2.1 Ethics statement
Every procedure was carried out in compliance with the applicable rules and regulations.
2.1 Cell culture
HUVECs were cultivated at 37°C in a humidified environment with 5% CO2 in DMEM supplemented with 10% FBS and 1% penicillin/streptomycin. Every one to two days, the culture media was changed, and cells that were 85–90% confluent were passaged at a confluence ratio of 1:3. In every experiment, the cells were employed between passages two and five.
2.2 Cell transfection
The GenePharma Company (Suzhou, China) developed a lentivirus vector plasmid system containing the sh-TUG1 gene(sh-TUG1:CCATCTCACAAGGCTTCAA), which was labeled with a green fluorescent protein (GFP). HUVECs were transfected with the lentivirus vectors using standard procedures, with an MOI=10 considered the most suitable. The expression and detection of GFP were performed on 1, 2, and 3 days after the transfection with the lentiviral vector.
In order to obstruct miR-542-3p, Genepharma Company (Suzhou, China) supplied siRNA against miR-542-3p (named as si-miR-542-3p: UUUCAGUUAUCAAUCUGUCACA).The oe-TUG1 group represents a TUG1 overexpression group, while the oe-NC group was transfected with an empty plasmid. As directed by the manufacturer, cell transfection was carried out using Lipofectamine 2000 (Invitrogen, Carlsbad, USA).
2.3 Animal models
Thirty-six male C57/C mice, weighing between 18 and 22 grammes and aged between 6 and 8 weeks, were acquired from Xuzhou Medical University's Laboratory Animal Centre in Jiangsu, China. After a week of acclimatization, the mice were split into four groups at random, each consisting of 16 mice: the sham group, the UUO group, the sh-TUG1 transfected group(sh-TUG1 group), and the equivalent negative controls (sh-NC group) that received an identical dosage of transfection.The sh-TUG1 lentivirus or empty virus injections (5 nmol/g/day) were administered via the tail vein for three consecutive days before the surgery in sh-TUG1 group and sh-NC group. To build the UUO model, a left abdominal incision was done and the mice were given a chloral hydrate anesthesia. After ligating the left ureter with a 4-0 silk suture, the incision was layer-closed. The left ureter was not clamped during the comparable left abdominal incision performed on the sham group.
On the seventh day following surgery, mice from all four groups were slaughtered. The left kidneys of the mice were then extracted and rinsed with saline solution. While the remaining kidney was held at -80 °C for PCR and Western blot analysis later on, a portion was kept in 10% formaldehyde for morphological and immunofluorescence labeling.
2.4 Tube formation assay
Tube formation was carried out according to the method previously explained[18]. To summarize, a 96-well plate containing 50 μl of growth factor-reduced Matrigel TM (BD, USA) was seeded with endothelial cells (1 × 104) and incubated for 24 hours at 37 °C to enable tube stability. A computer-assisted microscope (OLYMPUS, JAPAN) was used to count the total number of tube loops in five different microscopic fields at random.
2.5 Hematoxylin and Eosin Staining
The kidney tissues of mice were fixed in 4% paraformaldehyde (Sigma) and subsequently embedded in paraffin. After dewaxing in xylene and rehydrating with a decreasing series of alcohol, 5-μm-thick slices were taken from the paraffin-embedded tissues. Following that, the tissue sections were stained for five minutes with hematoxylin and three minutes with eosin solution. The sections were stained, dehydrated with graded ethanol, and then cleaned in xylene. Ultimately, the tissue sections were examined under an Olympus microscope in order to do additional investigation.
2.6 Masson Staining
Standard deparaffinization was performed on the kidney tissue slices, and Masson's Trichrome Stain Kit was used, adhering to the manufacturer's recommendations for staining. After that, the stained slices were examined at a 200x magnification using an optical microscope (Olympus). Blue dye was applied to the regions that showed collagen fibers. The National Institutes of Health (NIH) ImageJ program was used to examine the pictures. The total area of fibrotic lesions was computed for randomly chosen fields of view and reported as a percentage of the full picture.
2.7 FMA
FMA was conducted as stated earlier [34]. The mice were sedated with chloral hydrate (10.0%, 0.003 ml/g intraperitoneally), and then placed on a surgical heating pad that was set to 37 °C. From the symphysis pubis to the jugulum, the abdomen was sliced in the middle. Using the method described by Rafael Kramann et al., all solutions were heated to 41 °C. A venous needle was used to inject one milliliter each of 3 M KCl and heparinized saline into the pounding left ventricle. The mouse was then given a right atrial cut, into which 10 ml of 41 °C prewarmed PBS and 5 ml of the agarose-microbead combination (500 ml 0.02 mm FluoSpheres + 4.5 ml 1% agarose/mouse) were perfused.The kidneys were gently removed and put in a small beaker covered by ice for 10 minutes. Afterward, the kidneys were fixed in 4% paraformaldehyde on ice for 2 hours, followed by overnight incubation in 30% sucrose in PBS at 4 °C. Following cryosectioning into 10 μm slices, the implanted kidneys were placed on Superfrost slides. The sections were treated with 49,6-diamidino-2-phenylindole, stained, and then mounted in ProLong Gold (Life Technologies) after being rinsed in PBS for a predetermined period of time. To prepare sections for immunofluorescence staining, PBS washed them for five minutes, and then they were incubated for one hour at room temperature with 5% donkey serum in PBS containing 0.3% Triton-X-100. Next, they were incubated for eight hours at 4 °C with anti-VE-cadherin antibody (1:200, ab33168, abcam), anti-alpha smooth muscle actin mouse antibody (1:200, ab7817,abcam), and rabbit anti-CD31 rabbit antibody (1:200, ab28364,abcam). The Goat anti-Rabbit IgG (H + L) Highly Cross-Adsorbed Secondary Antibody, Alexa Fluor 594 (1:200, #A-11037, ThermoFisher), and Donkey anti-Mouse IgG (H + L) Highly Cross-Adsorbed Secondary Antibody, Alexa Fluor 488 (1:2000, #A-21202, ThermoFisher) were employed on the sections in the experiment. After that, the sections were incubated for two hours at room temperature. The tissue slices were then mounted using Invitrogen's ProLong Gold Antifade reagent (18255385). Our tool of choice for viewing the images was a confocal laser microscope (FV1000; Olympus, Tokyo, Japan).In addition, VE-cadherin antibody (1:200, ab33168, abcam) was used for an 18-hour incubation period at 4 °C. We then incubated the sections at room temperature for two hours using the Goat anti-Rabbit IgG (H + L) Highly Cross-Adsorbed Secondary Antibody, Alexa Fluor 594 (1:200, #A-11037, ThermoFisher), and the Donkey anti-Mouse IgG (H + L) Highly Cross-Adsorbed Secondary Antibody, Alexa Fluor 488 (1:2000, #A-21202, ThermoFisher). ProLong Gold Antifade reagent (18255385, Invitrogen) was once more used to mount the tissue slices.Lastly, each image was seen using a confocal laser microscope (Leica, Germany).
2.8 Quantitative RT-PCR
The RNeasy kit (Takara,Japan) was utilized to extract RNA from entire tissue samples, followed by a ABIPRISM 7300 Sequence Detection System quantitative RT-PCR analysis. The reaction was composed of complemental DNA template, iTaq SYBR Green Supermix (with ROX, Takara, Japan), and gene-tailored primers ( Table 1). Conditions for the PCR were two minutes at 50 °C, ten minutes at 95 °C, and forty cycles of 30 seconds at 95 °C, 45 seconds at 60 °C, and 30 seconds at 72 °C. As an internal control, GADPH was employed for benchmarking. Following PCR, cycle threshold values were established for GADPH and the other particular genes. The normalized fold expression for each gene was computed using the 2-ΔΔCT technique and published.
2.9 Western blotting
The kidney tissue was lysed in a 100:1 mixture of RIPA and PMSF and allowed to stand on ice for half an hour. After that, the resultant solution was spun for 15 minutes at 12,000 rpm while being maintained at 4 °C. Roughly 150 μg of total protein was loaded onto 10% or 12% SDS polyacrylamide gels and then electroblotted onto a PVDF membrane after the proteins were heated in boiling water for five minutes. After treating the membrane with 3% BSA for an hour at room temperature, it was incubated with primary antibodies targeting TGF-β1, α-SMA, VEGF, HIF1-α, and VE-cadherin for an overnight period at 4 °C. Each primary antibody was diluted at a ratio of 1:1000 or 1:200 to prevent non-specific binding. After that, another round of incubation was conducted using ECL secondary antibodies. Ultimately, the ImageQuant LAS 4000 mini was used to identify the signal, and beta actin was used to quantify it.
2.10 FISH
To find out where TUG1 is in the cell, we performed a technique called fluorescence in situ hybridization (FISH). We used special probes labeled with fluorescein, made by GenePharma in Suzhou, China, to target TUG1. First, we fixed HUVECs with a solution of 4% paraformaldehyde, then we exposed them to a solution that helped make them more permeable. After blocking any unwanted interactions, we added the TUG1 probes and let them bind with the RNA overnight in the absence of light. To visualize the results, we stained the cell nuclei with DAPI and used a confocal laser microscope to scan for fluorescence signals.