Reagents and antibodies. Puromycin, serum, medium, polybrene, RNA assay-related reagents, LY294002, and caspase inhibitors, as well as cell counting kit-8 (CCK-8) reagent and Trypan blue were purchased from Sigma-Aldrich Chemicals (St. Louis, Mo). Fluorescence dyes, including EdU (5-ethynyl-2’-deoxyuridine), TUNEL (terminal deoxynucleotidyl transferase dUTP nick end labeling), and JC-1 were provided by Invitrogen Thermo-Fisher (Shanghai, China). The anti-REG3A antibody (ab202057) and anti-REG1 antibody (ab47099) were obtained from Abcam (Shanghai, China). The anti-ZNF680 antibody was from Sigma. All other antibodies were provided by Dr. Zha [21].
Cells. MDA-231 and MCF-7 breast cancer cell lines and a non-tumorigenic epithelial cell line, MCF-10A, were provided by Dr. Cao [22] and maintained in the described medium [22]. The protocols for the primary culture of human TNBC cells were described in an early study [22]. Fresh cancer tissues and cancer-adjacent normal mammalian epithelial tissues were freshly obtained at the time of surgery, separately, carefully under microscopy, and thoroughly washed using the described medium [22]. Fresh tissues were cut into small pieces and incubated with 0.20% (w/v) collagenase (in DMEM) for 1h. Macrophages, vascular cells, fibroblasts, and debris were carefully removed. Individual breast cancer cells and mammary epithelial cells (“pMEC”) were thereafter pelleted, washed, and cultivated under the described complete medium [22]. The enrolled patients each provided informed-consent. The primary breast cancer cells were derived from two TNBC patients, namely “pBC-1” and “pBC-2”. These primary cancer cells were TNBC cells with PTEN depletion. pMEC were derived from one single patient. The protocols for using primary human cells were approved by the Ethics Committee of Nantong University (TY-B2022-0144) and were according to the Declaration of Helsinki.
Human tissues. The breast cancer tissues and matched adjacent normal tissues were obtained from a cohort of twenty (20) primary TNBC patients. All patients were administrated at the authors’ institution, and each provided written-informed-consent. Tissues were freshly obtained at the time of surgery and subjected to quantitative real-time PCR (qRT-PCR), Western blotting, and immunohistochemistry (IHC) assays. The protocols for testing human tissues were approved by the Ethics Committee of Nantong University (TY-B2022-0144) and were in accordance with the Helsinki Declaration.
Quantitative real-time PCR (qRT-PCR),Western blotting, and co-immunoprecipitation (Co-IP) assays. Total RNA was extracted from cells or tissues and quantified. It was then reversely transcripted to cDNA under a PrimeScript RT reagent kit (Takara Bio, Japan). The detailed protocols for qRT-PCR and data quantification were reported in other studies [23]. GAPDH expression was tested as the internal control and the reference gene. The detailed protocols of Western blotting assays and Co-IP (for mTOR complexes) were reported elsewhere [21, 24]. Figure S1 lists the uncropped blotting images.
shRNA. Breast cancer cells or mammary epithelial cells were cultivated in complete medium with polybrene at 60–65% confluence. A total of six different shRNAs targeting non-overlapping sequences of REG3A (shREG3A-Sq1 to shREG3A-Sq6) were designed and provided by Genechem (Shanghai, China). Each was individually inserted into a lentiviral construct. The construct, together with the lentivirus envelope plasmids, were co-transfected into HEK-293 cells, generating shRNA-expressing lentivirus. Which were added to the cultured cells at MOI = 12. The virus infection lasted for 48h. Afterwards, puromycin-containing complete medium was added to infected cells and stable cells were formed after 4–6 passages’ selection. Three different shRNAs were utilized: shREG3A-Sq2 targeting CTGTAATGTGAGGTTACCCTATGTC, shREG3A-Sq3 targeting TGTTTGGTGTGCAACTCATCATG and shREG3A-Sq6 targeting CCCTGGTGAAGAGCATTGGTAAC. The control cells were infected with lentiviral particles with scramble control shRNA (“shC”). The mRNA and protein expression of REG3A in the stable cells were always tested. shRNA-induced silencing of ZNF680 was done through the same procedures with different sequences, with shZNF680-Sq1 targeting AGGCACTGACACTTTAGACATTACA and shZNF680-Sq2 targeting TTGACAAAGCCTTCCAATGATTGTT.
Gene knockout (KO). Breast cancer cells were cultivated in complete medium with polybrene at 60–65% confluence and were infected with dCas9-expressing lentivirus (from Dr. Ling [25]), and stable cells formed after selection. The lentivirus encoding the CRISPR/Cas9-REG3A-KO puro-construct (containing sgRNA against REG3A, targeting GTAACAGCTACTCATACGTC, PAM TGG), provided by Genechem (Shanghai, China), was added to dCas9-expressing cells and stable cells were formed by puromycin treatment. Cells were then distributed into 96-well plates and subjected to REG3A KO screening. Finally, single stable REG3A KO (“koREG3A”) breast cancer cells were formed. The control cells were infected with lentivirus encoding the CRISPR/Cas9-empty control vector (“koC”, from Dr. Ling [25]). The CRISPR/Cas9-induced knockout of ZNF680 was done through the same procedure, with verified sgRNA targeting ZNF68 (targeting GCCTCACCTGATAACCTGTT, PAM TGG) inserted in the CRISPR/Cas9 construct.
Gene overexpression. Breast cancer cells were cultivated in complete medium with polybrene at 60–65% confluence and were infected with lentivirus encoding the REG3A-expressing construct (Genechem) at MOI = 12. The construct contained the REG3A cDNA [NM_002580.2] sequence. The virus infection lasted for 48h. Afterwards, puromycin-containing complete medium was added to infected cells and two stable cell selections, “oeREG3A-Slc1” and “oeREG3A-Slc2”, were formed after another 4–6 passages. REG3A expression in the stable cells was always tested. ZNF680 overexpression was done through the same procedure, with the ZNF680 cDNA (NM_001130022.2) inserted in the construct.
Cell viability and death assays. In brief, 2, 500 cells per well were seeded onto 96-well plates and further cultivated for 96h. Afterwards, CCK-8 reagent was added to each well and incubated for an additional 2h. CCK-8’s optical density (OD) was measured through a microplate reader at 450 nm. Alternatively, cells were stained with Trypan blue, and “dead” cells with positive Trypan blue staining were automatically measured via a cell counter.
Cell migration/invasion assays. The 8 µm-pore “Transwell” chambers (BD Bioscience, San Jose, CA) were utilized. For cell migration assays, breast cancer cells (10, 000 cells per well) with the designated genetic modifications were re-suspended in 200 µL serum-free medium and added to the upper chamber surface. The lower chambers were filled with complete medium. Cells were allowed to migrate for 24h. Afterwards, migrated cells were fixed and stained. For cell invasion assays, the inserts were pre-coated with Matrigel (Sigma), and other steps were the same.
Caspase-3 activity. In brief, the caspase-3 activities in cell lysates or xenograft tissue lysates (20 µg lysates pre-treatment) were measured via the Caspase-3 Colorimetric Assay kit (BioVision, Milpitas, CA) according to the manufacturer's instructions.
Fluorescence dye assays. The breast cancer cells, or mammary epithelial cells, with the designated genetic modifications, were seeded into twelve-well plates at 65–75% confluence and cultivated for designated hours. The cells were then fixed, permeabilized, washed, and incubated with the designated fluorescence dyes. After washing with PBS, the fluorescence signals were captured via a Zeiss confocal microscope, and their intensity was quantified.
Akt1 mutation. The described breast cancer cells were first placed on six well plates at 50–60% confluence and maintained in polybrene-containing complete medium. Thereafter, cells were transduced with a lentiviral S473D constitutively-active mutant Akt1 construct (caAkt1, from Dr. Xu [26], with no tag) or the empty vector. After selection using puromycin, stable cells were formed, and caAkt1 expression was verified in the stable cells.
siRNA. Genechem (Shanghai, China) provided validated siRNAs targeting different transcription factors (Foxl2, ZNF680, ZSCAN31, Nr1H2, and Foxo1) used at a concentration of 200 nM for individual transfection into breast cancer cells using Lipofectamine 3000. The transfection was repeated once at 24 hours and terminated at 48 hours. Each siRNA achieved a minimum of 70% reduction in targeted mRNA expression. Control cells were transfected with a non-sense control siRNA (siC).
Chromatin immunoprecipitation (ChIP). Tissue lysates or total cellular lysates, following homogenization using a homogenizer, were diluted in ChIP dilution buffer as described previously. These lysates were then subjected to immunoprecipitation using an anti-ZNF680 antibody, and ZNF680-associated DNA was subsequently eluted using protein A/G agarose (Santa Cruz Biotech) containing NaCl. The proposed REG3A promoter sequence from the JASPAR database was quantitatively evaluated via PCR (qPCR).
Xenograft study. The female nude mice, weighing 18.2-18.9g, were purchased from Changzhou Cavens Experimental Animal Center (Changzhou, China). The pBC-1 primary breast cancer cells, with shREG3A-Sq6 (“shREG3A”) or control shRNA (“shC”), were dissolved in serum free medium and were subcutaneously (s.c.) injected into the flanks of the nude mice (5 × 10 6 cells per mouse). The mice body weights and tumor volumes were measured every six days [27]. The protocols were approved by the Institutional Animal Care and Use Committee (IACUC) and the Ethics Committee of Nantong University.
Tissue immunohistochemistry (IHC) and immunofluorescence assays. For IHC staining, human tissue sections or xenograft tissue sections were permeabilized by 0.3% Triton X-100 for 15 min at room temperature and were thereafter washed. Next, tissue sections were blocked by 5% serum for 30 min. The sections were then incubated with the anti-REG3A antibody (Abcam, ab198824, 1:100) or anti-p-Akt Ser-473 antibody (Cell Signaling Tech, #31957, 1:100) at 4°C overnight, followed by treatment with an enzyme-labeled second antibody at room temperature for 1h. Afterwards, tissue sections were developed [28]. For tissue immunofluorescence staining, the sections were incubated with fluorescence dyes, washed, and signals captured by a Zeiss Confocal microscope.
Statistical analyses. All values in the study were distributed normally and were expressed as means ± standard deviation (SD). Statistical differences between multiple (three or more) groups were analyzed via one-way ANOVA plus post hoc Bonferroni test (SPSS 23.0). For comparing two specific groups, the two-tailed Student’s t-test (Excel 2013) was utilized. P values < 0.05 were statistically significant.