Cell lines and reagents
EBV + P3HR-1 and Daudi BL cell lines were obtained from ATCC. EBV + Mutu I BL was obtained from Dr. Ben Gewurz (originally a gift from Jeff Sample). EBV + Rael BL was obtained from Dr. Lisa Guilino Roth. EBV + GM12878, GM12892, GM12881, GM14890, and GM15892 LCLs were obtained from the Coriell Institute. 2-3-3 E2HT LCLs, expressing EBNA2 fused to an estrogen receptor 4-hydroxytamoxifen (4HT)-binding domain, were obtained from Dr. Bo Zhao. In the presence of 1 µM 4HT, EBNA2HT localizes to the nucleus; without 4HT, it relocalizes to the cytosol and becomes destabilized. To remove 4HT, cells underwent five washes with 4HT-free media, the last two washes lasting 30 minutes each before re-seeding at 300,000 cells per mL. Cells were then grown for an additional 48 hours before cell lysate preparation. The conditional P493-6 LCLs, a gift from Dr. Ben Gewurz, contain a conditional EBNA2-HT allele and an exogenous Tet-OFF MYC allele. Cells were washed three times with PBS, then seeded at 0.3 million/mL in RPMI-1640 media with 10% doxycycline-free FBS, and treated under various conditions for 48h as specified. To culture P493-6 cells at a low MYC state, they were grown without 4-hydroxytamoxifen (4HT, SML1666, Sigma-Aldrich) and with 1 mM doxycycline (HY-N0565, MedChemExpress). For a high MYC BL-like state, both doxycycline and 4HT were removed. For a high EBNA2 LCL state, cells were treated with 1 µg/mL doxycycline and 1 µM 4HT. For a high MYC and EBNA2 state, cells received 1 µM 4HT but no doxycycline. HEK-293 T cell line was obtained from ATCC. All the BL, DLBCL, LCL, and PEL cell lines, as well as primary B cells, were cultured in RPMI 1640 medium (Gibco, Life Technologies) with 10% fetal bovine serum (FBS, Gibco) or with dialyzed FBS where indicated (Gibco). HEK-293 T cells were cultured in Dulbecco’s Modified Eagle’s Medium (DMEM, Gibco) with 10% FBS. To obtain the stable Streptococcus pyogenes Cas9 expression, cell lines were treated with lentiviral transduction and blasticidin (5 µg/mL, ant-bi-1, InvivoGen) selection. To select the transduced cells, puromycin (3 µg/mL, A11138-03, Gibco) or hygromycin (100 µg/mL, 10687010, ThermoFisher) were added to the post-infection cells. All Cells were cultured at 37° in 5% CO2 incubator.
Cells were treated with 1 µM alexidine dihydrochloride (AD, A4542, ApexBio) at a density of 2×10^5/mL for 48 hours, refreshing AD after 24 hours and diluting the cells 1:1 with culture media. AD treatment details are specified in figure legends. For antioxidant rescue analysis with N-acetyl-L-cysteine (NAC, 7874, Tocris) and L-glutathione reduced (GSH, 70-18-8, Millipore), GM12878 cells were co-treated with 1 µM AD and either 1.5 mM NAC or 2 mM GSH, refreshing treatments after 24 hours. GOT1 or G6PD knockout GM12878 LCLs, after puromycin selection, were treated with DMSO or 1µM AD for 48 hours. Similarly, GM12878 LCLs expressing GFP or SLC1A3, post-puromycin selection, received DMSO, 1µM AD, or 1µM AD plus 1mM L-aspartate (A1330000, Sigma-Aldrich) for 48 hours. For pyruvate supplementation studies, GM12878 LCL cells were treated with DMSO or 1µM AD and 0, 1, or 5 mM sodium pyruvate (P5280, Sigma-Aldrich) for 48 hours.
Live cell counts following AD treatment with or without 10µM SHIN1 (S6392, Selleckchem) were performed on GM12878 LCL, GM15892 LCL, Mutu I BL, or Daudi BL, using DMSO, 1µM AD, 10µM SHIN1, or a combination of 1µM AD and 10µM SHIN1 for 48 hours. For studies on the effect of glutamine restriction with AD treatment, GM12878 LCLs were washed with PBS, resuspended in glutamine-free RPMI-1640 (21870-076, Gibco) with 10% dialyzed FBS, seeded at 2×10^5/mL, supplemented with 2 mM or 0.2 mM L-Glutamine (25030-149, Gibco), and treated with DMSO or 1µM AD for 48 hours.
Human Primary B cells isolation
Discarded, de-identified leukocyte fractions left over from platelet donations were obtained from the Brigham and Women’s Hospital Blood Bank. Blood cells were collected from platelet donors following institutional guidelines. Since these were de-identified samples, the gender was unknown. Our studies on primary human blood cells were approved by the Tufts University Institutional Review Board (Tufts IRB: STUDY00004385). Primary human B cells were isolated by negative selection using RosetteSep Human B Cell Enrichment and EasySep Human B cell enrichment kits (Stem Cell Technologies), according to the manufacturers’ protocols. B cell purity was confirmed by plasma membrane CD19 positivity through FACS. Cells were then cultured with RPMI 1640 with 10% FBS.
EBV production and concentration
The EBV B95-8 strain was generated from B95-8 cells engineered for inducible ZTA expression (a gift from Dr. Ben Gewurz). The activation of EBV lytic cycle was achieved by treating the cells with 1 µM of 4HT for 24 hours. Subsequently, the 4HT was removed, and the cells were cultured in RPMI medium supplemented with 10% FBS, devoid of 4HT, for an additional 96 hours. The viral supernatants obtained were then cleared of producer cells by passing through a 0.45 µm filter. The viral titer was assessed using a transformation assay. Similarly, the P3HR-1 strain of EBV was obtained from a P3HR-1 cell line that expresses 4HT-inducible ZTA-HT and RTA-HT alleles, generously provided by Dr. Ben Gewurz. The induction process involved treating P3HR1 ZHT/RHT cells with 1 µM of 4HT for a 24-hour period. Afterwards, the culture medium was replaced with fresh RPMI/FBS medium, and the cultures were allowed to incubate for 96 hours to collect the virus-rich supernatants. These supernatants were then filtered using a 0.45 µM filter for purification. The supernatant was transferred to an ultracentrifuge tube (326823, Beckman Coulter) and centrifuged at 25,000 rpm for 2 h at 4°C in an ultracentrifuge (OPTIMA XPN-100, Beckman Coulter). The viral pellet was resuspended and aliquoted in PBS with 2% dialyzed FBS, stored at − 80°C until infection. The genomic DNA of virus was quantified by PCR targeting the BALF5 gene from the extracted viral genome. This quantification was used to standardize the virus amounts for cell infection experiments.
Transmission electron microscopy (TEM)
A mixture of 2.5% paraformaldehyde, 5% glutaraldehyde, and 0.06% picric acid in 0.2 mol/L Cacodylate buffer was freshly prepared before use, then the above mixture was diluted 1:1 with dH2O. To Fix primary B cells, 1 million cells were collected and washed with Dulbecco’s Phosphate Buffered Saline (DPBS, 14190, Gibco) one time, remove the residue buffer, then gently add the diluted fixative to the primary B cells. The cells were fixed at RT for 1h. The cells were then post-fixed for 30 min in 1% Osmium tetroxide (OsO4)/1.5% potassium ferrocyanide (KFeCN6), washed in water 3x and incubated in 1% aqueous uranyl acetate for 30 minutes. Samples were then washed twice in water and dehydrated in grades of alcohol (5min each; 50%, 70%, 95%, 2x 100%). Cells were removed from the dish in propyleneoxide, pelleted at 3000 rpm for 3 minutes and infiltrated for 2 hours in a 1:1 mixture of propyleneoxide and TAAB Epon (Marivac Canada Inc. St. Laurent, Canada). Samples were subsequently embedded in TAAB Epon and polymerized at 60 degrees C for 48 hrs. Ultrathin sections (about 60nm) were cut on a Reichert Ultracut-S microtome, picked up on to copper grids stained with lead citrate and examined in a JEOL 1200EX transmission electron microscope or a TecnaiG² Spirit BioTWIN. Images were recorded with an AMT 2k CCD camera.
CRISPR/Cas9 editing
CRISPR/Cas9 knock-out was performed in cells with stably Cas9 expression, using Broad Institute Brunello or Avana library sgRNA sequences as listed in Table S1. CRISPR/dCas9 interference (CRISPRi) was performed in GM12878 LCL expressing dCas9 fused with KRAB. Single guide RNAs against targeting upstream CRLS1 enhancers were designed using GPP sgRNA Designer at the Broad Institute. sgRNA oligos were obtained from Integrated DNA Technologies and cloned into the pLentiGuide-Puro vector (Addgene plasmid #52963, a gift from Feng Zhang). Lentiviruses were produced in HEK-293 cells by co-transfection of pLentiGuid-puro with psPAX2 and VSV-G packaging. At 24 hours post transfection, cell culture media was changed to RPMI-1640 + 10% FBS. Two rounds of lentiviral transduction were performed at 48 and 72 hours post plasmids transfection. Cells were selected by puromycin (3 µg/ml), added 48 hours post-transduction. Depletion of target gene encoded protein expression was confirmed by immunoblot.
cDNA rescue
The PTPMT1 cDNA with silent PAM site mutations was purchased from IDT and was inserted into pLX-TRC313 (a gift from John Doench) by HifiAssembly (New England Bioloabs). GM12878 -Cas9 with stable C-terminal V5 epitope-tagged PTPMT1 cDNA expression was established by lentiviral transduction and hygromycin selection as described above. Ten days post hygromycin selection, PTPMT1-V5 expression was confirmed by immunoblot. The sequence of PTPMT1 rescue cDNA is listed below. sg PTPMT1 targeting sequences are highlighted in underlined bold. PAM sequences are underlined. Mutation sites are indicated in italics bold. Overlapping sequences for HifiAssembly reaction are highlighted in underlined.
>PTPMT1 cDNA
TCTTCCATTTCAGGTGTCGTGAGGCTAGCATGGCGGCCACCGCGCTGCTGGAGGCCGGCCTGGCGCGGGTGCTCTTCTACCCGA
CGCTGCTCTACACCCTGTTCCGCGGGAAGGTGCCGGGTCGGGCGCACCGGGACTGGTACCACCGCATCGACCCCACCGTGCTGC
TGGGCGCGCTGCCGTTGCGGAGCTTGACGCGCCAGCTGGTACAGGACGAGAACGTGCGCGGGGTGATCACCATGAACGAAGAG
TACGAGACGAGGTTCCTGTGCAACTCTTCACAGGAGTGGAAGAGACTAGGAGTCGAGCAGCTGCGGCTCAGCACAGTAGACAT
GACTGGGATCCCCACCTTGGACAACCTCCAGAAGGGAGTCCAATTTGCTCTCAAGTACCAGTCGCTGGGCCAGTGTGTTTACGT
GCATTGTAAGGCTGGGCGCTCCAGGAGTGCCACTATGGTGGCAGCATACCTGATTCAGGTGCACAAATGGAGTCCAGAGGAGGC
TGTAAGAGCCATCGCCAAGATCCGGTCATACATCCACATCAGGCCTGGCCAGCTGGATGTTCTTAAAGAGTTCCACAAGCAGATT
ACTGCACGGGCAACAAAGGATGGGACTTTTGTCATTTCAAAGACAGATATCGGTAAGCCTATCCCTAACCCTC
Mitochondria isolation
The mitochondria were isolated following the manufacturer’s protocols of Mitochondria Isolation Kit for Cultured Cells (89874, Thermo Fisher Scientific). Specifically, 20 million cells were harvested into a 2.0 mL microcentrifuge tube, centrifuged at 850 g for 2 minutes, the supernatant was removed and then the cell pellet was added with 800 µL of Mitochondria Isolation Reagent A containing EDTA-free protease inhibitor (cOmplete™, Millipore Sigma). Gently vortex and incubate on ice for exactly 2 minutes. 10 µL of Mitochondria Isolation Reagent B was then added to the mixture and incubated on ice, fully vortexing the mixture at every minute. After 5 minutes, 800 µL of Mitochondria Isolation Reagent C containing EDTA-free protease inhibitor was included, gently inverted tube several times before centrifuging at 700 g for 10 minutes at 4°C. Transfer the supernatant to a new, 2.0 mL tube and centrifuge at 12,000 g for 15 minutes at 4°C. The obtained mitochondrial pellet was resuspended in 100 µL of Mitochondria Isolation Reagent C containing EDTA-free protease inhibitor. The protein content of mitochondria was further measured by Qubit 4 Fluorometer (Q33226, Thermo Fisher Scientific) with Qubit Protein Assay kit (Q33212, Thermo Fisher Scientific).
Blue-Native (BN) gel electrophoresis and immunodetection.
Sample preparation. The BN gel electrophoresis and Immunoblot was conducted as previously described59. The NativePAGE sample prep kit (BN2008, Thermo Fisher Scientific) was used to make the mitochondrial Sample buffer cocktail. 50 µg mitochondrial protein was mixed with 5 µL 4× NativePAGE sample buffer, 8 µL 5% digitonin, and 7 µL water in the kit. Then we incubated the solubilized mitochondria on ice for 20 min. After that, solubilized mitochondria were then centrifuged at 20,000 g for 10 min at 4°C. 15 µL supernatant was transferred into a new tube and fully mixed with 2 µL Coomassie G-250 sample additive in kit.
Electrophoresis. Each well (NativePAGE 3–12% gradient gel, BN2011, BX10, Thermo Fisher Scientific) was gently washed with 1 mL of dark blue 1X cathode buffer (BN2002, Thermo Fisher Scientific). Subsequently, 15 µL of mitochondrial sample was loaded into the gel. The inner chamber was filled with 1X dark blue cathode buffer, and 600 mL of 1X running buffer (BN2002, Thermo Fisher Scientific) was added to the outer chamber. Electrophoresis took place in an XCell SureLock Electrophoresis-Cell (EI0001, Novex) at a constant voltage of 150 V for 30 minutes, with the current limited to 15 mA. Following this, the buffer in the inner chamber was replaced with light blue buffer (created by mixing 20 mL of dark blue 1X cathode buffer with 180 mL of distilled water). Electrophoresis continued at 250 V for 60 minutes.
Immunoblot. The BN-PAGE gel was gently washed with water for 5 minutes to remove the cathode buffer. It was then placed in bicarbonate transfer buffer (10 mM NaHCO3, 3 mM Na2CO3) for a 15-minute incubation. The PVDF membrane was activated by immersion in 100% methanol for 2 seconds and then washed with water for 5 minutes, followed by a 5-minute incubation in bicarbonate transfer buffer. The transfer was carried out at a constant current of 300 mA for 1 hour in the cold room. Following the transfer, the membrane was rinsed with PBS and then fixed with 8% acetic acid for 5 minutes. The membrane was subsequently washed with water three times, each for 5 minutes. To remove the Coomassie blue, the membrane underwent shaking with methanol three times, each for 5 minutes. This was followed by a water wash, also three times for 5 minutes each. The membrane was incubated with 5% milk in PBS-Tween 20 (PBST) for blocking for 1 hour. The membrane was washed with PBST three times, each for 5 minutes, and then incubated with primary antibodies for the electron transport chain Complexes I, II, III, IV, and Ox-Phos overnight at 4°C. The next day, the membrane was washed with PBS three times, each for 5 minutes, followed by a 1-hour incubation with the secondary antibody and then washed three times with PBST for 5 minutes each. Chemiluminescent detection was performed on the membranes by LI-COR XF system.
Lipidomic profiling analysis
The intracellular lipidomic profiling was performed as described60. Newly isolated human B-cells were mock infected or infected with EBV at a MOI of 1 for 5 days. B-Cells were counted and pelleted at 1,200 rpm for 5 minutes at 4°C with an equal number of cells in each sample. Lipidomic profiling was performed as described previously60, 61. They were then resuspended in 200 µL of HPLC-grade water (270733, Sigma-Aldrich) and mixed vigorously with 2.5 mL of HPLC-grade methanol (A456, Fisher Scientific) in glass tubes. Following this, 5 mL of methyl tert-butyl ether (MTBE, 1634-04-4, Supelco) was added, and the samples were agitated for 1 hour at room temperature. To separate phases, 1.5 mL of water was added, and after vigorous vortexing, the samples were centrifuged at 1000 x g for 10 minutes at room temperature. The upper phase was then dried a speed vacuum concentrator (Savant SPD 1010, Thermofisher Scientific) for 4h at RT and stored at − 80°C.
For analysis, samples were reconstituted in 35 µL of a 1:1 mixture of LCMS-grade isopropanol and methanol, and subjected to liquid chromatography-mass spectrometry (LC-MS) as previously outlined, employing a high-resolution hybrid QExactive HF Orbitrap mass spectrometer (Thermo Fisher Scientific) set to data-dependent acquisition mode (Top 8) with the capability of switching between positive and negative ion polarities. Lipid species identification and quantification were performed using the LipidSearch 4.1.30 software (Thermo Fisher Scientific), leveraging an internal database comprising ≥ 20 major lipid classes and ≥ 80 subclasses. For verifying signal linearity, a pooled sample was created by combining 5 µL from each sample, which was then diluted with a 1:1 mixture of isopropanol and methanol to generate dilutions of 0.3x and 0.1x, alongside a blank. These dilutions underwent analysis, and for each lipid species within this series, the Pearson correlation coefficient between ion count and sample concentration was computed. Only lipids exhibiting a correlation coefficient (r) greater than 0.9 were retained for final analysis. The abundance of individual lipid species was normalized against the total ion count of the sample. Using R, lipids were categorized by class, and the total ion intensity for each lipid class in each sample was calculated.
Intracellular metabolite profiling
The intracellular metabolites profiling was performed as described62. Newly infected B-cells collected at 4DPI were washed 3 times with PBS and counted. 6 million cells were seeded into a T25 flask with 20 mL RPMI-1640 with 10% dialyzed FBS. Cells were incubated with DMSO, 2uM AD, or 100nM ofPiericidin A (MedChemExpress, 2738-64-9) for 24h. The cells were counted and washed 3 times with pre-chilled PBS. The cell pellet was fully resuspended with 100uL PBS by vortex, the metabolism was quenched by adding 3.3 mL of dry ice-cold 80% aqueous methanol (A456, Fisher Scientific), and kept at -80°C overnight. The lysate was centrifuged at 21,000 g for 15 min at 4°C. The supernatants were obtained and dried by a speed vacuum concentrator (Savant SPD 1010, Thermofisher Scientific) for 4h at RT. Samples were re-suspended using 20 uL HPLC grade water for mass spectrometry. 5–7 µL were injected and analyzed using a hybrid 6500 QTRAP triple quadrupole mass spectrometer (AB/SCIEX) coupled to a Prominence UFLC HPLC system (Shimadzu) via selected reaction monitoring (SRM) of a total of 300 endogenous water soluble metabolites for steady-state analyses of samples and 150 endogenous metabolites for 13C/15N isotopomer flux tracing. Some metabolites were targeted in both positive and negative ion mode for a total of 311 SRM transitions using positive/negative ion polarity switching. ESI voltage was + 4950V in positive ion mode and − 4500V in negative ion mode. The dwell time was 3 ms per SRM transition and the total cycle time was 1.55 seconds. Approximately 9–12 data points were acquired per detected metabolite. Samples were delivered to the mass spectrometer via hydrophilic interaction chromatography (HILIC) using a 4.6 mm i.d x 10 cm Amide XBridge column (Waters) at 400 µL/min. Gradients were run starting from 85% buffer B (HPLC grade acetonitrile) to 42% B from 0–5 minutes; 42% B to 0% B from 5-16minutes; 0% B was held from 16–24 minutes; 0% B to 85% B from 24–25 minutes; 85% B was held for 7 minutes to re-equilibrate the column. Buffer A was comprised of 20 mM ammonium hydroxide/20 mM ammonium acetate (pH = 9.0) in 95:5 water:acetonitrile. Peak areas from the total ion current for each metabolite SRM transition were integrated using MultiQuant v3.0.2 software (AB/SCIEX). Metabolites with p-values < 0.05, log2(fold change) > 1 or <-1 were used for pathway analysis using MetaboAnalyst 5.0 (https://www.metaboanalyst.ca/MetaboAnalyst/ModuleView.xhtml).
U-13C-Glutamine tracing
EBV infected primary B-cells were collected at 4DPI, treated with DMSO or 2µM AD for 16h, then U-13C glutamine was applied to the cells. Ten million cells were cultured in glutamine-free media containing 10% dialyzed FBS- and 2 mM 13C5- L-Glutamine (184161-19-1, Cambridge Isotope Laboratories) for 8 h. Cell samples were collected and processed as mentioned in intracellular metabolite profiling. Metabolic flux analysis was performed as described63.
Seahorse mitochondrial stress test
The Agilent Seahorse XF Assay was conducted as described preiously12. Specifically, the sensor cartridge was first hydrated with water overnight and incubated with XF Calibrant for 1h. Add 12 µL Cell-Tak solution (1.3 mL of 0.1M sodium bicarbonate, 11.2 µL of 0.1M NaOH, 22.4 µL of Cell-Tak solution) to each well of the V7-PS 96-well cell culture plate. The Cell-Tak solution was washed with sterile water twice and 0.25 million primary B cells (resuspension in 180 µL of RPMI-1640 with 10% FBS and 5 mM pyruvate) were seed on a Seahorse plate. Then the cells were placed in a non-CO2 37°C for 30 minutes. The Oxygen consumption rates (OCR) were simultaneously recorded by a Seahorse XFe96 Analyzer (Agilent). The cells were sequentially probed by 20 µL of 3.5 µM oligomycin, 20 µL of 2 µM CCCP, and 20 µL of 100 nM piericidin A. For Seahorse in GM12878 cells, cells were seeded as 0.1 million/well in a 96-well cell culture plate. Data were analyzed by Seahorse Wave Desktop Software (Agilent).
Flow cytometry analysis
The mitochondrial mass was determined by the MitoTracker Green FM (M7514, Thermo Fisher Scientific) and the mitochondrial membrane potential was determined by the fluorescence intensity of TMRM (Tetramethyl-rhodamine methyl ester perchlorate, T668, ThermoFisher Scientific) following the manual. 1×106 of Cells were collected and resuspended in 500 µL cell culture media with 1.5 µL 100 µM of MitoTracker Green or TMRM. Cells were then incubated in 37°C incubator for 30 min. Then cells were washed once with 1×PBS and resuspended in PBS buffer with 2% FBS for FACS. For cell viability analysis, cells were washed and resuspended with PBS buffer with 2% FBS. Then cells were incubated with 1 µM of 17‑Aminoactinomycin D (7AAD, A1310, Invitrogen) for 5 min before analyzing. For CFSE (C345544, Invitrogen) cell proliferation staining, 10 millions of primary B cells were resuspended in PBS with 0.1% BSA, then the cells were mixed with the same volume of 1µM CFSE for 10 min at 37°C. Cells were then neutralized by prechilled 10% FBS RMPI-1640 for 5 min. After washing the cell with culture media, cells were resuspended and infected with virus. 1h after infection, cells were treated with 100 µM Aminooxyacetic acid (AOA), CFSE were analyzed at 5DPI. For cell cycle analysis, cells were fixed with ice-cold 70% ethanol for at least 24h. At the day for analysis, cells were centrifuged at 3000 rpm for 10 min to remove ethanol, and resuspended in PBS buffer. Cells were incubated in 1 mL of staining buffer (propidium iodide, 5 µg/ml; RNase A, 40 µg/ml; 0.1% Triton X-100 in PBS) at room temperature for 30 min in dark. For MitoSOX analysis, 1 million cells were collected and washed with HBSS (Hank's Balanced Salt Solution, Gibco) buffer, then incubated with 1uM MitoSOX™ Green (M36006, Thermo Fisher Scientific) for 30 min. cells gently washed with warm HBSS buffer. Flow cytometry was performed on a BD FACS Calibur instrument. Data were analyzed with FlowJo V10.
Quantitative real-time PCR (qRT PCR)
Extraction of total RNA from cells was conducted by the RNeasy Mini Kit (Qiagen). RNase-Free DNase Set (Qiagen) were used to remove genomic DNA and SYBR Green RNA-to-CT 1-Step Kit (Applied Biosystems) were applied to assemble the qRT PCR reaction. Primer sequences are listed in the Supplementary Table. Samples were run in technical triplicates. The relative expression was calculated using the 2−ΔΔCt method, and the data was normalized to internal control β-actin mRNA levels.
DNA extraction and qPCR
The total DNA from the intracellular was extracted by the Blood & Cell culture DNA mini kit (Qiagen #13362). Extracted DNA was diluted to 10 ng/µL and quantified by qPCR for the EBV BALF5 in the Supplementary Table. For quantification of intracellular EBV genome copy number, standard curves of BALF5 were set as serial dilution of a pHAGE-BALF5 miniprep DNA at 25 ng/µL. Viral DNA copy number was calculated according to the inputting sample Ct and the standard curve as described previously64. For quantification of mitochondrial DNA, the total DNA samples were used for qPCR analysis of MT-ND1. The relative expression was calculated using the 2-ΔΔCt method, and the data was normalized to β-actin. The fold change was calculated by normalizing data points to uninfected control (0DPI) DNA levels.
Western blot analysis
Immunoblot analysis was performed according to the previous instructions14. Cell lysates were prepared by incubating cells in 1× Laemmli buffer at 95°C for 5 min. For the target protein anchoring to the membrane like SLC1A3, and the electron transport chain, Cell lysates were incubated at 37°C for 1h. Lysate Samples were separated by SDS-PAGE electrophoresis, transferred onto the nitrocellulose membranes, blocked with 5% milk in TBST buffer for 1 h, and then probed with relevant primary antibodies at 4°C overnight. The next day, the membranes were incubated with secondary antibody for 1 h. Blots were then developed by incubation with ECL chemiluminescence (Millipore) and images were captured by Licor Fx system. Bands intensities were measured where indicated by Image Studio Lite Version 5.2. All antibodies used in this study were listed in Supplementary Table S1.
Cell viability analysis
Absolute live cell counts were determined using the Countess 3 automatic counter with Trypan Blue (15250061, ThermoFisher Scientific) staining. For growth curve analysis, cells were seeded at a density of 2×10^5/mL in 12-well tissue culture plates. For growth curve analysis of CRISPR/Cas9 knock-out cells, cells were seeded at day 5 post-puromycin selection. The KO effects were confirmed by immunoblotting. The absolute live cell numbers were adjusted based on the culture splitting factors.
Statistical analysis
Unless otherwise indicated, all bar graphs and line graphs represent the arithmetic mean of three independent experiments (n = 3), with error bars denoting standard deviations. Data were analyzed using two-tailed paired Student t test or analysis of variance (ANOVA) with the appropriate post-test using GraphPad Prism7 software. Metabolic pathway analysis was performed using MetaboAnalyst 3.0.
Graphics
Figures were drawn with GraphPad, Biorender, Microsoft Powerpoint, and ggplot2 in R.