Identification and expression of the target gene SLC24A2 of oar-miR-377 and its novel SNPs effects on wool traits in sheep

doi:10.21203/rs.3.rs-4066287/v1

Download PDF

Research Article

Identification and expression of the target gene SLC24A2 of oar-miR-377 and its novel SNPs effects on wool traits in sheep

https://doi.org/10.21203/rs.3.rs-4066287/v1

This work is licensed under a CC BY 4.0 License

Version 1

posted

You are reading this latest preprint version

Hair follicle development is closely associated with wool traits. Current studies reveal the crucial role of microRNAs in regulating the specific gene expression by binding to target mRNA involution in hair follicle growth and development, thereby regulating the wool traits. Our previous miRNA sequencing showed that oar-miR-377 have special expression in secondary hair follicle development and SLC24A2 may be a new candidate target using bioinformatics analysis. In this study, the regulatory relationship of oar-miR-377 and its specific target gene SLC24A2 was determined in sheep fibroblasts by dual-luciferase reporter assay, RT-qPCR and western blot. The genetic variation of oar-miR-377 precursors were detected using PCR and Sanger sequencing, the association between polymorphisms of oar-miR-377 and wool quality traits were analyzed in Chinese Merino and prolific Suffolk sheep. The result showed that SLC24A2 was a target gene of oar-miR-377. A SNP (276T＞C) of oar-miR-377 upstream sequences was identified in Chinese Merino sheep and prolific Suffolk sheep, and extremely significant associated with the fiber diameter variation (P<0.01). These results suggest that oar-miR-377 promotes secondary hair follicle development by down regulation of SLC24A2 gene expression, and its SNP might be useful markers for wool quality.

oar-miR-377

SLC24A2

SNP

Wool traits

Sheep

Wool is a healthy natural product from sheep, the economic traits of wool are including fiber length, fiber diameter, fiber diameter standard deviation, fiber diameter variation, fiber crimp, fiber density, and so on. Wool quality is determined by the development of hair follicles. Hair follicles (HFs) are complex and composed of 8 unique cell populations that are derived from the ectoderm and mesoderm, comprised with primary hair follicles and secondary hair follicles (Paus et al. 1999; Stenn 2001), the secondary hair follicles are a key factor in determining wool quality (Watabe et al. 2014). In mammals, hair follicles are crucial for temperature regulation, physical protection, sweat and sebum dispersion, sensory and tactile functions, and social interactions(Fuchs 2016). The number of dermal papilla cells and the size of hair placode are associated with the diameter, crimp, and density of wool fibers, which are of high economic value in sheep industry (Azzawi et al. 2018; Bertolini et al. 2020; Paus et al. 2005). Many reports have indicated that several genes may be involved in hair follicle development, such as Wnt10a (Reddy et al. 2001), Sox9 (Ouspenskaia et al. 2016), BMP4 (Chen et al. 2012). Additionally, some signaling pathways, such as BMP (Li et al. 2015), Eda (Zhang et al. 2009), Shh (Cetera et al. 2018) and TGF-β (Qiu et al. 2011) signaling, were revealed to promote or suppress the process of hair follicle development. In animal husbandry, elucidating the genetic mechanisms of development of hair follicle and wool-related traits is important to improve the sheep breeding.

MicroRNAs is a noncoding RNAs which include 22nt nucleotide and widely present in animals and plants, which can negatively regulate gene expression by base pairing of 5-end with the 3 untranslated regions (3'UTRs) of target mRNAs (Bartel 2004; Cai et al. 2009). Research has found that microRNAs are expressed in a variety of different hair follicle cells, such as hair follicle stem cells, matrix cells, outer root sheath cells, inner root sheath cells, and lots of miRNAs are verified to be specifically expressed in hair follicle cells (Andl 2015). MiR-203 is abundantly expressed in the epidermis and hair follicles, and closely related to the development of skin and hair follicles (Fabian et al. 2010). MiR-206 regulates the periodic changes of hair follicles by affecting the expression of genes related to hair follicle initiation and development in Shanbei white cashmere goats (Zou et al. 2020). MiR-125b may act as a repressor to suppress hair follicle stem cell differentiation (Zhang et al. 2011). MiR-205 has a positive effect on hair follicle stem cells and the proliferation of their progenies (Wang et al. 2013). Single nucleotide polymorphisms (SNP) are the most common variations in the genome, several SNPs in miRNA genes have been proved to be associated with human diseases by affecting the miRNA-mediated regulatory function. The SNP of mature miR-125a sequences can reduce miR-125a expression in cancer (Huang et al. 2019).

The SLC24A2 gene is a cation exchanger and serves as the second member of the solute carrier 24 family (Wang et al. 2022; Wang et al. 2017). Although there is no direct evidence that SLC24A2 is related to skin hair follicles, SLC24A5 has been confirmed to be related to animal hair color (Jorgenson et al. 2020). RT-PCR results showed that the SLC24A5 gene was highly expressed in skin and eyes and low expressed in other tissues, while the expression level in mouse melanoma was more than 100 times higher than that in normal skin and eyes (Childebayeva et al. 2022; Saito et al. 2022). Our previous research showed that SLC24A2 is a key molecule in hair follicle development signal transduction which also is the target gene of the oar-miR-377 by microRNA-sequencing analysis. However, the potential relationship between SLC24A2 and oar-miR-377, and its SNPs effects on wool traits has not been illustrated. In this study, the target binding relationship of SLC24A2 and oar-miR-377 was investigated in cellular levels, and functional mechanisms of SNP of oar-miR-377 were elucidated in sheep populations levels of Chinese Merino (Xinjiang Junken type) and prolific Suffolk sheep. The study may provide a basis for genetic mechanism of wool traits and fine wool sheep breeding.

Ethics statement

All experimental procedures were in accordance with the animal welfare legislation and approved by the Experimental Animal Care and Use Committee of Xinjiang Academy of Agricultural and Reclamation Sciences (Shihezi, China, ethic committee approval number: XJNKKXY-2020-34, December 30, 2020).

Experimental animals

The 165 Chinese Merino sheep (Xinjiang Junken type) and 95 prolific Suffolk sheep were selected from the sheep breeding farm of Xinjiang Academy of Agricultural and Reclamation Science, peripheral blood was collected from the jugular vein and placed in anticoagulant tubes containing EDTA (1mg/mL).

Cell culture of sheep skin fibroblasts

Ear tissue (10×10 mm) was sterilized with 75% alcohol and collected from 3-month-old healthy Merino lambs. After sterilized with 75% alcohol and washed by 1×PBS (pH 7.2) containing penicillin and streptomycin double antibody (1:100), skin was minced pieces and put into 90 mm dishes containing 10 mL of Dulbecco’s Modified Eagle’s Medium (DMEM, The Gibco Company) supplemented with 10% FBS and 1% antibiotics (penicillin and streptomycin). The cells were placed in Galaxy® 48R CO₂ Incubator from Eppendorf at 37°C and 5% CO₂, the culture medium was changed every 3 days and the growth status of cells was observed. When cell confluency reached 80%, the cells were detached using trypsin-EDTA (0.10% trypsin and 0.02% EDTA, The Gibco Company) for 5 min at 37°C, followed by trypsin digestion method for culture in the next passage.

Prediction of target genes and construction of recombinant plasmids

Using Bibiserv (https://bibiserv.cebitec.uni-bielefeld.de/rnahybrid/) online website to predict oar-miR-377 and sheep SLC24A2 gene 3'-UTR region binding sites. The primers of wild carrier was designed according to the binding site sequence of miRNA and target SLC24A2 gene searched in the NCBI website by Primer5.0 software (Table 1). The upstream primer was introduced the Not I restriction site, and downstream primer was introduced the Xho I restriction site, the primers were synthesized by Sangon Biotech (ShangHai, China). Total RNA was extracted from sheep skin samples using Trizol reagent (Invitrogen, Carlsbad, CA), cDNA was synthetized using the TransScript One-Step gDNA Removal and cDNA Synthesis SuperMix Kit (Beijing Transgen Biotech Co. Ltd., Beijing, China). SLC24A2 gene 3 'UTR sequence containing microRNA binding sites was amplificated by RT-PCR, the reactions were incubated in a 96-well plate at 94℃ for 5 min, followed by 35 cycles at 94℃ for 30 s, 60℃ for 30 s, 72℃ for 30 s, a final extension of 72°C for 5min, PCR products were purified using gel recovery kit, and ligated to pEASY - T1 Simple vector, then cloned into a psiCHECK-2 vector and constructed wild-type plasmid (pCHECK-W). The mutation sequence of SLC24A2 gene 3'-UTR region binding sites was synthetized in Jikai Gene Company (Shanghai, China), and ligated to psiCHECK-2 vector constructed mutation-type plasmid (pCHECK-M). The reconstructed plasmids were sequenced in Sangon Biotech (ShangHai, China). Mimics of oar-miR-377 were designed and synthesized by Jikai Gene Company (Shanghai, China).

Table 1

Sequences of primers
Primer names	Primer sequence	Length (bp)
SLC24A2-F	ATAAGAATGCGGCCGCgccaccatggTGGAAGCGCCTCACAA	589
SLC24A2-R	CCGCTCGAGcgccaccatggCTCTGACCAGCAAGGAGTA	589
*The lowercase letters indicate NotI and XhoI restriction sites

Cell transfection and dual luciferase activity assay

The skin fibroblasts were digested after the cell density reached approximately 85% confluence, and transfected with oar-miR-377 mimic, oar-miR-377 negative control, psiCHECK-2, pCHECK-W and pCHECK-M plasmid using Lipofectamine 2000 reagent (Invitrogen, Carlsbad, CA) following the manufacturer's protocol. Experimental groups were devided into 5 groups (Table 2). Each group was three replicates.At 48 h of transfection, the luciferase activity was detected by Dual Luciferase Reporter Assay system (Promega) according to the manufacturer's instructions. The luciferase activity of the firefly and renal luciferase was detected using a microplate reader (Thermo Scientific varioskan flash, MA, USA). Firefly luciferase activity was normalized to Renilla luciferase activity.

Table 2

Experimental groups
Groups	Experiment project
A	pCHECK-W and mimic
B	pCHECK-W and mimic negative control
C	pCHECK-M and mimic
D	pCHECK-M and mimic negative control
E	psiCHECK-2 and mimic negative control

Western blotting

The cell proteins were extracted by using a whole protein extraction kit (Applygen technologies, Beijing, China). Protein concentrations in cell lysates were determined spectrophotometrically using the NanoDrop ND-1000 (NanoDrop Technologies Inc., Wilmington, DE), and adjusted to the same concentration. Heat-denatured protein samples (25µg per lane) were resolved by SDS polyacrylamide gel electrophoresis (SDS-PAGE) on duplicate gels and transferred to nitrocellulose membrane (Boster, Wuhan, China). The membranes were incubated for 60 min in 10% nonfat dry milk to block nonspecific binding, followed by incubation for 12 h at 4℃ with a primary rabbit monoclonal antibody against SLC24A2 (Boster, Wuhan, China), which was diluted 1:1000 in tris-buffered saline Tween-20 (TBST). The membrane was then washed 2 times for 10 min in TBST, 1 time for 10 min in TBS, and incubated for 1 h at room temperature with a goat anti-rabbit secondary antibody conjugated to horseradish peroxidase (HRP) (Boster, Wuhan, China) diluted 1:2500 in TBST. The membrane was washed 2 times for 10 min in TBST and 1 time for 10 min in TBS, and the bound antibody was detected colorimetrically using a DAB detection kit (Boster, Wuhan, China) according to the manufacturer's instructions. Intensity of signals for SLC24A2 was quantified using Image-Pro Plus software version 6.0 (Media Cybernetics, Inc., Rockville, MD, USA).

RT-qPCR

Sheep skin fibroblasts were cultured after transfection, their mRNA levels were detected by qPCR after 48h culture. Total RNA was extracted according to the manufacturer's instructions using TRIzol (Thermo Fisher Scientific, Waltham, MA, USA). The RNA quality was detected using electrophoresis on 1% agarose gel in 1× TAE buffer. The purity and concentration of RNA was detected using Nanodrop 2000. Gene sequences were obtained from the NCBI gene bank, primers of SLC24A2 were designed by Primer 5, and miRNA primers of oar-miR-377 were designed by miR primer 2 (Table 1). The 20µL PCR reaction mixture contained 10µL Platinum SYBR GreenⅠmaster, 1µL forward primer (10µM), 1µL reverse qPCR primer (10µM), 6 µL ddH2O, 2µL DNA template. The reactions were incubated in a 96-well plate at 95℃ for 5 min, followed by 45 cycles at 95℃ for 10 s and 60℃ for 20 s and 72℃ for 20 s.

Measurement of wool traits

The wool samples were collected from 165 Chinese Merino (Xinjiang Junken type) and 95 prolific Suffolk sheep as the research objects. The average wool fiber diameter, fiber diameter standard deviation and fiber diameter variation were measured according to the guidelines of the China Fiber Inspection Bureau and International Wool Textile Organization (Cottle DJ, 2010).

Preparation of the genomic DNA

The genomic DNA was extracted using Tiangen blood genomic DNA extract kit following the manufacturer's protocol, the concentration and purity of genome DNA were detected by using 1.5% gel electrophoresis.

PCR amplification and SNP detection of oar-miR-377

The mature sequence of oar-miR-377 was obtained according to miRBase ( http://www.mirbase.org/ ). 700bp of oar-miR-377 upstream and downstream flanking sequences were searched by the UCSC Genome Browser ( http://genome.ucsc.edu/ ). The primers were designed using Primer 5.0 software, and synthesized by Shanghai Sangon Biotechnology Co. Ltd. (Shanghai, China) (Table 3).

Table 3

Primers for detection SNPs of oar-miR-377
Primer name	Primer sequences(5’-3’)	Annealing temperature(℃)	Product length	Chromosome position (bp)
miR-377-1	CCTTGGGAGGACCTTGCT	60	485	chr18:64558969–64559453
miR-377-1	AGAAGCCATCCCAAGCAG	60	485	chr18:64558969–64559453
miR-377-2	CTCTCTGTTCAATCGCAGCTC	60	460	chr18:64558923–64559382
miR-377-2	AATTCACCAAAGGCAACCTC	60	460	chr18:64558923–64559382

The mature sequence of oar-miR-377 was individually amplified using miR-377-1 primers and miR-377-2 primers. The PCR reactions were performed by mixing 2.5µl of genome DNA, 25µl of 2 × EasyTaq PCR Supermix, 1µl (10µM) each of the upstream primers and downstream primers, 20.5µl of DDW, in a final volume of 50µl. The cycling was performed on a thermocycler (A200, Longgene Scientific Instrument Company, Hangzhou, China), in accordance with the following program: 94°C for 5 min, 35 cycles of 94°C for 30 s, annealing at 60°C for 30 s, and 72°C for 30 s, a final extension of 72°C for 5min. The PCR products were detected using 1.5% agarose gel electrophoresis, and sequenced by Shanghai Sangon Biotechnology Co. Ltd. (Shanghai, China), and the SNP sites were identified by Blast against miRBase (v19, http://microrna.sanger.ac.uk).

Statistical Analysis

Genotype frequencies, allele frequencies and Hardy-Weinberg equilibriums test were performed using the Popgene32 software. For the tested population, the statistical models associated between different genotypes with average wool fiber diameter, fiber diameter standard deviation and fiber diameter variation were: Yijk = µ + Gi + Bj + Ak + Gi×Bj + Gi×Aj + Bj×Ak + eijK, which Yij was the phenotypic value of the wool traits, µ was overall population mean, Gi was the fixed effect of genotype, Bj was the fixed effect of breed, Ak was the fixed effect of age, Gi×Bj was genotype × breed interaction, Gi×Aj was genotype × age interaction, Bj×Ak was breed × age interaction, eijK was the random residual.

Data were subjected to the GLM procedures of John’s Macintosh Program (JMP version 10.0, SAS Institute Inc.), which was used to examine the correlations between genotypes and continuous traits, and to evaluate the least squares means. For all the data, P < 0.05 was significant, and P < 0.01 was highly significant.

Culture of sheep skin fibroblasts

Primary sheep fibroblast cells migrated from tissue pieces 5–12 day after explanting. Then, cells continued to proliferate and were passaged when reached 90% confluences. The cells were morphologically consistent with fibroblasts phenotype (Fig. 1).

Prediction of miRNA binding sites with target genes

The secondary structure of oar-miR-377 was obtained by sequencing results, which had two typical stem-loop structures (Fig. 2). The 3’-UTR sequence of SLC24A2 gene was obtained on the NCBI website, and the binding site sequence of the mature sequence of oar-miR-377 were matched with the 3’-UTR of the SLC24A2 gene by Bibiserv software (Fig. 3). The mfe was − 26.1 keal/mol.

Construction of psiCHECK-2 wild-type vector and mutant vector

The binding site sequence of SLC24A2 gene was obtained by PCR amplification. The 589bp PCR production was appeared by 1.5% agarose gel electrophoresis (Fig. 4). The target gene product were incorporated into the psiCHECK-2 vector using a T4 DNA ligase at 4℃ overnight. The sequences of constructed pCHECK-W and pCHECK-M were confirmed by standard BLAST alignment analysis and showed 100% and 97% Identities with Ovis aries solute carrier family 24 member 2 (SLC24A2) mRNA (Genbank accession number XM_015093243.4). The results indicated pCHECK-W and pCHECK-M vectors were successfully constructed.

Dual luciferase activity assay of SLC24A2 targeted by oar-miR-377

The results showed that the relative luciferase activity in pCHECK-W and mimic was significantly lower than the pCHECK-W and mimic NC by using dual luciferase activity assay (P<0.05) (Fig. 5). The relative luciferase activity were not significantly different among pCHECK-W and mimic NC, pCHECK-M and mimic, pCHECK-M and mimic NC, psiCHECK-2 and mimic NC (P>0.05). These results indicated that oar-miR-377 was binding to the 3’UTR in regulation of SLC24A2 mRNA.

The effect of SLC24A2 protein level regulated by oar-miR-377

The regulation of SLC24A2 protein level by oar-miR-377 in sheep skin fibroblasts was detected by Western blot (Fig. 6a). The grey values of bands were measured using ImageJ software (v1.48, NIH, Bethesda, MD). The relative intensity ratio of SLC24A2 and GAPDH was calculated based on their grey value. The results show that the protein expression of SLC24A2 regulated by oar-miR-377 was extremely significantly lower than NC (P < 0.01), the expression level of oar-miR-377 was 1.73 times lower than the negative contral (Fig. 6b).

The effect of SLC24A2 gene expression level regulated by oar-miR-377

The mRNA expression level of SLC24A2 regulated by oar-miR-377 and negative control was detected using RT-qPCR. The results showed that SLC24A2 expression level was significantly lower than NC (P < 0.05), the expression level of SLC24A2 was 3.37 times lower than the NC(Fig. 7).

PCR amplification and SNPs identification of oar-miR-377 precursors

PCR productions of oar-miR-377 was detected by 1.5% agarose gel electrophoresis, the 460bp bands were observed (Fig. 8).

Sequence of PCR productions were aligned to known oar-miR-377 precursors sequence after DNA sequencing. T > C mutation site was detected at 276bp upstream flanking region of oar-miR-377 in Chinese Merino sheep and prolific Suffolk sheep (Fig. 9).

Association of oar-miR-377 polymorphisms with wool traits

Three genotypes of TT, TC and CC were identified in Chinese Merino sheep (Xinjiang Junken type) and two genotypes of TC and CC were identified in the prolific Suffolk sheep, by using genetic polymorphism analysis of -276T > C locus of oar-miR-377. The genotype frequencies of CC, TC and TT in the Chinese Merino sheep were 0.39, 0.55 and 0.06. However, the genotype frequencies of CC and TC in prolific Suffolk sheep were 0.89 and 0.11 (Table 4). The SNP was in Hardy-Weinberg disequilibrium in Chinese Merino sheep, and Hardy-Weinberg equilibrium in prolific Suffolk sheep.

Table 4

The distribution of genotypic frequency and gene frequency of -276T > C in oar-miR-377 in two sheep breeds
Breeds	Number	CC	TC	TT	C	T	χ2 value	p-value
Chinese Merino sheep	165	0.39(65)	0.55(90)	0.06(10)	0.67	0.33	8.52	0.004
prolific Suffolk sheep	95	0.89(85)	0.11(10)	0(0)	0.95	0.05	0.29	0.59

The results of LSM analysis showed that the wool fiber diameter variation of CC genotype was extremely significantly larger than that of TT genotype (P < 0.01). The wool fiber diameter was no significant difference among CC, TT and TC genotype. The wool fiber diameter standard deviation was no significant difference among CC, TT and TC genotype (Table 5).

Table 5

Effects of oar-miR-377 SNP on wool traits (LSM)
Genotype	Numbers	Wool fiber diameter (µm)	Wool fiber diameter standard deviation	Wool fiber diameter variation
CC	150	26.80 ± 0.41	5.03 ± 0.17	19.94 ± 0.52 ^A
TC	100	26.37 ± 0.57	4.41 ± 0.23	17.43 ± 0.70 ^AB
TT	10	25.53 ± 1.58	4.39 ± 0.66	17.00 ± 0.34 ^B

*A-B:P < 0.01

MicroRNA is a small non-coding RNA, which is one of the gene regulators, play an important role in skeletal muscle growth and development. miRNA usually regulate mRNA stability or translation efficiency by silencing their target genes by binding to 3’ -untranslated region (UTR) sequences (Bartel, 2004; Cai et al. 2009). MicroRNAs regulate gene expression post-transcriptionally by interacting with target mRNA in a sequence-specific manner to either impair its stability, translation, or both. This post-transcriptional regulation serves as an important mechanism controlling the expression of many protein-coding genes (Fabian et al. 2010). 22 new miRNAs and 316 conserved miRNAs were identified in adult inner Mongolia cashmere goats using conservative identification, and these miRNAs may play important roles in the growth of skin and hair follicles (Liu et al. 2012). Both miR-125b (Zhang et al. 2011) and miR-205 (Wang et al. 2013) are expressed in hair follicle stem cells, but they have the opposite effect, miR-125b may act as a repressor to suppress stem cell differentiation, while miR-205 has a positive effect on stem cells and the proliferation of their progenies.

oar-miR-377 has been reported to enhance fibronectin protein production, regulate angiogenesis, suppress cell proliferation, predict clinical outcomes in patients with gastric cancer, induce tumorigenesis, and promote oxidative stress (Wang et al. 2008). Owing to the pleiotropic functions and DNMT1 targeting potential of oar-miR-377 may regulate human skin fibroblast (HSF) senescence by targeting DNMT1 (Xie et al. 2017). Studies have shown that oar-miR-377 controls the occurrence and development of esophageal cancer by inhibiting the expression of CD133 and VEGF (Li et al. 2017), and can regulate the NF-κB signaling pathway in melanoma cells by targeting the E2F3 gene (Zehavi et al. 2015). The SLC24A2 gene is a cation exchanger and serves as the second member of the solute carrier 24 family. Like other members of this family, the SLC24A2 gene encodes a protein with a hydrophobic signal sequence at the amino acid terminus and 11 hydrophobic regions, forming 2 groups of potential transmembrane domains separated by a central cytoplasmic domain. Although there is no direct evidence that SLC24A2 is related to skin hair follicles, SLC24A5 is related to animal hair color. Due to the mutation of SLC24A5 gene, the golden mutation is accompanied by the decreased pigmentation of the skin melanophore and the retinal epithelium, and the number and density of melanosomes are reduced, resulting in the delay and reduction of melanin deposition. In this study, the Dual-Luciferase reporter assay was used to study SLC24A2 targeting relationship with oar-miR-377, and results showed that oar-miR-377 could significantly reduce the gene expression and protein expression of SLC24A2 gene compared with NC, it was indicated that SLC24A2 is also regulated by oar-miR-377 to affect the quality of wool in sheep. Previous studies found that oar-miR-377 can regulated CD133, VEGF and E2F3 genes in humans, and this study found that oar-miR-377 can regulated SLC24A2 gene in sheep. This phenomenon indicates that oar-miR-377 gene regulation is species-specific.

Single nucleotide polymorphisms (SNP) are the most common variations in the genome, occurring every hundreds of base pair throughout the genome. Most SNPs in the genome are not non-synonymous SNP occurring in untranslated regions, introns or intergenic regions. These SNPs affect gene expression and complex diseases. However, because the thermodynamics of RNA-RNA binding plays a crucial role in the interaction of miRNA with target mRNA, it can be expected that sequence variants such as SNP in miRNA binding sites may affect the expression of miRNA targets. There was also evidence that SNPs in miRNA binding sites may be associated with disease, such as SNP identified at miRNA binding sites in oncogenes are associated with increased gene expression in papillary thyroid cancer (Hou et al. 2022). Due to the mutation of SLC24A5 gene, the golden mutation is accompanied by the decreased pigmentation of the skin melanophore and the retinal epithelium, and the number and density of melanosomes are reduced, resulting in the delay and reduction of melanin deposition (Reis et al. 2020). In this study, T > C mutation was found at 276bp upstream flanking region of the oar-miR-377 by sequencing and sequence alignment. TT, TC and CC genotypes were identified in Chinese Merino sheep (Xinjiang Junken type), TC and CC genotypes were identified in the prolific Suffolk sheep, TT genotype exists only in Chinese Merino sheep, and wool fiber diameter variation of TT genotype was extremely significantly less than that of CC genotype, it was indicated that TT genotype is closely related to wool quality. The genotypes P-value of Chinese merino sheep(Xinjiang Junken type) and prolific Suffolk sheep showed that Chinese Merino sheep were in disequilibrium according to Hardy-Weinberg equilibrium, These results suggest that the phenotypic traits of Chinese merino sheep wool are artificially manipulated, while the phenotypic traits of prolific Suffolk sheep wool are in a natural state. We speculated that SNP at 276bp upstream flanking region of the oar-miR-377 affected the binding with SLC24A2 and regulation of SLC24A2 expression. As a result, the mutation of oar-miR-377 influence the wool fiber diameter variation. It was indicated that oar-miR-377 regulated hair follicle development, the mutation of oar-miR-377 affected wool quality, the individuals with TT genotype could be selected in fine wool sheep breeding.

SLC24A2 gene was target gene of oar-miR-377. SNP of -276 T > C in the flanking region of oar-miR-377 affected wool fiber diameter variation, TT genotypes were relation to wool quality. The results of this study provide a basis for the study of oar-miR-377 regulating wool quality and breed selection.

Author Contributions Conceptualization and writing-original draft preparation was Hua Yang and Hua-Qian Zhou; Methodology and data curation was Hang-Yu-Lu Yang; Validation was Wen-Hua Fan and Li-Xia Qiu; Investigation and samples was Qian Yu and Wen-Zhe Zhang; Writing-review and editing was Zong-Sheng Zhao and Yong-Lin Yang; Funding acquisition was Hua Yang. All authors have read and agreed to the published version of the manuscript.

Acknowledgements This work was supported by the National Natural Science Foundation of China (No. 32360818), Youth Science and Technology Innovation Talent of Tianshan Talent Training Program in Xinjiang; Bingtuan Talent Training Program in Xinjiang; Agricultural Science and Technology Innovation Project of Xinjiang Production and Construction Corps (No. NCG202211), Sheep Breeding and Upgrading Plan of duel-purpose breed both for mutton and wool, cashmere and wool of Xinjiang Uygur Autonomous Region (No. 2023XJRMY-03), China.

Competing Interest The authors have no relevant financial or non-financial interests to disclose.

Andl T, Botchkareva NV (2015) MicroRNAs (miRNAs) in the control of HF development and cycling: the next frontiers in hair research. Exp Dermatol 24(11):821-826. https://doi.org/10.1111/exd.12785
Azzawi S, Penzi LR, Senna MM (2018) Immune Privilege Collapse and Alopecia Development: Is Stress a Factor. Skin Appendage Disord 4(4):236-244. https://doi.org/10.1159/000485080
Bartel DP (2004) MicroRNAs: genomics, biogenesis, mechanism, and function. Cell 116(2):281-297. https://doi.org/10.1016/s0092-8674(04)00045-5
Bertolini M, McElwee K, Gilhar A et al (2020) Hair follicle immune privilege and its collapse in alopecia areata. Exp Dermatol 29(8):703-725. https://doi.org/10.1111/exd.14155
Cai Y, Yu X, Hu S et al (2009) A brief review on the mechanisms of miRNA regulation. Genomics Proteomics Bioinformatics 7(4):147-154. https://doi.org/10.1016/S1672-0229(08)60044-3
Cetera M, Leybova L, Joyce B et al (2018) Counter-rotational cell flows drive morphological and cell fate asymmetries in mammalian hair follicles. Nat Cell Biol 20(5):541-552. https://doi.org/10.1038/s41556-018-0082-7
Chen D, Jarrell A, Guo C et al (2012) Dermal beta-catenin activity in response to epidermal Wnt ligands is required for fibroblast proliferation and hair follicle initiation. Development 139(8):1522-1533. https://doi.org/10.1242/dev.076463
Childebayeva A, Rohrlach AB, Barquera R et al (2022) Population Genetics and Signatures of Selection in Early Neolithic European Farmers. Mol Biol Evol 39(6):https://doi.org/10.1093/molbev/msac108
Fabian MR, Sonenberg N, Filipowicz W (2010) Regulation of mRNA translation and stability by microRNAs. Annu Rev Biochem 79:351-379. https://doi.org/10.1146/annurev-biochem-060308-103103
Fuchs E (2016) Epithelial Skin Biology: Three Decades of Developmental Biology, a Hundred Questions Answered and a Thousand New Ones to Address. Curr Top Dev Biol 116:357-374. https://doi.org/10.1016/bs.ctdb.2015.11.033
Hou Y, Zhou M, Li Y et al (2022) Risk SNP-mediated LINC01614 upregulation drives head and neck squamous cell carcinoma progression via PI3K/AKT signaling pathway. Mol Carcinog 61(8):797-811. https://doi.org/10.1002/mc.23422
Huang X, Zhang T, Li G et al (2019) Regulation of miR-125a expression by rs12976445 single-nucleotide polymorphism is associated with radiotherapy-induced pneumonitis in lung carcinoma patients. J Cell Biochem 120(3):4485-4493. https://doi.org/10.1002/jcb.27736
Jorgenson E, Choquet H, Yin J et al (2020) Genetic ancestry, skin pigmentation, and the risk of cutaneous squamous cell carcinoma in Hispanic/Latino and non-Hispanic white populations. Commun Biol 3(1):765. https://doi.org/10.1038/s42003-020-01461-8
Li A, Lai YC, Figueroa S et al (2015) Deciphering principles of morphogenesis from temporal and spatial patterns on the integument. Dev Dyn 244(8):905-920. https://doi.org/10.1002/dvdy.24281
Li B, Xu WW, Han L, et al (2017) MicroRNA-377 suppresses initiation and progression of esophageal cancer by inhibiting CD133 and VEGF. Oncogene 36(28):3986-4000. https://doi.org/10.1038/onc.2017.29
Liu Z, Xiao H, Li H et al (2012) Identification of conserved and novel microRNAs in cashmere goat skin by deep sequencing. PLoS One 7(12):e50001. https://doi.org/10.1371/journal.pone.0050001
Ouspenskaia T, Matos I, Mertz AF et al (2016) WNT-SHH Antagonism Specifies and Expands Stem Cells prior to Niche Formation. Cell 164(1-2):156-169. https://doi.org/10.1016/j.cell.2015.11.058
Paus R, Muller-Rover S, Van Der Veen C et al (1999) A comprehensive guide for the recognition and classification of distinct stages of hair follicle morphogenesis. J Invest Dermatol 113(4):523-532. https://doi.org/10.1046/j.1523-1747.1999.00740.x
Paus R, Nickoloff BJ, Ito T (2005) A 'hairy' privilege. Trends Immunol 26(1):32-40. https://doi.org/10.1016/j.it.2004.09.014
Qiu W, Li X, Tang H, Huang AS et al (2011) Conditional activin receptor type 1B (Acvr1b) knockout mice reveal hair loss abnormality. J Invest Dermatol 131(5):1067-1076. https://doi.org/10.1038/jid.2010.400
Reddy S, Andl T, Bagasra A et al (2001) Characterization of Wnt gene expression in developing and postnatal hair follicles and identification of Wnt5a as a target of Sonic hedgehog in hair follicle morphogenesis. Mech Dev 107(1-2):69-82. https://doi.org/10.1016/s0925-4773(01)00452-x
Reis LB, Bakos RM, Vianna FSL et al (2020) Skin pigmentation polymorphisms associated with increased risk of melanoma in a case-control sample from southern Brazil. BMC Cancer 20(1):1069. https://doi.org/10.1186/s12885-020-07485-x
Saito T, Okamura K, Kosaki R et al (2022) Impact of a SLC24A5 variant on the retinal pigment epithelium of a Japanese patient with oculocutaneous albinism type 6. Pigment Cell Melanoma Res 35(2):212-219. https://doi.org/10.1111/pcmr.13024
Stenn KS, Paus R (2001) Controls of hair follicle cycling. Physiol Rev 81(1):449-494. https://doi.org/10.1152/physrev.2001.81.1.449
Wang D, Zhang Z, O'Loughlin E et al (2013) MicroRNA-205 controls neonatal expansion of skin stem cells by modulating the PI(3)K pathway. Nat Cell Biol 15(10):1153-1163. https://doi.org/10.1038/ncb2827
Wang F, Luo Q, Chen Y et al (2022) A Genome-Wide Scan on Individual Typology Angle Found Variants at SLC24A2 Associated with Skin Color Variation in Chinese Populations. J Invest Dermatol 142(4):1223-1227 e1214. https://doi.org/10.1016/j.jid.2021.07.186
Wang L, Shao Z, Chen S et al (2017) A SLC24A2 Gene Variant Uncovered in Pancreatic Ductal Adenocarcinoma by Whole Exome Sequencing. Tohoku J Exp Med 241(4):287-295. https://doi.org/10.1620/tjem.241.287
Wang Q, Wang Y, Minto AW et al (2008) MicroRNA-377 is up-regulated and can lead to increased fibronectin production in diabetic nephropathy. FASEB journal : official publication of the Federation of American Societies for Experimental Biology 22(12):4126-4135. https://doi.org/10.1096/fj.08-112326
Watabe R, Yamaguchi T, Kabashima-Kubo R et al (2014) Leptin controls hair follicle cycling. Exp Dermatol 23(4):228-229. https://doi.org/10.1111/exd.12335
Xie HF, Liu YZ, Du R et al (2017) miR-377 induces senescence in human skin fibroblasts by targeting DNA methyltransferase 1. Cell Death Dis 8(3):e2663-e2663. https://doi.org/10.1038/cddis.2017.75
Zehavi L, Schayek H, Jacob-Hirsch J et al (2015) MiR-377 targets E2F3 and alters the NF-kB signaling pathway through MAP3K7 in malignant melanoma. Mol Cancer 14:68. https://doi.org/10.1186/s12943-015-0338-9
Zhang L, Stokes N, Polak L et al (2011) Specific microRNAs are preferentially expressed by skin stem cells to balance self-renewal and early lineage commitment. Cell Stem Cell 8(3):294-308. https://doi.org/10.1016/j.stem.2011.01.014
Zhang Y, Tomann P, Andl T et al (2009) Reciprocal requirements for EDA/EDAR/NF-kappaB and Wnt/beta-catenin signaling pathways in hair follicle induction. Dev Cell 17(1):49-61. https://doi.org/10.1016/j.devcel.2009.05.011
Zou X, Lu T, Zhao Z et al (2020) Comprehensive analysis of mRNAs and miRNAs in the ovarian follicles of uniparous and multiple goats at estrus phase. BMC Genom 21(1):267. https://doi.org/10.1186/s12864-020-6671-4

Download PDF

Version 1

posted

You are reading this latest preprint version

Identification and expression of the target gene SLC24A2 of oar-miR-377 and its novel SNPs effects on wool traits in sheep

Status:

Version 1

Abstract

Figures

Introduction

Materials and methods

Ethics statement

Experimental animals

Cell culture of sheep skin fibroblasts

Prediction of target genes and construction of recombinant plasmids

Cell transfection and dual luciferase activity assay

Western blotting

RT-qPCR

Measurement of wool traits

Preparation of the genomic DNA

PCR amplification and SNP detection of oar-miR-377

Statistical Analysis

Results

Culture of sheep skin fibroblasts

Prediction of miRNA binding sites with target genes

Construction of psiCHECK-2 wild-type vector and mutant vector

Dual luciferase activity assay of SLC24A2 targeted by oar-miR-377

The effect of SLC24A2 protein level regulated by oar-miR-377

The effect of SLC24A2 gene expression level regulated by oar-miR-377

PCR amplification and SNPs identification of oar-miR-377 precursors

Association of oar-miR-377 polymorphisms with wool traits

Discussion

Conclusions

Declarations

References

Status:

Version 1