captured and the infarct area was calculated using image software (IMAGE J, NIH, USA). The infarct size was defined as the ratio of the infarct area to the risk one.
2.6. Hematoxylin-eosin (H&E) staining
The mice were sacrificed and their hearts were taken and fixed with 4% paraformaldehyde. The heart was then encased in paraffin, sectioned into slices(µm), and separately stained with standard H&E histology (No.C0105S, Beyotime, China). Morphological characteristics of heart section were observed using an optical microscope with a 40x objective.
2.7. TUNEL detection
Cardiomyocyte apoptosis was detected by TUNEL assay kit (KTA2010, Abokine, China). The apoptosis rate was represented by the percentage of TUNEL positive cardiomyocytes in the total cells of the fields.
2.8. Cell culture and cardiomyocyte hypoxia/reoxygenation (H/R) model
Cardiomyocyte hypoxia reoxygenation model was established as follows: cardiomyocytes (HL-1) were cultured in the DMEM without glucose in a humidified atmosphere of 5% CO2, 94% N2 and 1% O2 at 37°C for 6 h, followed by incubation under normoxia (95% air and 5% CO2) for 24 h in the DMEM with high glucose containing 10% FBS. Brown adipocytes (HIB 1B) were cultured in the DMEM with high glucose containing 10% FBS.
2.9. Cell viability
The cell viability of cardiomyocytes was detected by CCK-8 kits. Cardiomyocytes were seeded at a density of 1.0 × 104 cells/well in a 96-well plate and grown for 24 h. After H/R treatment, CCK-8 solution (10 µl, Biosharp) was added to each well of the plate and the cells were incubated at 37°C for 2h. The OD value in each well was detected at 450 nm by a microplate reader (BioTek Instruments, USA). A LDH release assay kit was utilized to detect the LDH from cells in which the absorbance was measured at 490 nm. Cell viability and lactate dehydrogenase release were normalized in the control group.
2.10. Enzyme-linked immunosorbent assay (ELISA)
The levels of CK-MB (SBJ-M1037, Sbjbio, China) and mouse FGF21 (E-EL-M0029c, Elabscience, China) in the serum were measured by ELISA, according to the manufacturer’s instructions.
2.11. Dihydroethidium (DHE) staining
Intracellular ROS levels were measured by DHE staining. Fixed cardiomyocytes were incubated with DHE probe (10 nM) away from light for 30 min at 37°C. Then the fluorescence images were photographed by microscope.
2.12. Flow cytometry
Cardiomyocytes were seeded at 1.0 × 106 cells/well in a 6-well plate and grown for 24 h, then stimulated by H/R treatment. Cell apoptosis was detected using an Annexin V-FITC/PI Apoptosis Detection Kit (C1062M, Beyotime, China) according to the manufacturer’s instructions. The cells with positive Annexin V-FITC staining and negative PI staining were apoptotic cells. Cell apoptosis rate was analyzed with BD FACSAria III flow cytometry. The data were processed by FlowJo software.
2.13. Quantitative real-time PCR
Total RNA in cardiac tissues,brown adipose tissues and cells were harvested using Trizol reagents(15322,CWBIO,China).The equal contents of RNA (1µg) were reverse transcribed using the cDNA Synthesis SuperMix kit (11141ES60,YEASEN Biotechnology,China).Real-time PCR was performed using the qPCR SYBR Green Master Mix(11202ES08,YEASEN Biotechnology,China).The sequences of primers used are the following: β-actin,Forward-5’GCTACAGCTTCACCACCACAG3’,Reverse-5’GGTCTTTACGGATGTCAACGTC3’;FGF21,Forward-5’AAGACACTGAAGCCCACCTG3’,Reverse-5’ATCAAAGTGAGGCGATCCAT3’;UCP1,Forward-5’GTACCAAGCTGTGCGATGTC3’,Reverse-5’ATTCGTGGTCTCCCAGCATA3’;PPARr,Forward-5’AATCCACGAAGCCTACCTGA’,Reverse-5’AATCGGACCTCTGCCTCTTT3’;PRDM16,Forward-5’GCTCGTGTTTAGCGGTCATTA’,Reverse-5’GCGTCTTCTCGATTCACG3’;CIDEA,Forward-5’CTCGGCTGTCTCAATGTCAA’,Reverse-5’CCGCATAGACCAGGAACTGT3’;HO-1,Forward-5’AAGCCGAGAATGCTGAGTTCA’,Reverse-5’GCCGTGTAGATATGGTACAAGA3’;NQO1,Forward-5’TGGCCGAACACAAGAAGCTG’,Reverse-5’GCTACGAGCACTCTCTCAAACC3’;GCLM,Forward-5’AGGAGCTTCGGGACTGTATCC’,Reverse-5’GGGACATGGTGCATTCCAAAA3’;GCLC,Forward-5’GGACAAACCCCAACCATCC’,Reverse-5’GTTGAACTCAGACATCGTTCCT3’.The relative expression of target genes was calculated by the 2–∆∆Ct method.
2.14. Western blot
Proteins of cardiac tissues,brown adipose tissues and cells were extracted by lysis buffer (P0013, Beyotime, China).Proteins(30 µg) were separated by polyacrylamide gel electrophoresis(8%,10% or 12% SDS-PAGE gel) and transferred to a PVDF membrane(IPVH00010,Millipore,USA).Afterward, the membranes were blocked for 1h at room temperature 5% non-fat dry milk(5g skim milk powder in 100ml TBST).Then the membranes were incubated with primary antibodies such as anti-β-actin(4970T,Cell siganaling technology), anti-FGF21(26272-1-AP,Proteintech), anti-Bcl-2(BM4985,Boster), anti-Bax(A00183,Boster), anti-cleaved caspase 3(9661S,Cell siganaling technology), anti-AMPK(A00994-6,Boster), anti-p-AMPK(AF3423,Affinity), anti-PGC1α(sc-518025,Santa Cruz Biotechnology), anti-Keap1(10503-2-AP,Proteintech), anti-Nrf2(16396-1-AP,Proteintech) antibodies at 4 ℃, followed by incubation with HRP-conjugated secondary antibodies for 2 h at room temperature. Expose and develop the membranes after treatment with the developing solution; the gray value analysis is performed by Image J, and each experiment was in triplicate.
2.15. Co-immunoprecipitation
The cell lysates were immunoprecipitated with the anti-Keap1 antibodies(1 µg) for 2 h at 4°C and then incubated with protein G PLUS-Agarose (20 µl) at 4°C on a shaking table overnight. After centrifugation, the supernatant was discarded and the precipitate was resuspended in protein loding buffer (40 µl) and boiled for 10 min. Subsequently, proteins were separated by SDS-PAGE, transferred to PVDF membranes, blocked, incubated with primary antibodies and secondary antibody as described above.
2.16. Molecular docking
The 3D structure of dexmedetomidine for molecular docking was built using Discovery Studio. The crystal structure of AMPK protein was then obtained from the RCSB Protein Data Bank database. Molecular docking calculations were executed by the LibDock program in Dock Ligands. In addition, PyMOL was used to complete the molecular binding pattern diagram of AMPK and DEX.
2.17. Statistical analysis
All data are calculated as the mean ± standard deviation. Differences between groups were determined by One-way ANOVA followed by Bonferroni’s multiple comparisons test. SPSS version 19 statistical software (IBM Corp.) was used for all statistical analysis. The P value < 0.05 was considered as statistically significant.