Patients
From January 2018 to June 2019, 66 children were diagnosed with MPP and examined by bronchoscopy in the affiliated Children’s Hospital of Suzhou University. These children were included in the MPP case group (mean ± SD age, 5.58±2.67 years; 32 boys, 34 girls). A total of 20 children who underwent bronchoscopy because of bronchial foreign bodies in the same period were included in the control group (mean ± SD age, 5.23±2.24 years; 12 boys, 8 girls).
MPP was diagnosed according to the following: (1) the diagnostic criteria of community-acquired pneumonia in children were met[5]; (2) the indications for bronchoscopy were met[6]; and (3) MP DNA >1.0×103 copies was detected in BALF.
Children were included in the control group if they met the following criteria: (1) there was a clear history of foreign body inhalation and irritant cough, and the course of disease was shorter than 7 days; (2) an imaging examination showed a clear shadow of foreign bodies, but did not indicate inflammatory changes; and (3) there was no history of pulmonary infection within 2 months.
The exclusion criteria for the study were as follows. Other viral and bacterial infections were excluded. Additionally, patients with an incomplete history and data of bronchopulmonary dysplasia, pulmonary mass, genetic and metabolic diseases, hematological diseases, and immunodeficiency were excluded.
The study was approved by the hospital ethics committee and informed consent was obtained from the parents of the children.
Collection of BALF in children with pneumonia
All children fasted before the operation and did not drink any water. The children were placed in the supine position and underwent bronchoscopy and bronchoalveolar lavage after local anesthesia. According to the results of an imaging examination, the healthy side was examined first to determine whether there were inflammation and abnormalities. The lesion site was then examined and lavage was performed with normal saline at 37°C (each injection was 5–10 ml of lavage, and the total amount was ≤5–10 ml/kg). The lavage fluid was then sucked out through negative pressure, and the reabsorption rate of each lavage fluid was ≥40%. The obtained BALF was stored in a sterilized collector for later inspection.
Real-time PCR for detection of MP
A real-time polymerase chain reaction (PCR) procedure (Daan Gene Co. Ltd., Guangzhou, China), which was approved by the State Food and Drug Administration of China, was used to detect MP in real time[7]. Briefly, the sample of BALF was shaken, centrifuged, and then removed liquid supernatant. The sediment was collected, blended with 50 μL of DNA extraction solution, incubated at 100 °C for 10 min, and centrifuged at 12,000 rpm for 5 min. PCR amplification was performed using primers and probes (Daan Gene Co. Ltd.) in a 7600 real-time PCR system (Applied Biosystems, Foster City, CA, USA). The PCR conditions were as follows: 93°C for 2 min; 10 cycles of 93°C for 45 s, and 55°C for 60 s; and 30 cycles of 93°C for 30 s and 55°C for 45 s. Quantitative curves were drawn with standard control samples at several concentrations.
Detection of CARDS TX, HMGB1, receptor for advanced glycation end products, TLR2, TLR4, MyD88, TLR6, and CD14 mRNA expression
BALF samples were centrifuged at 15,000×g at 4°C for 5 min, and 0.5 ml of Trizol (Aidlab Biotechnologies Co., Ltd., Beijing, China) was added to the bottom of the tube for precipitation. Total RNA was extracted and reverse transcribed to synthesize cDNA. Using pdhA as the internal reference, mRNA expression of CARDS TX, HMGB1, receptor for advanced glycation end products (RAGE), TLR2, TLR4, MyD88, TLR6, and CD14 was determined using real-time PCR. Gene expression was assessed using the comparative cycle threshold (Ct) method. The relative amount of mRNA was determined by subtracting the Ct values for these genes from the Ct value for the housekeeping gene pdhA (DCt). The amount of mRNA was expressed relative to the amount of pdhA mRNA (2-DDCt) and presented as mean ± SEM. The sequence of primers is shown in Table 1.
Table 1
Forward and reverse primers used for real-time PCR
DNA | F(5’ →3’) | R (5’ →3’) |
pdh A | ACTGGTTCTGCCCTACCTTCCGTTCC | CTTCGTGCATTGCTTCGTAACTCGC |
CARDS TX | TTCCACTTCAGAAACACCCACAGC | TCAATCAGGGCACGCAAACG |
HMGB1 | TGTAAGGCTGTGTAAGATT | AAGGTTAGTGGCTATTGAA |
RAGE | GTGAAGGAACAGACCAGGAGAACA | TGGGCTGAAGCTACAGGAGAA |
TLR2 | TGAGGAACTTGAGATTGAT | CACGGAACTTGTAACATC |
TLR4 | TCAGTGTGCTTGTAGTAT | CCTGGCTTGAGTAGATAA |
MyD88 | AGCCATTCACACATCTTCACCC | GCTATGCTTCACCATTTCCTACA |
TLR6 | TGCAGAGTAACAGGAGCACACA | ACCCTCGGACTCCAGCAAA |
CD14 | CTCAGCTGCAACAGACTGAACA | GGAGTTCATTGAGCCCTCGTG |
Detection of tumor necrosis factor-a and interleukin-1b levels by ELISA
The cytokines tumor necrosis factor (TNF)-a and interleukin (IL)-1b in BALF were detected by the ELISA method. The specific steps were carried out according to the manufacturer’s instructions in a commercial ELISA kit (Neobioscience, Shenzhen, China).
Statistical analysis
Data were analyzed with SPSS version 24.0 for Windows (IBM Corp., Armonk, NY, USA). Measurement data that had a normal distribution and homogeneity of variance are expressed as mean ± SD. The t-test is used for comparison between the two groups. Pearson correlation was used for correlation analysis. Categorical data were analyzed by the chi-square test. A P value <0.05 was considered statistically significant.