Cell lines and culture
The T-cell acute lymphoblastic leukemia (T-ALL) Jurkat cell line (Jurkat E6.1 subline, authenticated by short tandem repeat genotyping in April 2022) was provided by Nuno L. Alves (i3S, Porto, Portugal). The Burkitt lymphoma Raji cell line was previously described [27]. The A20 mouse B lymphoma cell line (TIB-208) was acquired from American Tissue Culture Collection (ATCC, Manassas, VA, USA). Suspension cell lines were cultured in RPMI complete medium (RPMI 1640 medium (Gibco, Carlsbad, CA, USA) supplemented with 10% heat-inactivated fetal bovine serum (FBS; Gibco), 100 U/ml penicillin-streptomycin (Gibco) and 1 mM L-Glutamine (Gibco), maintaining a density between 1 × 105 and 1 × 106 cells/ml, in a 5% CO2 humidified incubator at 37 ºC. The HEK293T cell line was cultured in DMEM medium (Cytiva, Marlborough, MA, USA) supplemented as described above. Absence of Mycoplasma was confirmed by 16S rRNA amplification with MGSO and GPO-1 primers [28]. For cell growth assays, cells were plated at 1 × 105 and counted in a Neubauer hemocytometer after 24 and 48 h.
Generation of a PSGL-1-deficient Jurkat cell line
Three target guide RNA (gRNA) sequences (#1, AATTACGCACGGGGTACAT; #2, GACAACTCGACTGACGGCCA; #3, TGGGGGAGTAATTACGCACGG) targeting the second exon of the SELPLG gene were designed in CRISPOR and Synthego software platforms [29,30] and selected for their high specificity, low off-targets, high activity and early coding region. The gRNAs were cloned into the lentiCRISPR v2 plasmid, a gift from Feng Zhang (Addgene, Watertown, MA, USA; plasmid #52961; http://n2t.net/addgene:52961; RRID: Addgene_52961), after digestion with Esp3I restriction enzyme (cat. no. ER0451, Thermo Scientific, Waltham, MA). To produce lentiviral particles, each gRNA-bearing lentiCRISPR plasmid or empty plasmid together with pRRE, pRev, and pMD2.G (VSV-G envelope-expressing plasmid) packaging plasmids, all a gift from Didier Trono (Addgene plasmids #12251, #12253, #12259), and pCEP4-tat, gifted by Sergey Kasparov (Addgene plasmid # 22502), were transfected into HEK293T cells with Lipofectamine 2000 reagent (Invitrogen, Carlsbad, CA, USA). After 72 h, supernatants from lentivirus-producing cells were collected, filtered through 0.22 µm filters (Cytiva) and added immediately to 1 × 106 Jurkat cells growing in complete RPMI medium without antibiotics. Two days later, the medium was changed and the transduced cells were selected by addition of 0.5 µg/ml puromycin. The puromycin concentration was increased to 1 µg/ml after two more days. The gRNA #2 showed increased efficacy in knocking-out SELPLG, as most Jurkat/SELPLG KO #2 cells showed absence of PSGL-1 expression by flow cytometry. Puromycin-resistant Jurkat cells, infected with empty lentiCRISPR lentiviral particles (Jurkat/Mock), were obtained as controls. The Jurkat/SELPLG KO #2 PSGL-1 negative cells were isolated by flow cytometry sorting in a BD FACSAria II. After the Jurkat/SELPLG KO cell line establishment, clones were isolated from the bulk population through serial dilution.
Primary human T cell isolation
Peripheral blood mononuclear cells (PBMCs) were obtained from buffy coats of adult healthy blood donors (aged 18–42 years; Supplementary Table 1) provided by the local hospital blood bank (Serviço de Imunohemoterapia, Centro Hospitalar Universitário São João, Porto) after ethical approval (ref. no. 398/2020). PBMCs were isolated by density-gradient separation using Ficoll Paque Plus (Cytiva). The cell pellet was cleared of remaining erythrocytes by incubation in red blood cell lysis buffer (90% 160 mM NH4Cl, 10% 170 mM Tris-HCl) 5 min at 37 ºC, and then washed in phosphate-buffered saline (PBS). Untouched T cells were isolated by depleting CD3-negative cells using the MojoSort Human CD3 T Cell Isolation Kit (cat. no. 480021, Biolegend, San Diego, CA, USA) and EasySep Magnet (cat. no. #18000, StemCell Technologies, Vancouver, BC, Canada), according to the manufacturer’s instructions.
In vitro human T cell activation
Healthy donor T cells were stimulated with plate-bound anti-human CD3 (clone OKT3, cat. no. 317326, Biolegend) and soluble anti-human CD28 (clone CD28.2, cat. no. 302934, Biolegend), at concentrations of 0.5 and 2 µg/ml or 2 and 5 µg/ml of each antibody. Jurkat cells were stimulated with 0.1, 0.5 or 5 µg/ml of plate-bound anti-human CD3. Incubations were performed in RPMI complete medium for the duration indicated in the Results section.
Allogeneic T-cell activation assays
Pre-activated, primed, or in vitro exhausted healthy donor T cells were cocultured at a 2:1 ratio with irradiated Raji cells (150 Gy, Gammacell irradiator) in RPMI complete medium, in 96-well round bottom microplates (cat. no. 353077, Falcon) for 3, 5, or 7 days. Ten µg/ml of mouse IgG (cat. no. 015-000-003, Jackson ImmunoResearch, West Grove, PA) or anti-human PSGL-1 PL1 hybridoma (concentration of approximately 5–10 µg/ml) were added at the beginning of coculture. The PL1 hybridoma, developed by McEver, R.P., was obtained from the Developmental Studies Hybridoma Bank, created by the NICHD of NIH and maintained at the University of Iowa, Department of Biology, Iowa City, IA 52242, USA. For T-cell pre-activation, isolated healthy donor T cells were stimulated with plate-bound 0.5 µg/ml anti-CD3 (clone OKT3) and soluble 2 µg/ml anti-CD28 (clone CD28.2) for approximately 18–24 h in RPMI complete medium. For T-cell priming, isolated healthy donor T cells were cocultured for 7 days with irradiated Raji lymphoma cells at a 2:1 ratio in RPMI complete medium. For T-cell in vitro exhaustion, isolated healthy donor T cells were stimulated every 3 days for 9 days with plate-bound 1 µg/ml anti-CD3 and soluble 5 µg/ml anti-CD28, following reported methodology [31]. Regarding Jurkat cocultures, Raji cells were loaded with 2 µg/ml of the bacterial superantigen staphylococcal enterotoxin B (SEB) (cat. no. S4881, Sigma-Aldrich, St. Louis, MO, USA) for 1 h at 37 ºC. Afterwards, 6 × 105 SEB-loaded Raji cells were cocultured with 2 × 105 Jurkat/Mock cells (3:1) in 24-well plates (cat. no. 4430300, Orange Scientific, Braine-l’Alleud, Belgium) for 24 h at 37 ºC.
Primary human lymphoma samples
Lymph node biopsies collected between 2019 and 2023 from six B-cell lymphoma patients (Supplementary Table 2) were obtained at the Onco-Hematology Department of IPO-Porto after informed consent and ethical approval (ref. GOM_PI_2013.03). Research was conducted according to the principles of the Declaration of Helsinki. Lymph node biopsies were processed by cutting in small pieces with a scalpel in RPMI 1640 medium, and dissociated by gentle pressure against a 0.75 µm cell strainer. For autologous coculture experiments, lymph node suspensions were cultured in RPMI complete medium, with or without PL1 antibody (concentration of approximately 5–10 µg/ml) or mouse IgG (10 µg/ml, Jackson ImmunoResearch) for 3 days.
In vivo studies
BALB/c mice were bred and maintained at the i3S barrier animal facility under 12 h light:dark cycles with food and water ad libitum. All experimental procedures were approved by the i3S ethics committee (approval no. 15/CECRI/2020) and Portuguese authorities (Direção-Geral de Agricultura e Veterinária) and followed recommendations from the European Commission (Directive 2010/63/UE) and the local Portuguese authorities (decree laws no. 113/2013 and 1/2019). Five × 106 A20 cells were injected s.c. into 9-11-week-old BALB/c male mice. Mice were randomized into 2 groups, and treated i.p. in the late afternoon with three doses of 200 µg of either PSGL-1 monoclonal antibody (mAb; clone 4RA10, cat. no. BE0186, BioXcell, Lebanon, NH, USA) or control IgG (ChromPure rat IgG, cat. no. 012-000-003, Jackson ImmunoResearch) at 7, 10 and 13 days post-cell injection (dpi). Tumors were measured with calipers at 6, 8, 10, 13, 15, 17 and 20 dpi, and their volume (V) was calculated using the formula: V (mm3) = (L × W2)/2, being L the larger and W the smaller of two perpendicular tumor axes. Mice were euthanized by CO2 inhalation at 20 dpi. At experimental endpoint, spleens and tumors from mice were mechanically digested through a 70 µm cell strainer (cat. no. 352350, Corning, Glendale, AZ, USA) and cells were counted using Neubauer hemocytometer.
Flow cytometry
Cells were washed with FACS buffer (3% FBS and 10 mM NaN3 in PBS), centrifuged at 300 g, and resuspended in FACS buffer containing fluorochrome-conjugated antibodies (listed in Supplementary Table 3). After incubation on ice for 45–60 min, cells were washed twice with FACS buffer and resuspended in 10 mM NaN3 in PBS. For intracellular immunostaining, cells were first washed and stained for surface markers, as described above. Next, cells were fixed in paraformaldehyde with Fixation Buffer (cat. no. 420801, Biolegend) and permeabilized with True-Phos Perm Buffer (cat. no. 425401, Biolegend), following the manufacturer’s instructions. Next, cells were incubated on ice with fluorochrome-conjugated antibodies in FACS buffer for 30–45 min, and washed in FACS buffer, as described above. For in vitro T cell proliferation assays, T cells were first stained with 2 µM eFluor Dye 670 (cat. no. 65-0840-85, eBioscience, San Diego, CA, USA), according to the manufacturer’s instructions, and then cultured in RPMI complete medium. Cell fluorescence levels were acquired in BD Accuri C6 or BD FACSCanto II cell analyzers, and data analyzed through FlowJo software.
ELISA assays
Coculture supernatants were collected and stored at -80 ºC. Concentrations of IFN-γ and IL-2 were assessed by the ELISA MAX Deluxe Set Human IL-2 (cat. no. 431804, Biolegend) and IFN-γ (cat. no. 430104, Biolegend) kits, following the manufacturer’s instructions. Briefly, Nunc MaxiSorp ELISA uncoated plates (cat. no. 423501, Biolegend) were incubated at 4 ºC overnight with capture antibody and sealed with Plate Sealers (cat. no. 423601, Biolegend). Plate wells were washed with ELISA Wash Buffer (cat. no. 421601, Biolegend) and diluted supernatants and standards were added to the wells and incubated at room temperature. Plate wells were washed with ELISA Wash Buffer, the detection antibody was added, and plates were incubated at room temperature. After washing, avidin-horseradish peroxidase (HRP) reagent was added and incubated at room temperature. Plates were washed, 3,3',5,5'-tetramethylbenzidine (TMB) substrate was added, and plates were incubated in the dark at room temperature for 20 min. The TMB reaction was terminated with Stop Solution (cat. no. 423001, Biolegend). Absorbances at 450 nm and 570 nm were measured in a Biotek (Winooski, VT, USA) PowerWave XS Microplate Reader.
Immunoblotting
Whole cell lysates were prepared from 4 × 106 Jurkat cells after two rounds of ice-cold PBS washing and resuspension in ice-cold RIPA buffer (10 mM Tris pH 7.4, 150 mM NaCl, 1 mM EDTA, 1% Triton X-100, 0.5% sodium deoxycholate, 0.1% sodium docetyl sulfate (SDS)) with freshly added protease inhibitors (10 µg/ml aprotinin, 10 µg/ml leupeptin and 1 mM phenylmethylsulfonyl fluoride) and phosphatase inhibitors (10 mM p-nitrophenyl phosphate, 15 mM β-glycolphosphatase and 1 mM Na3VO4) for 10 min. After 15 000 g centrifugation, the supernatants were denatured in SDS sample buffer (62.5 mM Tris pH 6.8, 20% glycerol, 2% SDS and 5% β-mercaptoethanol) by heating the samples for 5 min at 95 ºC. Samples were subjected to 10% SDS-polyacrylamide gel electrophoresis, together with PageRuler Plus prestained protein ladder (Thermo Fisher Scientific) and transferred to an immunoblot nitrocellulose membrane (Cytiva). Protein transfer efficiency was assessed by Ponceau staining (cat. no. P7170, Sigma-Aldrich). Membranes were blocked with 5% nonfat dried milk in PBS with 0.1% Tween 20 and then incubated with antibodies against human PSGL-1 (1:1000 dilution; KPL1, cat. no. 328802, Biolegend). Diluted 1:5000 HRP-conjugated goat anti-mouse IgG (cat no. A00160; GenScript, Piscataway, NJ, USA) was used as secondary antibody. Bound secondary antibodies were revealed by incubating the membrane with SuperSignal West Femto Maximum Sensitivity Substrate (Thermo Fisher Scientific) and luminescence captured by Amersham Hyperfilm (Cytiva) or ChemiDoc XRS+ (Bio-Rad, Hercules, CA, USA).
Statistics
Data plots and statistical analyses were performed with GraphPad Prism software. Statistical tests and sample numbers are indicated in figure legends. A P value below 0.05 was considered statistically significant.