Marker assisted transfer of S5 gene to develop universal restorer with wide-compatibility for genetic diversification and realization of inter-subspecific heterosis by overcoming indica x japonica hybrid sterility in rice

doi:10.21203/rs.3.rs-4067045/v1

Download PDF

Article

Marker assisted transfer of S5 gene to develop universal restorer with wide-compatibility for genetic diversification and realization of inter-subspecific heterosis by overcoming indica x japonica hybrid sterility in rice

https://doi.org/10.21203/rs.3.rs-4067045/v1

This work is licensed under a CC BY 4.0 License

Version 1

posted

You are reading this latest preprint version

A major phenomenon hindering development of inter-subspecific rice hybrids is the ‘hybrid sterility’ observed in indica x japonica (IJ) crosses. We had successfully transferred wide compatibility gene S⁵ in to an elite restorer background for the first time through marker-aided back cross breeding (MABB), and developed wide compatible restorers (WCR) that are genetically diversifiable with japonica for use with indica CMS lines to realize inter-subspecific heterosis. WCR lines also improved the fertility of IJ hybrids by overcoming incompatibility compared to control hybrids. These lines exhibited agronomic superiority over original restorer in terms of earliness, longer panicle, more number of filled grain and single plant yield. MABB for major fertility restoring genes Rf3 and Rf4, background genotyping with genome-wide SSR markers and stringent phenotyping resulted in superior recipient genome recovery. Thus, the present study opened up the development of a new class of ‘wide compatible restorer’ (WCR) with universal application in hybrid rice breeding such as genetic diversification with japonica, restorers with broad genetic base, use of diversified restorers with well adapted indica gene pool towards development of IJ hybrids with preferred grain qualities and high yield. The implications of the results for inter-subspecific hybrid development are discussed.

Biological sciences/Genetics/Genomics

Biological sciences/Genetics/Plant breeding

Biological sciences/Genetics

Biological sciences/Plant sciences

Biological sciences/Plant sciences/Plant breeding

Biological sciences/Plant sciences/Plant molecular biology

inter-subspecific cross

marker assisted back cross breeding

rice

wide compatibility

indica x japonica hybrid

restorer

Rice is one of the important food staple for more than half of the world’s population. Rice production in India stood at 124.36 million tonnes of rice from 45.7 million hectares during 2020 − 21¹. Hybrid rice cultivation was successfully demonstrated in countries like China, Bangladesh, Indonesia and Philippines including India. Unlike in China where contribution of more than 50% to rice area and production comes from hybrid rice, only 6.7% of total area (~ 3 million hectares) under rice cultivation in India is shared by hybrid rice cultivation. The global demand for rice to feed increasing human population from the limited arable land can be met through development and adoption of strategies enhancing production and productivity in rice.

Hybrid rice technology is one of the potential strategy for increasing rice production and productivity in rice². Exploitation of heterosis in rice has resulted in release of several hybrids for commercial cultivation in India and other countries. The Wild-Abortive Cytoplasmic Male Sterile (WA-CMS) line as female parents and restorer lines, which restores the fertility in the hybrids, as male parents were widely used for the development of rice hybrids. Complete and stable restoration ability is governed by two major genes viz., Rf3 on chromosome 1 and Rf4 on chromosome 10 along with modifier genes. The restorers with dominant alleles of the two genes in homozygous or heterozygous condition will be fully fertile and the genotypes having dominant alleles of one of the two genes in homozygous or heterozygous condition but homozygous recessive alleles of the other gene will behave partially sterile or partially fertile and vice-versa³. Routine screening procedure for fertility restoration involve a test cross between the test genotype and CMS lines followed by progeny testing of their F₁ hybrids for pollen and spikelet fertility and classification of test genotypes as restorers/partial restorers/maintainers/partial maintainers. With advent of molecular markers linked to fertility restoration trait and by molecular screening, identification of restorers from large number of germplasm/breeding lines is made easy without progeny testing⁴. Based on PCR assay with molecular markers linked to Rf3 and Rf4, higher fertility restoration was reported in those lines possessing both Rf3 and Rf4 than the genotypes containing either Rf3 or Rf4 individually⁴.

The majority of rice hybrids which were released for cultivation were derived from intra-subspecific i.e indica x indica hybridization. Exploitation of strong heterosis exhibited in inter-subspecific i.e indica x japonica (IJ) crosses was proposed for breaking the yield plateau of rice hybrids⁵. Since then, development of such inter-subspecific hybrids has become a major objective of hybrid rice breeding programs in India and other Asian countries. However, the major difficulty encountered in the development of such inter-subspecific hybrids is the partial sterility frequently observed in most indica x japonica (IJ) crosses⁶. The efforts to overcome the hybrid sterility have met with limited success due to the need for tedious and time consuming ‘bridge-cross’ with a wide compatible variety (WCV).

In hybrid rice breeding, hybrid sterility is the major bottleneck in the utilization and exploitation of high heterosis in inter-subspecific crosses^7–10. Dissection of the genetic basis underlying hybrid sterility has been extensively investigated in the last several decades and nearly 50 loci had been implicated to control this phenomenon in rice, including loci causing female gamete abortion and pollen sterility¹¹. S5 is a major locus which control hybrid sterility due to its implicative role in female sterility in the inter-subspecific hybrids^12,13. At S5 locus on chromosome 6, three alleles, namely indica allele (S5ⁱ), japonica allele (S5^j) and neutral allele (S5ⁿ) were identified^12,14. The S5ⁱ and S5^j alleles differed only at two nucleotides for the female sterility, while the S5ⁿ allele has a loss-function mutation with 136-bp DNA sequence deletion for the compatibility^15–17.

With the discovery and molecular characterization of major indica–japonica hybrid sterility and wide compatibility gene S5ⁿ in a wide compatible variety¹⁵, the first-author co-developed a set of functional molecular markers such as S5 InDel, S5-MMS for S5 locus and further multiplexed to assay the allelic status at one go and classified the varieties as indica (S5ⁱ) or japonica (S5^j) or neutral / wide compatible (S5ⁿ)¹⁸. Several studies have demonstrated the utility of the S5 InDel / S5-MMS in assaying the allelic status and also in Marker Assisted Selection^11,19–25. Recently, using S5 Indel / S5MMS, the major wide compatible gene S5ⁿ was introgressed into elite rice maintainer for obtaining wide compatible CMS lines to use with male restorers of japonica background to exploit inter-subspecific heterosis and develop heterotic indica x japonica hybrids²⁴. However, use of japonicas as male parent is of limited utility due to their poor fertility restoration in WA-CMS based hybrids although inter-subspecific hybrids could be produced due to the improved WA-CMS line. On the other hand, genes responsible for hybrid sterility were transferred in to japonica variety and indica-compatible lines were developed for use in Chinese hybrid rice breeding¹¹. This particular strategy has limitation in hybrid rice breeding programs of India where indica-type grain qualities are preferred and usually determined by indica female parent.

In India, most of the WA-CMS lines (female parents) used to develop hybrids are of indica type and are preferred for their contribution to desirable grain quality features exhibited in the hybrids. Hence, diversification and use of indica based male restorers with varying proportions of japonica genome while retaining the restoration ability is the only available option to realize inter-subspecific heterosis and to achieve this, a new class of lines ‘indica-compatible-japonica-restorers’ or simply “Wide Compatible Restorers” (WCR) which would produce fertile hybrids with japonica, need to be first developed. In this direction, an attempt was made to introgress wide compatible gene into elite, stable restorer of a popular rice hybrid, CORH4 and to demonstrate the utility of wide compatible restorer in overcoming the hybrid sterility in inter-subspecific crosses.

Evaluation of fertility restoration of recipient restorer CB174R

Evaluation of fertility restoration behaviour of recipient parent CB174R compared to stable restorer KMR3R (male parent of popular commercial rice hybrid, KRH2) in the present study in crosses involving WA-CMS lines viz., IR58025A, IR58029A and two in-house developed CMS lines viz., COMS23A, TNAU CMS2A. The F₁ hybrids were studied for pollen and spikelet fertility during four rice growing seasons in comparison with the KRH2 hybrid re-constituted using stable restorer KMR3R, as check. Over season - group mean pollen fertility percent and spikelet fertility percent of hybrids involving CB174R were found to be significantly higher compared to the KMR3R-derived hybrid (Table 1). Over seasons, two CB174-derived hybrids for mean pollen percent and three CB174-derived hybrids for mean spikelet fertility recorded significantly higher values than KMR3R-derived hybrid. The overall fertility restoration of CB174R in terms of mean pollen and spikelet fertility across all seasons was found to be 93.5% and 88.1%, respectively and was found to be significantly higher than KMR3R (Table 1).

Molecular screening of rice germplasm and validation of gene specific marker in donor

The rice collections were assayed for their allelic status at S5 locus with gene-specific functional marker, S5-InDel, previously co-developed by the author (Table 3). In the present study, we aimed for the transfer of wide compatible allele from the donor parent Akshaydhan which was confirmed through this experiment. In addition, molecular screening for presence of wide compatible allele - S5ⁿ among a subset of rice germplasm collection containing 52 genotypes was carried out. Among the 52 genotypes, 17 were identified to harbour the ‘wide compatible neutral allele - S5ⁿ and remaining genotypes possessed either indica (S5ⁱ) or japonica (S5^j) allele at the locus S5 (Table 4). S5-InDel amplified 281-bp fragment in wide compatible genotypes and 417-bp fragment in indicas or japonicas.

Molecular screening for Rf gene(s) and identification of polymorphic SSR markers

The recipient restorer parent CB174R was screened for the presence of Rf3 (on chromosome 1) and Rf4 (on chromosome 10) using gene linked SSR markers DRRM RF3-5 and RM6100, respectively (Table 2). The restorer lines CB174R was confirmed to possess both Rf3 and Rf4 genes specific alleles. These markers were also used for selection of restorer background through selection for Rf3 and Rf4 among the S5ⁿ positive plants in addition to genome-wide SSR markers to select for the restorer genetic background in addition to above loci so as to ensure recovery of complete restorer / recipient genome among the backcross derived lines in the later generations (Table 2). Parental polymorphism survey was conducted with 154 genome-wide SSR markers spanning around all rice chromosomes and 80 markers were identified to be polymorphic between parents (Table 3).

Marker-assisted backcross breeding for wide compatibility and fertility restoration

The details of plant selection at each generation and advancement to next generation are given in master Table 5 through A to F. The F₁ plants generated from the cross CB174R/Akshaydhan were first screened for wide compatible allele S5ⁿ with S5-InDel marker to identify the ‘true’ F₁s showing heterozygous amplification pattern. A total of 16 ‘positive’ F₁ plants were identified from 50 plants and then backcrossed to recurrent parent CB174R as female and positive F₁s as male. Out of 268 BC₁F₁ plants produced, 72 plants were found to be positive for wide compatible allele S5ⁿ confirming the introgression (Fig. 1a). Screening for the presence of major fertility restorer genes Rf3 and Rf4 was carried out using tightly linked SSR markers (DRRM RF3-5 and RM6100) to retain the restorer genes in the selected population (Fig. 1b). Thirty eight plants were observed to display homozygous amplification of fertility restorer allele (i.e Rf3Rf3) and these plants were further screened for another fertility restorer gene Rf4 using the linked marker RM6100. Twenty six plants were observed to be homozygous i.e Rf4Rf4. A total of 26 plants were found to contain Rf3 and Rf4 in addition to S5ⁿ and considered triple positives.

In order to recover the recurrent parent genome from among the 26 triple positives BC₁F₁ plants, 80 polymorphic SSR markers were used. The percentage of background genome recovery among the BC₁F₁ plants ranged from 51.32 to 80.00%. Ten plants with maximum recurrent parent genome recovery and showed similarity to recurrent parent (CB174R) with respect to phenotypic and agronomic characters were selected (Supplementary Table 1) and backcrossed to produce BC₂F₁s. In BC₂F₁, a total of 462 plants genotyped with S5 InDel, DRRM RF3-5, RM6100 markers in a step-by-step manner as followed in BC₁F₁ generation. Of the 462 plants, 42 plants were identified to be triple positive for S5ⁿ, Rf3 and Rf4 specific markers. During background selection, six plants with maximum recurrent parent genome recovery and showed phenotypic similarity to recurrent parent were selected and advanced to BC₂F₂ by selfing. In BC₂F_2, 386 plants were raised and four plants with homozygous alleles for S5ⁿ, Rf3 and Rf4 were identified and selfed. Four promising homozygous lines of CB174R carrying S5 gene for wide compatibility were thus isolated in the advanced generation. Select homozygous lines were assessed for wide compatibility and fertility restoration.

Evaluation of gene-introgressed line for hybrid fertility / wide compatibility and yield effect with japonica testers

The introgressed and original versions of CB174R restorer lines were test crossed to five japonica testers viz., Blue Bonnet 50, Hawn Cam, Pulut Todipi, D1-177, Hinohikari for studying the wide compatibility in terms of pollen and spikelet fertility of resulting hybrids. A significant increase in percent pollen fertility and percent spikelet fertility was observed among the F₁s produced using restorer with wide compatible gene S5ⁿ compared to the F₁s produced with normal restorer (Table 6, Fig. 2). The per cent pollen fertility in F₁s with original restorer was ranged from 37.30 (Hawn Cam x CB174R) to 65.31(Pulut Todipi x CB174R) with mean of 53.04%. In the F₁s resulting with introgressed restorer having S5ⁿ, the per cent pollen fertility ranged from 41.02 (Hawn Cam x CB174R + S5ⁿ) to 80.10 (Pulut Todipi x CB174R + S5ⁿ) with mean of 65.59%. The per cent increase in pollen fertility in the hybrids between japonicas and introgressed restorer line ranged from 9.97 (Hawn Cam x CB174R + S5ⁿ) to 53.50 (Blue bonnet x CB 174R + S5n). The per cent spikelet fertility in F₁s with original CB174R was ranged from 7.75 (Hawn Cam x CB174R) to 72.37 (Pulut Todipi x CB174R) with mean of 53.63% and in the F₁s derived from CB174R with S5ⁿ, it ranged from 29.34 (Hawn Cam x CB174R + S5ⁿ) to 86.41 (DI − 177 x CB174R + S5ⁿ) with mean of 71.77%. The per cent increase in spikelet fertility ranged from 15.19 (Pulut Todipi x CB174R + S5ⁿ) to 278.58 (Hawn Cam x CB174R + S5ⁿ). The mean percent increase in pollen and spikelet fertility in the inter-subspecific crosses was 23.92 and 77.55, respectively. Mean PFF and PSF of parent CB174R was observed to be 73.40 and 88.57, respectively.

Evaluation of gene-introgressed line for fertility restoration ability with male sterile line

Fertility restoration ability of introgressed restorer was assessed in the F₁ hybrids derived from IR58025A/CB174R (i.e CORH4) and IR58025A/CB174R + S5ⁿ in terms of pollen and spikelet fertility. It was observed that the fertility level of hybrid derived using improved restorer (IR58025A x CB174R + S5ⁿ) was on par to the CORH4 hybrid derived from IR58025A x CB174R confirming the restoration ability of the introgressed CB174R (data not shown).

Effect of S5ⁿ gene-introgression on the yield of indica x japonica hybrids

Evaluation of effect of wide compatible gene S5ⁿ on the yield and its component traits was studied among the hybrids of japonica testers with introgressed restorer of CB174R (indica x japonica hybrids or IJ hybrids) in comparison to hybrids with original CB174R (control hybrids). All IJ crosses exhibited positive and significant yield improvement compare to the control hybrids (Table 7a&7b). Positive significant differences were observed for number of filled grains per panicle and single plant yield in all IJ hybrids studied. Among the five japonica testers, IJ hybrid resulting with DI-177 and Hinohikari exhibited positive significant differences for total number of tillers and total number of spikelets, and panicle length, respectively. Among the control hybrids, single plant yield ranged from 13.50 g (Hawn Cam x CB174R) to 29.15 g (Blue Bonnet-50 x CB174R) with a mean of 24.70 g. The single plant yield among IJ hybrids varied from 20.75 g (Hawn Cam x CB174R + S5ⁿ) to 39.00 g (DI-177 x CB174R + S5ⁿ) with a mean of 33.50 g. The mean percent increase in single plant yield in IJ crosses over control hybrid ranged from 11.59 (Blue bonnet x CB 174R + S5ⁿ) to 55.02 (Pulut Todipi x CB174R + S5ⁿ) with an average of 38.13% yield increase (Table 7b).

Phenotypic evaluation of wide compatible restorer lines

The four introgressed / back cross derived lines termed as Wide Compatible Restorer lines (WCRs) with more than 94% of recurrent parent genome were isolated in homozygous condition at BC₂F₄ and subjected to phenotypic evaluation for fertility and agro-morphological characters along with original restorer CB174R (Table 8, Fig. 3). The two backcross derivatives WCR02, WCR03 were morphologically similar and recorded the plant height on par to original restorer. The per cent pollen fertility in the improved restorer lines or WCRs ranged from 92.8 (WCR04) to 98.9 (WCR02). The per cent spikelet fertility in WCRs ranged from 94.2 (WCR03) to 97.8 (WCR02). Days to fifty percent flowering ranged from 100 days (WCR01) to 113 days (WCR04). New variants were obtained for traits such as earliness (129 days, WCR01), longer panicle 28.6 cm, WCR02) and more number of filled grains per panicle (298.6, WCR02) compared to original restorer. The percent pollen and spikelet fertility of WCRs was on par to CB174R. The original restorer parent recorded an overall mean single plant yield of 30.8g. While the derived lines (WCR01 and WCR04) exhibited grain yields on par to recipient parent, WCR02 (22.0%) recorded highest percent yield increase followed by WCR03 (12.7%) with a yield of 37.60 g and 34.70 g, respectively. The grain quality characters of introgressed lines were confirmed to be comparable to CB174R (Table 9).

Hybrid rice technology is considered as viable genetic option to increase the rice productivity through development and deployment of highly heterotic rice hybrids. Even though rice is a self pollinated crop, availability of wild-abortive (WA) cytoplasm based cytoplasmic male sterile (CMS) lines (as female parent) and fertility restoration lines or ‘restorers’ (as male parent) made it possible to commercially exploit rice hybrids worldwide. In order to further increase the heterosis and yield levels of rice hybrids, development of inter-subspecific or indica x japonica (IJ) hybrids through exploitation of high heterosis observed in genetically wider IJ crosses had been attempted with limited success particularly in countries like India. One of the major challenges faced by hybrid rice breeding is to overcome ‘inherent incompatibility’ or ‘wide incompatibility’ phenomenon which is manifested in the form of hybrid sterility. Development of heterotic inter-subspecific IJ hybrids is mainly hindered due to sterility of hybrids through reduction of pollen or spikelet fertility when indica and japonica genome come together in a hybrid²⁶. Hybrid sterility also limits undertaking genetic diversification of ‘well adapted - preferred’ indica parental gene pool towards japonica subspecies which is to be achieved obviously by crossing of these two subspecies.

In addition to the limitations and large complexities associated with direct use of japonicas as males to restore the fertility of WA-CMS and as females to behave like male sterile lines, poor grain qualities of japonicas also restrict their use as females in IJ hybrid development. Strategies of development of lines intermediate to indica and japonica through genetic diversification and use of such lines as parents, particularly as males, are considered promising for realization of genetic gains from inter-subspecific heterosis. Hence, genetic diversification or ‘japonica-sisation’ of male indica restorers is the only option left as the female ‘indica’ maintainers / CMS lines are preferred for grain quality currently and used widely than ‘japonica’ particularly with respect to Indian context where grain quality considerations are of paramount. Efforts to overcoming hybrid sterility associated limitations and to undertaking genetic diversification towards desired rice sub-species are expected to fuel the IJ hybrid rice breeding to a greater extent towards successful development of highly productive, inter-subspecific hybrids with high heterosis, yield and superior grain quality. Introgression of neutral allele or wide compatible genes in to hybrid rice parental lines is considered as one of the strategies of overcoming hybrid sterility in IJ hybrids.

In this context, we had successfully demonstrated the introgression of wide compatible gene in an indica restorer which improved hybrid fertility in IJ crosses involving japonica testers and overcome sterility /poor seed set problems in IJ crosses, and also developed genetically diversifiable ‘Wide Compatible Restorer’ (WCR) with stable and complete fertility restoration across CMS lines under varied rice growing ecologies for universal applications in Indian hybrid rice breeding. Therefore in the present investigation, an attempt was made to transfer wide compatible gene into elite, indica-based restorer of a popular rice hybrid through Marker Assisted Backcross Breeding (MABB) coupled with phenotypic selection and to study the fertility levels of indica x japonica hybrids (IJ hybrids) derived by crossing the improved restorer with japonica testers. We had taken Akshaydhan, a modern rice cultivar released by Indian Institute of Rice Research, as donor parent for S5ⁿ and CB174R, an elite and stable restorer male parent of a popular rice hybrid CORH4, as the recipient. Marker Assisted Backcross Breeding (MABB) was carried out for wide compatibility and fertility restoration with functional marker S5-InDel previously co-developed by the first author¹⁸ and, Rf3 and Rf4 linked SSR markers DRRM RF3-5 and RM6100, respectively. In addition, genome-wide SSR markers were used for background selection and recipient genome recovery.

Several reports of successful introgression of genes in to hybrid rice parental lines using MABB are available including the report of transfer of wide compatible gene S5ⁿ in to a common female parent of several rice hybrids (IR58025B, maintainer of WA-CMS line)²⁴, and into japonica variety and developed indica compatible japonica lines but encountered sterility with certain japonicas¹¹. Deployment of wide compatible gene in male sterile lines (A lines) through maintainer lines (B lines) could be considered as the right strategy in the context that only a few indica based universal A/B lines are routinely used as female in commercial hybrid development while male restorers are numerous. However, considering the grain quality concerns of japonicas which hinder its use in diversification of female parents, the only way left to exploit inter-subspecific heterosis is through development and use of genetically diverse male restorers with varying proportions of japonica genetic background. It has also been suggested that wide compatible varieties / germplasm when used as male exhibit positive effect on spikelet fertility in their hybrids with indica and japonica²⁷, underscoring the importance and need for transfer of wide compatibility trait in to male restorer parent. In the present study, wide compatible allele S5ⁿ was transferred in to CB174R, elite restorer male parent of a popular rice hybrid, CORH4.

Fertility restoration ability of CB174R was assessed across different rice growing seasons against a standard and stable restorer parent, KMR3, of another popular hybrid KRH2 through pollen and spikelet fertility levels. Significantly high mean fertility restoration levels in CB174R-derived hybrids over the KMR3-derived KRH2 in different environments established CB174R as a good and stable restorer which could be preferred for development of diversified restorers for hybrid rice breeding without any fertility restoration problems. Probing the allelic status at S5 in germplasm collections was carried out. Identification of germplasm carrying S5ⁿ was reported earlier in different rice collections using the functional marker with S5-Indel^18,24. However, the present study on molecular screening at S5 locus with S5-Indel and S5-MMS¹⁸ revealed seventeen genotypes harbouring neutral allele - S5ⁿ. and enriched this special class of germplasm such as Wide Compatible Varieties (WCVs). These WCVs of different genetic backgrounds could be considered as excellent genetic stocks/resources with direct application in genetic diversification and constitute diverse panel of germplasm with wide compatibility for developing heterotic gene pool(s) in IJ-hybrid rice breeding without test cross.

Recovery of restorer background was ensured in three dimensions such as (i) selection of Rf3 and Rf4 genes underlying fertility restoration through gene-linked microsatellite markers; (ii) selecting for restorer parent genome through genome-wide polymorphic SSRs as background selection; (iii) stringent phenotypic selections to ensure isolation of morphologically similar restorer lines having wide compatible alleles. Four introgressed lines possessing alleles for wide compatibility (S5ⁿ) and fertility restoration (Rf3 and Rf4) with > 94% of recurrent parent genome recovery and phenotypic similarity were obtained. The successful recovery of recipient parent genome in terms of phenotype was also evident from the observation that crossing of introgressed line (CB174R + S5ⁿ) with the female parent COMS23A showed complete fertility restoration level in the ‘re-constituted hybrid’ similar to original CORH4 hybrid produced with CB174R. As the fertility restoration of WA-CMS lines are controlled by major genes Rf3 and Rf4^{4, 28–29}, during MABB, we ensured that these two genes are selected in parallel using linked microsatellite marker while improving the CB174R for wide compatibility. This was particularly important because the donor parent showed low fertility restoration levels (25–30%) in the test cross hybrids produced with select WA-CMS lines (data not shown). Recovery of restorer background is important to avoid restoration related issues particularly when these lines are expected to undergo diversification with japonicas towards development of intermediate lines for use in inter-subspecific hybridization. Recovery of fertility restoration and grain quality characters with superior yield in introgressed wide compatible restorer lines are the significant achievement of this study in view of the fact that these traits are multigenic and are distributed across the genome.

During the evaluation of wide compatibility in terms of hybrid fertility, we observed significant increase in pollen fertility percent, spikelet fertility percent and number of filled grains / panicle (i.e seed set) among the IJ hybrids produced with improved restorer (CB174R carrying S5ⁿ) compared to control hybrids derived using original restorer in the crosses with five japonica testers (Fig. 4a), leading to significant increase in mean single plant yield among I/J hybrids of improved restorer (Table 7b, Fig. 4b). Such restorers could be proposed to be termed as ‘Wide Compatible Restorers” and also as ‘Universal Restorers of Choice’ for several applications viz., genetic diversification, diversified restorer with wide compatibility, improved hybrid rice parental line with varying proportions of japonica genome, parent for commercial three line hybrids system etc. The effect of wide compatible allele S5ⁿ in increasing the hybrid fertility had been well demonstrated through the use of ‘Wide Compatible Varieties (WCVs)’ in a bridge cross with IJ test hybrids in improving the hybrid fertility and wide compatibility^27,30,31. However, the varying levels of pollen and spikelet fertility observed among the hybrids studied may be attributed to the effects of presence of modifier genes, non-allelic interactions and different genetic background etc^24,32–35. Alternatively, we opine that other gene(s) could also play a role in manifestation of hybrid fertility or wide compatibility. Candidate gene identification through functional genomics would elucidate the role of other gene(s). While the improvement in wide compatibility through hybrid fertility and yield were observed due to the introgression of S5ⁿ in restorer parent, the introgressed restorer parent showed similar fertility restoration levels as that of original restorer in the re-constituted rice hybrid CORH4 thus confirming the maintenance of similar fertility restoration ability in the introgressed restorer CB174R and successful MAS thorough foreground selection for Rf genes and background recovery coupled with stringent phenotypic selection. The present study clearly demonstrated that embryosac sterility that underlies hybrid sterility in IJ crosses could be overcome by introgression of major gene for wide compatibility in to restorer lines.

With japonica testers, the inter-subspecific indica x japonica hybrids (IJ hybrids) were produced involving introgressed and original restorer. It was found that all the hybrids derived from introgressed restorer were found to be significantly superior in their agronomic performance in terms of yield, number of filled grains per panicle compared to the ‘control hybrids’ (Fig. 4b, Table 7a) which could be due to an increase in the compatibility between the two subspecies through the increase in hybrid fertility and seed set. It also suggested an indirect role for S5ⁿ in yield improvement similar to that was observed in the introgressed maintainer lines of rice²⁴. In addition to yield, positive significant differences were also observed for yield component traits such as number of tillers, total number of spikelet and panicle length in certain hybrids, suggesting the role of genetic background of japonica testers plays a key role in expression or suppression of component trait(s). Further studies are warranted to probe the relationship between superior trait expressions with heterosis in these hybrids.

Four backcross-derived introgressed lines were identified through phenotypic selection and MABB. These lines were subjected to phenotypic evaluation for various agromorphological characters. Two lines designated as WCR02 and WCR03 recorded highest percent yield increase over the recipient parent, CB174R. These lines were confirmed to be similar to recipient parent in morphology and grain quality and found to be superior with earliness (WCR01), longer panicle (WCR02) and more filled grains (WCR02) compared to recipient parent. Such superiority could emanate from the donor segments along side of wide compatible gene, S5. The developed WCR lines in the background of CB174R would constitute excellent genetic resources in hybrid rice breeding as CB174R with stable restoration ability to wide range of WA-CMS lines is preferred for its utility in diversification and development of new restorers in addition to be used as broad spectrum universal restorer in hybrid rice development. These WCRs could also act as the potential donor for wide compatibility in R-line (restorer-line) breeding programmes.

The role of wide compatibility varieties in overcoming crossability barriers and embryo sac sterility problems in IJ hybrids through increasing the pollen and spikelet fertility in a conventional cross / bridge-cross has been well documented during the past. Development of new parental lines through genetic diversification by intentional crossing of indicas with japonicas requires use of WCVs for bridge cross. Identification of gene (S5ⁿ) conferring compatibility by overcoming hybrid sterility in indica-japonica crosses and availability of functional marker have opened up smart ways of parental line improvement for wide compatibility and of by-passing conventional bridge cross-route in development intermediate IJ lines for use in IJ hybrid development. In the present study, we had improved indica restorer for compatibility-with-japonica and improved the fertility levels of inter-subspecific hybrids while eliminating the need to use time/resource consuming additional bridge-cross with a wide compatible variety (WCV) to overcome incompatibility. Allele mining in rice germplasm for wide compatible gene is needed to discover and to isolate superior allelic variants for deployment in hybrid rice breeding. “Wide Compatible Restorers (WCR)” developed in the present study would constitute excellent genetic stocks for deployment in genetic diversification studies for development of diversified restorer lines with japonica genetic base. Efforts are further required to develop “japonica-diversified” restorers with varying proportions of japonica genetic background for high heterosis levels in IJ hybrids through hybrid rice breeding.

Research involving plants

Experimental research and field studies on plants (either cultivated or wild), including the collection of plant material, and use of plants in the present study complies with international, national and/or institutional guidelines.

Plant materials

Akshaydhan, a medium duration variety released by Indian Institute of Rice Research, Hyderabad was previously identified to harbor wide compatible gene S5ⁿ¹⁸ was used as donor parent. CB174R, is an indica type stable restorer line of the popular, public bred rice hybrid CORH4 released by Tamil Nadu Agricultural University, Coimbatore was used as recipient parent. It is a high yielding restorer parent of released hybrid CORH4. CB174R is a well-adapted, medium duration restorer line with medium slender grain type. It has excellent grain and cooking qualities and was developed at Department of Rice, Tamil Nadu Agricultural University, Coimbatore, India and most commonly subjected restorer for MAS like improvement of resistance to blast disease etc³⁶. The present study was taken up during 2013–2017 at this department and additional / confirmatory analyses were carried out during 2022–2023.

Crossing scheme

Akshaydhan was used as male parent and crossed with female parent, CB174R. The F₁s were obtained and confirmed both at morphological and molecular level. The “true’ F₁s obtained were backcrossed to CB174R to obtain BC₁F₁s and assayed for the presence of target gene in heterozygous condition using PCR based functional marker S5-InDel. The positive plants were further screened with SSR markers linked to fertility restoring genes Rf3 and Rf4. The selected plants were advanced to BC₁F₂ by selfing and then screened with gene-linked marker to identify the plants homozygous for S5ⁿ. These plants were selfed to obtain next generation till BC₂F₅ with screening for the target gene and fertility restoration background with microsatellite markers. Four homozygous lines (WCR1, WCR2, WCR3 and WCR4) possessing stable fertility restoration, yield superiority over original restorer and grain quality were isolated in advanced generation.

Marker-assisted selection for wide compatibility and fertility restoration

DNA was extracted from fresh leaf tissues of parents, F₁s and backcross-derived plants by following the standard protocol³⁷. The PCR was performed with S5-InDel / S5-MMS marker to identify the presence of wide compatible allele in the F₁ and backcross generations¹⁸ and with microsatellite markers (DRRM RF3-5, RM6100) linked to fertility restorer genes³⁸. Genome-wide SSR markers were employed in background genotyping.

Evaluation of gene-introgressed lines for hybrid fertility / wide compatibility

Homozygous BC₂F₅ lines carrying S5ⁿ allele in homozygous state with maximum recurrent parent genome (indica type) from backcross population of CB174R x Akshaydhan was selected and used for crossing with five different japonica testers viz., Blue bonnet 50, Hawn Cam, Pulut Todopi, DI-177 and Hinohikari. The japonicas were used as female and introgressed lines as male. For comparing the fertility levels, same set of japonica lines were crossed with original parent CB 174R (control). The F₁s’ seeds of control and introgressed line were collected separately and raised to evaluate compatibility and spikelet fertility. Pollen fertility was studied by taking three randomly chosen spikelet covering the whole panicle (bottom, middle and top) of the every two panicles of each randomly selected three plants in F₁ having fully matured anthers were collected in a vial containing 70 per cent alcohol. Two to three anthers from each spikelet were placed together on a glass slide, squashed and pollen grains were stained with 1 per cent iodine-potassium iodide stain (the stain was prepared by dissolving 1 g iodine and 2 g of potassium iodide in 100 ml of distilled water) and observations for fertile pollen grains were recorded under stereo microscope in three microscopic fields. The percentage of fertile pollen to the total pollen grains observed was worked out and expressed in percentage. The mean percentage of spikelet fertility was obtained from percentage of filled spikelet to the total number of spikelets in the primary panicle of selected plants. The student ‘t’ test was performed in hybrids of both normal and introgressed lines and their significance were calculated.

Evaluation of effect of gene-introgression on the yield and its component traits of hybrids involving japonicas

For comparing the effect of gene introgression on yield and other components, the F₁s developed using improved restorer and original restorers with same set of japonica lines were raised separately along with parents. Thirty-day-old seedlings of parents, F₁s were transplanted at 20 x 20 cm spacing. The recommended package of practices was followed to obtain good standing crop. Observations were recorded on quantitative characters viz., days to 50 per cent flowering, plant height (cm), number of productive tillers/plant, panicle length (cm), number of filled grains per panicle and single plant yield (g).

Evaluation of agro-morphological traits

Thirty-day-old seedlings of parents, F₁s and backcross progenies were transplanted at 20 x 20 cm spacing. The recommended package of practices was followed to obtain good standing crop. Observations were recorded on quantitative characters viz., days to 50 per cent flowering, plant height (cm), number of productive tillers/plant, panicle length (cm), total number of spikelets per panicle, percent spikelet fertility, number of filled grains per panicle, 100 seed weight (g) and single plant yield (g).

Acknowledgement

We acknowledge and thank the Department of Biotechnology (DBT), Government of India, New Delhi for financial support through competitive grant under Rapid Grant for Young Investigator (RGYI) mode (Grant No BT/PR6091/GBD/27/376/2012) to the first author. Authors dedicate this work to Late Dr. S. Robin, Former NAAS Fellow, and Professor and Head of Department of Rice, Tamil Nadu Agricultural University (TNAU), Coimbatore who was also Co-PI of this project and gratefully acknowledge him for providing all the facilities for execution of this research work, and for his encouragement and support.

Financial support:

Department of Biotechnology (DBT), Government of India, New Delhi for financial support through competitive grant under Rapid Grant for Young Investigator (RGYI) mode (Grant No BT/PR6091/GBD/27/376/2012)

Author contributions

KS carried out conceptualization of the project and funding acquisition, investigation, project management, planning and execution of the project and writing the manuscript. SM involved in experiment designing, technical supervision and execution, data analysis. SR and MU involved in conducting experiments, data collection and analysis. MS involved in data preparation, analysis / representation and improvement of the manuscript.

Competing interests

The authors declare no competing interests. KS’s work was funded by DBT, Govt of India and no competing interest between funding agency and grantee.

Additional information

Correspondence and requests for materials should be addressed to SM and KS.

Data availability statement

The datasets used and/or analysed during the current study available from the corresponding author on reasonable request.

Indiastat (www.indiastat.com), (2020–2021).
Virmani, S. S. Hybrid Rice. in Advances in Agronomy vol. 57, 377–462 (1996).
Ponnuswamy, R., Singh, A.K., Raman, M.S. et al. Conversion of partial restorer Swarna into restorer by transferring fertility restorer Rf gene(s) through marker assisted back cross breeding (MABB) in rice. Sci Rep 10, 1101 (2020). https://doi.org/10.1038/s41598-020-58019-1
Revathi, P. et al. Efficiency of molecular markers in identifying fertility restoration trait of WA-CMS system in rice. Indian J. Gene. Plant Breed. 73(1), 89–93 (2013).
Yuan, L. & Virmani, S. Status of hybrid rice research and development. In Hybrid rice (International Rice Research Institute, Manila, Philippines), 7–24 (1988).
Kato, S., Kosaka, H. & Hara, S. On the affinity of rice varieties as shown by fertility of hybrid plants. Bull. Sci. Fac. Agric. Kyushu. Univ. 3, 132–147 (1928).
Govindaraj, K. & Virmani, S. S. Genetics of fertility restoration of ‘WA’ Type cytoplasmic male sterility in rice. Crop Sci. 28(5), 787–792 (1988).
Bharaj, T. S., Bains, S. S., Sidhu, G. S. & Gagneja, M. R. Genetics of fertility restoration of ‘Wild Abortive’ cytoplasmic male sterility in rice (Oryza sativa L.). Euphytica 56, 199–203 (1991).
Zhang, G., Bharaj, T. S., Lu, Y., Virmani, S. S. & Huang, N. Mapping of the Rf3 nuclear fertility-restoring gene for WA cytoplasmic male sterility in rice using RAPD and RFLP markers. Theor. App. Genet. 94, 27–33 (1997).
Zhang, Q. Y., Liu, Y. G., Zhang, G. Q. & Mei, M. T. Molecular mapping of the fertility restorer gene Rf4 for WA cytoplasmic male sterility in rice (Article in Chinese). Yi ChuanXue Bao. 29(11), 1001–1004 (2002).
Guo, J., Xu, X., Li, W. et al. Overcoming inter-subspecific hybrid sterility in rice by developing indica-compatible japonica lines. SciRep 6, 26878 (2016). https://doi.org/10.1038/srep26878
Ikehashi, H. & Araki, H. Genetics of F1 sterility in remote crosses in rice. In Rice Genetics: Proceedings of the First Rice Genetics Symposium (International Rice Research Institute), 119–130 (1986).
Song, X., Qiu, S., Xu, C., Li, X. & Zhang, Q. Genetic dissection of embryo sac fertility, pollen fertility and their contributions to spikelet fertility of intersubspecific hybrids in rice. Theor. Appl. Genet. 110, 205–211 (2005).
Yanagihara, S. et al. Molecular analysis of the inheritance of the S-5 locus, conferring wide compatibility in indica/japonica hybrids of rice (Oryza sativa L.). Theor. Appl. Genet. 90, 182–188 (1995).
Chen, J. et al. A triallelic system of S5 is a major regulator of the reproductive barrier and compatibility of indica-japonica hybrids in rice. Proc. Natl Acad. Sci. USA 105, 11436–11441 (2008).
Ji, Q. et al. Two sequence alterations, a 136 bp InDel and an A/C polymorphic site, in the S5 locus are associated with spikelet fertility of indica-japonica hybrid in rice. J. Genet. Genom. 37, 57–68 (2010).
Du, H., Ouyang, Y., Zhang, C. & Zhang, Q. Complex evolution of S5, a major reproductive barrier regulator, in the cultivated rice Oryza sativa and its wild relatives. New Phytol. 191, 275–287 (2011).
Sundaram, R. M. et al. Development and validation of a PCR-based functional marker system for the major wide-compatible gene locus S5 in rice. Mol. Breeding 26, 719–727(2010).
Revathi, P. et al. Molecular screening for the presence of wide compatibility gene S5 neutral allele in the parental lines of hybrid rice. Indian J. Genet.70(4): 373–376(2010).
Yang, J. et al. A killer-protector system regulates both hybrid sterility and segregation distortion in rice. Science 337, 1336–1340 (2012).
Revathi, P. et al. Marker assisted selection for S5 neutral allele in inter-subspecific hybridization of rice. Mol. Plant Breed 6(1):1–7 (2015)
Revathi, S. et al. Genetics of wide compatible gene and variability studies in rice (Oryza sativa L.). J. Genet.95: 463–467 (2016)
Priyadarshi, R. et al. Molecular stacking of wide compatibility gene, S5 n and elongated uppermost internode (eui) gene into IR 58025B, an elite maintainer line of rice. J. Plant Biochem. Biotechnol.26, 425–435 (2017).
Priyadarshi, R. et al. Marker-Assisted Improvement of the Elite Maintainer Line of Rice, IR 58025B for Wide Compatibility (S5ⁿ) Gene. Front. Plant Sci.9, 1051 (2018).
Sruthi, K. et al. Identification of stable restorer lines developed through inter-sub‐specific hybridization in rice (Oryza sativa) using multi‐trait stability index. Plant Breeding143, 105–119 (2023)
Ouyang, Y., Chen, J., Ding, J. & Zhang, Q. Advances in the understanding of inter-subspecific hybrid sterility and wide-compatibility in rice. Chin. Sci. Bull. 54, 2332–2341 (2009).
Vijaya Kumar, C. H. M., Ahmed, M. I., Viraktamath, B. C.&Ramesha, M. S. Identification and Utilization of wide compatibility gene in rice. Indian J. Genet. 59(2): 139–148(1999).
Zhang,Q.Y., Liu, Y.G., Zhang, G.Q & Mei, M.T. Molecular mapping of the fertility restorer gene Rf-4 for WA cytoplasmic male sterility in rice. Yi Chuan Xue Bao. 29(11):1001–4. Chinese. PMID: 12645264 (2002).
Sattari, M. et al. Development and use of a two-gene marker-aided selection system for fertility restorer genes in rice. Euphytica 153, 35–42 (2007).
Vijaya Kumar, R. V. & Virmani, S. S. Wide compatibility in rice (Oryza sativa L.). Euphytica 64, 71–80 (1992).
Singh, S. P. et al. Identification of simple sequence repeat markers for utilizing wide-compatibility genes in inter-subspecific hybrids in rice (Oryza sativa L.). Theor Appl Genet 113, 509–517 (2006).
Kubo, T. & Yoshimura, A. Epistasis underlying female sterility detected in hybrid breakdown in a Japonica Indica cross of rice (Oryza sativa L.). Theor Appl Genet 110, 346–355 (2005).
Kubo, T. & Yoshimura, A. Epistasis underlying female sterility detected in hybrid breakdown in a Japonica Indica cross of rice (Oryza sativa L.). Theor Appl Genet 110, 346–355 (2005).
Kubo, T., Yamagata, Y., Eguchi, M. & Yoshimura, A. A novel epistatic interaction at two loci causing hybrid male sterility in an inter-subspecific cross of rice (Oryza sativa L.). Genes Genet. Syst. 83, 443–453 (2008).
Kumar, S. & Chakrabarti, S. N. Genetic and cytogenetic analysis of spikelet sterility in indica x japonica crosses in rice (Oryza sativa L.). Indian J. Genet. Plant Breed. 60, 441–450 (2000).
Ramalingam, J. et al. Improvement of Stable Restorer Lines for Blast Resistance through Functional Marker in Rice (Oryza sativa L.). Genes11, 1266 (2020).
Zheng, K., Subudhi, P. K., Domingo, J., Maopanty, G. & Huang, N. Rapid DNA isolation for marker assisted selection in rice breeding. Rice Genet. Newsl. 12: 255–258(1995).
Balaji Suresh, P. et al. Fine mapping of Rf3 and Rf4 fertility restorer loci of WA-CMS of rice (Oryza sativa L.) and validation of the developed marker system for identification of restorer lines. Euphytica 187, 421–435 (2012).
Sheeba, N.K. et al. Validation of molecular markers linked to fertility restorer gene(s) for WA-CMS lines of rice. Euphytica 167, 217–227 (2009). https://doi.org/10.1007/s10681-008-9865-4

Table 1

Evaluation of recipient restorer, CB174R, for fertility restoration among rice hybrids involving CMS lines and CB174R across rice growing seasons/ecologies. # Fertility evaluation carried out during rice growing ecologies predominantly distinguished by the sowing seasons; ^ as recorded in the popular F₁ hybrid, KRH2, involving IR58025A and KMR3R
A x R hybrids / Fertility^#	Pollen fertility (%)					Spikelet fertility (%)
A x R hybrids / Fertility^#	June-July	Aug-Sep	Dec-Jan	Apr-May	Over season mean	June-July	Aug-Sep	Dec-Jan	Apr-May	Over season mean
IR 58025A/ CB174R	92.4	95.6	94.4	90.8	93.3**	87.0	89.6	89.8	88.6	88.8**
IR 58029A/ CB174R	93.8	94.0	91.8	89.0	92.2	86.2	87.2	85.0	84.2	85.7
COMS23A/ CB174R	93.2	95.6	92.2	88.6	92.4	89.0	90.8	86.8	83.6	87.6**
TNAU CMS2A/ CB174R	97.8	98.4	98.0	90.8	96.3**	91.6	92.8	92.0	84.0	90.1**
Mean	94.3	95.9	94.1	89.8	93.6**	88.5	90.1	88.4	85.1	88.1**
IR58025A/ KMR3R (check)^	92.8	94.6	90.2	85.4	90.8	86.6	89.5	87.6	80.6	86.1
SEd	0.911	0.607	0.536	0.517	0.643	0.409	0.447	0.611	0.394	0.465
CD@5%	2.573	1.713	1.513	1.459	1.815	1.154	1.263	1.725	1.112	1.314
CV(%)	2.167	1.418	1.284	1.299	1.542	1.037	1.109	1.548	1.046	1.185

Table 2

Details of gene-specific functional marker and gene-linked microsatellite markers used in foreground selection during marker assisted backcross breeding
Molecular marker	Type	Gene / trait	Chromosome location	Marker inheritance	Primer sequence (5’ – 3’) (Forward & Reverse)	Product size (bp)	Reference
S5 InDel	Gene-specific / Functional	S5 – Wide compatibility	6	Co-dominant	CCTACGTTTGACTGCCTGCCTG CTACACGCGGCTTCGGGAAAGC	281 (S5ⁿ – Neutral / wide compatible allele) 417 (S5ⁱ / S5^j – indica / japonica incompatible allele)	(18)
DRRM RF3-5	Microsatellite / SSR	Rf3 – Fertility restoration	1	Co-dominant	GATGGCACAGCTTCAGAACA CTAATTCTGGGCGAGCAAAG	210 bp (Rf3 allele)	(38)
RM6100	Microsatellite / SSR	Rf4 – Fertility restoration	10	Co-dominant	TCCTCTACCAGTACCGCACC GCTGGATCACAGATCATTGC	190 bp (Rf4 allele)	(39)

Table 3

Chromosome-wise details of SSR markers used for screening among parental lines and list of polymorphic markers used for recipient background selection
Chromosomal location	No. of markers employed for parental screening	No. of identified polymorphic markers	List of polymorphic markers
1	11	7	RM11865, RM3412, RM10936, RM11278, RM5931, RM3362, RM315
2	13	9	RM6938, RM7033, RM12469, RM211, RM279, RM13155, RM6942, RM6933, RM14140
3	11	8	RM14250, RM3202, RM14931, RM5928, RM15630, RM15679, RM16153, RM486
4	12	7	RM335, RM16606, RM16652, RM16649, RM16913, RM131, RM559
5	14	7	RM159, RM267, RM3777, RM18222, RM5592, RM18857, RM5973
6	17	10	RM540, RM19426, RM510, RM19660, RM20060, RM20158, RM20458, RM20473, RM8242, RM400
7	11	4	RM6697, RM427, RM429, RM5720
8	12	5	RM2584, RM544, RM10, RM6699, RM5720
9	10	5	RM219, RM24038, RM460, RM288, RM215
10	14	6	RM244, RM222, RM171, RM269, RM228, RM25262
11	14	6	RM286, RM25970, RM26086, RM26329, RM181, RM144
12	15	6	RM27406, RM27882, RM313, RM28157, RM17, RM3917
Total	154	80	RM27406, RM27882, RM313, RM28157, RM17, RM3917

Table 4

Functional marker-aided screening and identification of ‘S5ⁿ-carrying wide compatible varieties’ in rice germplasm. N- neutral allele (S5ⁿ), I/J- either *indica* (S5ⁱ) or *japonica* (S5^j) allele
S. No.	Genotype	Allelic status	S. No.	Genotype	Allelic status
1	Asse-y-pung	N	27	Akshaydhan	N
2	IRGC 5441	I/J	28	CB 203R	I/J
3	Khao Kap Sang	N	29	CB 174R	I/J
4	Peek	N	30	CO 15	I/J
5	Pato de gallinozoy	N	31	CO 19	I/J
6	Blue bonnet-50	I/J	32	CO 21	I/J
7	Nira	N	33	CO 23	N
8	Cuba 65	N	34	CO 25	I/J
9	PI 303646	N	35	CO 26	I/J
10	Iguapecateto	N	36	CO 28	I/J
11	Bomalasang	N	37	CO 35	I/J
12	Palawan	N	38	CO 36	I/J
13	Hawn Cam	I/J	39	CO 37	I/J
14	Labella	I/J	40	CO 38	I/J
15	Bella Patana	N	41	CO 39	I/J
16	Pulut Sam paka	N	42	CO 40	I/J
17	Puluttodo pi	I/J	43	CO 41	I/J
18	Khao do ngoi	N	44	CO 42	I/J
19	D1-177	I/J	45	CO 43	I/J
20	D4-148	I/J	46	CO 44	I/J
21	Indane	N	47	CO 45	I/J
22	Hinohikari	I/J	48	CO 46	I/J
23	Pusa Basmati 1	I/J	49	CO 47	I/J
24	IR 36	I/J	50	CO (R) 49	I/J
25	IR 64	I/J	51	CO (R) 50	I/J
26	Nagina 22	N	52	CO (R) 51	I/J

Table 5

Details of plant selection, foreground / background selection, and advancement during marker assisted backcross breeding program. *-details given in Supplementary Table 1.
A. F₁ screening
Cross	No. of F₁ plants screened				No. of ‘true’F₁ plants positive for S5ⁿ
CB174R x Akshaydhan	50				16
B. First Backcross (BC₁F₁)
Cross	No. of BC₁F₁s screened	No. of S5ⁿ positive BC₁F₁ plants		No. of double positive BC₁F₁s (S5ⁿ + Rf3)		No. of triple positive BC₁F₁s (S5ⁿ + Rf3 + Rf4)
CB174R / (CB174R x Akshaydhan)	268	72		38		26
C. Second Backcross (BC₂F₁)
Cross	No. of BC₂F₁s screened	No. of S5ⁿ positive BC₂F₁ plants		No. of double positive BC₂F₁s (S5ⁿ + Rf3)		No. of triple positive BC₂F₁s (S5ⁿ + Rf3 + Rf4)
CB174R // (CB174R x Akshaydhan)	462	176		141		42
D. Background selection in Backcross 1
Generation	No. of plants screened	No. of polymorphic SSR markers assayed		No. of SSR markers which are homozygous for CB174R alleles		No. of plants selected with high genome recovery of > 60% and used for backcross 2
BC₁F₁(CB174R / (CB174R x Akshaydhan))	26	80		48		10*
E. Details of Background selection in Backcross 2 & selfed BC₂F₂
Generation	No. of plants screened	No. of polymorphic SSR markers assayed		No. of SSR markers which are homozygous for CB174R alleles		No. of plants selected with high genome recovery of > 80% and used for selfing
BC₂F₁(CB174R // (CB174R x Akshaydhan))	42	80		64		6
BC₂F₂ (CB174R / (CB174R x Akshaydhan) upon selfing)	386	80		74		4
F. Details of recurrent parent genome recovery in BC₂F₂
BC₂F₂ plants	No. of SSR makers screened		No. of SSR markers homozygous for CB174R alleles			Recurrent parent genome recovery (%)
R3-12	80		75			94.0
R3-39	80		76			95.0
R3-114	80		77			96.0
R3-121	80		77			96.0

Table 6

Comparison of hybrid fertility percentage in I x J crosses involving normal (CB174R) and introgressed restorer (CB174R + S5ⁿ) with *japonica* testers.*significance at 5% level, ** significance at 1% level; PFF and PSF of the parent CB174R is 73.40 and 88.57, respectively.
Genotype /cross	Per cent pollen fertility (PPF)			Per cent spikelet fertility (PSF)
Genotype /cross	CB174R	CB174R + S5ⁿ	Per cent increase	CB174R	CB174R + S5ⁿ	Per cent increase
Blue bonnet – 50 x	45.72	70.18**	53.50	56.15	75.44**	34.35
Hawn cam x	37.30	41.02*	9.97	7.75	29.34**	278.58
Pulut todi pi x	65.31	80.10*	22.65	72.37	83.36*	15.19
D1-177 x	59.30	76.93**	29.73	69.86	86.41**	23.69
Hinohikari x	57.58	59.74**	3.75	62.02	84.30**	35.92
Mean	53.04	65.59**	23.92	53.63	71.77**	77.55

Table 7

a. Comparative evaluation of *indica* x *japonica* crosses involving *japonica* testers with original restorer (CB 174R) and introgressed restorer (CB174R + S5ⁿ) for various agronomic traits. `*significance at 5% level, ** significance at 1% level.
Cross / characters		Plant height (cm)	Total number of tillers	Panicle length (cm)	Total number of spikelets	Number of filled grains	Single plant yield (g)
Blue Bonnet – 50 x	CB 174R	108.68	9.75	25.40	209.50	116.75	29.15
Blue Bonnet – 50 x	CB 174R + S5ⁿ	111.90	10.00	26.23	207.50	157.00**	32.53*
Hawn cam x	CB 174R	135.14	8.50	33.50	162.50	12.50	13.50
Hawn cam x	CB 174R + S5ⁿ	135.50	9.00	32.45	177.00	51.00**	20.75**
Pulut Todipi x	CB 174R	129.20	8.40	29.98	198.80	143.00	25.08
Pulut Todipi x	CB 174R + S5ⁿ	133.04	9.00	30.02	274.60*	229.00**	38.88**
DI-177 x	CB 174R	136.60	10.20	27.82	237.80	166.40	27.50
DI-177 x	CB 174R + S5ⁿ	133.50	13.25*	30.10	292.00*	252.50**	39.00**
Hinohikari x	CB 174R	110.87	14.67	29.57	270.67	167.00	28.27
Hinohikari x	CB 174R + S5ⁿ	114.25	13.75	31.40**	260.00	219.00**	36.33**
CB 174R		133.25	15.00	30.20	184.50	176.00	30.80

Table 7

b. Mean per cent yield increase in inter-subspecific hybrids (involving *japonicas* as female parent and introgressed restorer CB174R with S5ⁿ as male *indica* parent) over control hybrids (CB 174R without S5ⁿ)
Genotypes/ crosses	Single plant yield of CB 174R derived hybrids (control) (g)	Single plant yield of CB 174R + S5ⁿ derived hybrids (introgressed) (g)	Per cent increase in yield
Blue Bonnet-50	29.15	32.53	11.59
Hawn Cam	13.50	20.75	53.70
Pulut Todopi	25.08	38.88	55.02
D1-177	27.50	39.00	41.82
Hinohikari	28.27	36.33	28.51
Mean	24.70	33.50	38.13

Table 8

Phenotypic evaluation of introgressed, wide compatible restorer lines for fertility and agronomic traits. *Recipient parent; GRP-Genome Recovery Percentage; PPF-Per cent pollen fertility; PSF-Per cent spikelet fertility; DFF-Days to fifty percent flowering; Days to maturity; PH-Plant height; NPT-No. of productive tillers; PL-Panicle length; NFG-No. of filled grains per panicle; HGW- Hundred grain weight; SPY- Single plant yield.
Introgressed lines	GRP (%)	PPF (%)	PSF (%)	DFF	DM	PH (cm)	NPT	PL (cm)	NFG	HGW (g)	SPY (g)	Yield increase over recipient parent (%)
CB174 WCR-01	94.5	94.3	96.2	100	129	105.6	17.2	23.5	212.4	1.83	31.80	3.3
CB174 WCR-02	95.0	98.9	97.8	106	136	128.6	15.8	28.6	298.6	1.56	37.60	22.0
CB174 WCR-03	95.0	96.6	94.2	108	139	134.3	17.2	24.4	240.8	1.73	34.70	12.7
CB174 WCR-04	96.0	92.8	94.8	113	142	158.6	18.0	21.6	215.0	1.89	30.90	0.3
CB174R*	-	92.1	95.4	106	135	133.3	15.0	26.2	176.0	1.65	30.80	-

Table 9

Grain quality characteristics of introgressed wide compatible restorer lines of CB174R and their original parents/checks. HRR: Head rice recovery, KL: Kernal length (mm), KB: Kernal breadth (mm), L/B: Length and breadth ratio, ASV: Alkali spreading value, AC: Amylose content (%), GC: Gel consistency
Introgressed lines	HRR	KL	KB	L/B	ASV	AC	GC
CB174 WCR 01	60.4	5.82	1.89	3.1	5	26.23	25
CB174 WCR 02	62.2	5.64	1.91	3.0	5	25.83	24
CB174 WCR 03	57.8	5.91	1.94	3.0	5	26.50	24
CB174 WCR 04	56.6	5.30	1.98	2.7	4	27.12	25
CB174R	56.3	5.40	1.86	2.9	5	26.47	24
KMR3R	57.6	5.80	2.01	2.9	4	25.85	25
Akshaydhan	55.8	5.71	1.94	2.9	5	26.80	24

No competing interests reported.

SupplementaryTable1260124.docx

Download PDF

Version 1

posted

You are reading this latest preprint version

Marker assisted transfer of S5 gene to develop universal restorer with wide-compatibility for genetic diversification and realization of inter-subspecific heterosis by overcoming indica x japonica hybrid sterility in rice

Status:

Version 1

Abstract

Figures

INTRODUCTION

RESULTS

Evaluation of fertility restoration of recipient restorer CB174R

Molecular screening of rice germplasm and validation of gene specific marker in donor

Marker-assisted backcross breeding for wide compatibility and fertility restoration

Evaluation of gene-introgressed line for fertility restoration ability with male sterile line

Phenotypic evaluation of wide compatible restorer lines

DISCUSSION

CONCLUSION

MATERIALS AND METHODS

Research involving plants

Plant materials

Crossing scheme

Marker-assisted selection for wide compatibility and fertility restoration

Evaluation of gene-introgressed lines for hybrid fertility / wide compatibility

Evaluation of agro-morphological traits

Declarations

References

Tables

Additional Declarations

Supplementary Files

Status:

Version 1