Banana Wilt caused by Xanthomonas vasicola pv. musacearum (Xvm), has emerged as a significant threat to food security in eastern DR Congo (Kivu). Currently, the only means of combatting this biotic constraint is through best agricultural practices. The aim of this study was to evaluate the effectiveness of medicinal plants used in Kivu in inhibiting of Xvm. Three in vitro experiments were conducted at Uganda's National Agriculture Research Organization (NARO) laboratories and the International Institute of Tropical Agriculture (IITA) in Kivu. The bacterial samples were collected in banana cultivated in Kivu and isolated on Yeast Extract Peptone Agar (YPGA). Pure Xvm colonies were used for identification via Polymerase Chain Reaction (PCR) and greenhouse inoculation trials. A completely randomized design was used for the inhibition tests (1) on Mueller Hinton Agar (MHA) using disc diffusion with 10 extracts, (2) in liquid YPG Broth, and (3) on MHA using disc diffusion with 19 extracts. The first two trials used ten plant species extracts diluted in petroleum ether, while the third trial used 19 plant extracts diluted in methanol. After maceration, filtration, and solvent evaporation, 10mg of extract was diluted in 80 µl of distilled water + 10µl of Dimethylsulfoxide (DMSO). Ten µl of this solution was impregnated on perforated discs of Whatman filter paper. Zingiber officinale (ginger) and Ricinus communis (castor) were the most effective plant extracts in suppressing Xvm. Of the thirteen plant species identified as effective against the pathogen, the Myrtaceae and Euphorbiaceae families were the most represented.
Research Article
Exploring In Vitro Inhibition of the Causal agent of Banana Xanthomonas Wilt by Medicinal Plant Extracts sourced from North Kivu province, Eastern Democratic Republic of Congo.
https://doi.org/10.21203/rs.3.rs-4076940/v1
This work is licensed under a CC BY 4.0 License
You are reading this latest preprint version
Banana Xanthomonas Wilt
Methanolic extract
Phytochemical groups
Petroleum extract
The East African Great Lakes region accounts for more than 11% of the world's banana production. A wide range of varieties are cultivated, which are cooked, processed into beer, eaten as dessert, processed into flour and even biscuits [1]. Additionally, novel uses are emerging, e.g. the use of fiber extracted from the leaf sheaths, which is used to produce paper, hair extensions, or other artistic items [2, 3].
In 2018, bananas and plantains occupied 1.2 million hectares in the DRCongo alone, yielding 5.1 million tons [4]. Unfortunately, banana production has decreased by 20 to 60% in the last few decades in the DRCongo [5], this due to abiotic and biotic constraints (pests and diseases) [6]. The biotic constraints primarily include nematodes and weevils as pests, xanthomonas wilt, banana bunch top disease, fusarium wilt, and black leaf streak (BLS) [7]. Among these threats, BXW has a significant impact on banana production landscapes in the region due to its rapid spread [8].
The emergence of banana bacterial wilt in the Great Lakes Region has prompted all stakeholders in the banana value chain to take action, recognizing its dire implications for the region's economy and food security [9]. Xanthomonas wilt was first reported on enset (1968) (Ensete ventricosum) and banana (1974) in Ethiopia [10, 11]. In 2001, the disease was also reported in central Uganda and eastern DRCongo. By 2010, Rwanda, Kenya, and Burundi had also reported cases [12, 13, 14, 15, 16].
[17] suggest that if the disease is left uncontrolled within 10 years, banana production, can decrease by as much as 55%, compared to a BXW-free baseline scenario, resulting in economic losses of around 25 billion USD in Africa south of the Sahara. At the same time, the population at risk of hunger in countries that highly depend on bananas as a staple food is projected to increase by more than 4.6%.
The responsible of banana bacterial wilt, also known as Xanthomonas vasicola pv. musacearum (Xcm), is a serious threat to the food security of the Great Lakes region [16, 18, 19]. The bacterium is characterized by the production of a yellow exudate and circular colonies with a dome-shaped surface. It is gram-negative, positive for catalase and KOH, and does not reduce nitrate [20]. To date, the molecular characterization of the bacterium primarily uses the Primer coding for the general secretory protein D (GspDm), amplifying the 265-bp fragment of XvmgspD [21].
Unfortunately, no chemical formula is currently available to cure the disease, and chemical control of bacterial diseases is not economically viable in the field [22, 23, 24]. As a result, cultural practices which include early male bud or flower removal, sterilizing garden tools, controlling animal movement, and using the ‘Single Diseased Stem Removal (SDSR)’ method have been used as the only means of combating the disease [7, 25]. Additional methods for the elimination of Xvm bacteria on e.g. garden tools, or other surfaces could help in disease control. [26, 27, 28] have explored alternative measures using antibiotics and plant extracts in vitro and found that certain antibiotics and plant extracts from native Ethiopian plant species have the potential to inhibit the bacterium responsible for bacterial wilt in Ensete.
There is great potential for plant extract-based treatments, as shown in ethnobotanical research conducted in DRCongo [29, 30], e.g., in Kinshasa and Kasangulu [30, 31, 32], and in North and South Kivu [33, 34, 35]. These studies have identified numerous medicinal plant species from families such as Euphorbiaceae, Rubiaceae, Papilionaceae, Malvaceae, Lamiaceae, Fabaceae, Asteraceae, Caricaceae, Poaceae and Myrtaceae that are effective in controlling infectious diseases. Especially in the Euphorbiaceae, Myrtaceae and Asteraceae families an important number of species are used for their antibacterial proprieties [36, 37, 38]. These effects are attributed to the presence of an estimated 104 chemical components, including glycosidic, phenolic acids, coumarins, monoterpenoids, triterpenoids, diterpenoids, flavonoids, and 4α-methyl steroids [39]. As such, this study aimed to identify the plant species capable of inhibiting the growth of Xanthomonas vasicola pv. musacearum through in vitro experimentation, specifically targeting antibacterial species commonly used by traditional practitioners in Eastern Democratic Republic of Congo.
To identify medicinal plant species in Kivu's traditional medicine that can inhibit Xanthomonas vasicola pv. musacearum (Xvm), two complementary experimental sites were utilized. The first was the "National Agriculture Research Organization" (NARO) laboratory in Kawanda/Kampala, Uganda, while the second was the laboratory at the International Institute of Tropical Agriculture (IITA) Olusegun Obasanjo campus in Kalambo/Bukavu, eastern DRCongo.
Preparation of Inoculum
To isolate the bacterium, a portion of the pseudostem was collected from a diseased plant showing characteristic symptoms of bacterial wilt [40]. The collected organ was cleaned with 70% ethanol and a smaller 4 cm2 portion was ground in 9 ml of sterile distilled water to release the bacteria. 20 µl of the ground material was then inoculated onto a petri dish containing YPGA medium (Yeast extract, Peptone, Glucose, and Agar) [41]. The inoculated plates were incubated at room temperature for 48 hours. For colony purification, only pure yellow colonies were collected using a platinum loop and re-seeded onto YPGA. The inoculum was prepared by diluting pure colonies in sterile distilled water to an absorbance reading of 0.5 Optical Density (OD) at 600 nm wavelength using a nanodrop 2000c spectrophotometer [42], corresponding to 108 CFU Colony-Forming Units per ml (CFU/ml).
Extraction of Desoxyribose Nucelic Acide (DNA)
As per [43] protocol, the DNA extraction process involved purifying bacterial cells through centrifugation of colonies in a 1 ml tube at 6000 rpm for 10 minutes in TES buffer: Tris, Ethylene-Diamine-Tetraacetic acid (EDTA), and Sodium Dodecyl Sulphate (SDS). Furthermore, the proteins were denatured by heating the solution at 65°C in a water bath. Precipitation of the denatured proteins was achieved by adding 250µl of 7.5% concentrated ammonium acetate solution to the mixture, followed by keeping it on ice for 10 minutes and then centrifuging it at 13,000 rpm for 10 minutes. The resulting solution was collected and mixed with an equal volume of isopropanol to precipitate nucleic acids. Finally, the collected pellet was cleansed with ethanol and diluted in distilled water, ultimately constituting the nucleic acids (DNA).
Polymerase Chain Reaction (PCR)
The purified nucleic acid was used to identify the Xcm strain using the method described by [21]. The GspDm-F2 (GCGGTTACAACACCGTTCAAT) and GspDm-R3 (AGGTGGAGTTGATCGGAATG) Primers were specific to amplify a 265 bp DNA fragment from the isolated Xvm. The simplex PCR cycles consisted of (i) initial denaturation step at 95 _C for 10min; (ii) 25 cycles of denaturation at 94 _C for 30s, annealing at 60 _C for 90s,elongation at 72 _C for 90 s; then (iii) a final extension step at 60 _C for 30min.The amplicons were separated by electrophoresis in a 1% agarose gel in0.5X TBE buffer at 100 V for 45 min. Gels stained with ethidium bromide were visualized and images captured with the Vilber UV Transilluminator.
Inoculation of Shoots
For confirmation of Xvm identity, 1 ml of a solution containing 108 CFU/ml was injected into the main vein of the leaf of 60-days-old banana plants of the AAA-EAH cooking banana “Mbwazirume”. The inoculation was carried out in the greenhouse of the IITA Kalambo laboratory. The presence of chlorotic spots on the leaves, leaf yellowing/wilting, and yellow ooze/exudates were recorded at 48 hours, 10 days, and thereafter every 15 days after inoculation [16].
Inhibition Test
The inhibition test of Xcm was performed using perforated discs of sterile Whatman filter paper. These discs were soaked, for an hour, with 10µl of a solution containing 10 mg of plant extract, 10µl of Dimethyl Sulfoxide (DMSO), and 80 µl of sterile distilled water. Preparation of plant extracts involved diluting 62.5 g of dried plant powder in 250 ml of solvent (petroleum ether or methanol), followed by maceration, filtration, and solvent evaporation [44]. The viscous extract obtained was weighed and stored in sterile plastic bottles of 50 ml volume in the refrigerator at 4°C or immediately used for inhibition.
The diameter of inhibition was initially measured on Mueller Hinton Agar plates after inoculating the medium with 100 µl of 108 CFU/ml of Xvm for one hour. The extract-soaked discs were then placed on the agar. For the liquid medium Yeast Peptone Glucose (YPG), inhibition was measured using a nanodrop 2000c spectrophotometer at a wavelength of 600 nm. 10 µl of inoculum was added to 9 ml of YPG Broth medium, mixed an hour later with 1 ml of the plant extract solution, DMSO, and sterile distilled water [45].
In vitro Experiments
Two in vitro trials were conducted at the NARO to test 10 Petroleum Ether extracts of medicinal plants that are traditionally used in Kivu’s medicine for human bacterial infections. These 10 plant species were collected between 9 a.m. and 3 p.m. in the vicinity of the Kalambo IITA research center in D.R.Congo after the disappearance of dew. The species were: Allium sativum (Liliaceae) AS, Aloe Vera (Xanthorrhoeaceae) AV, Azadiracta indica (Meliaceae) AI, Bidens pilosa (Asteraceae) BP, Capsicum frutescens (Solanaceae) CF, Carica papaya (Caricaceae) CP, Persea americana (Lauraceae) PA, Ricinus communis (Euphorbiaceae) RC, Solanum lycopersicum (Solanaceae) SL, Tetradenia riparia (Lamiaceae) TR [46, 47].
These plant species were sent to the research center in Lwiro, South Kivu, for species identification. In the initial trial, MHA was used to assess the level of bacterial inhibition via diffusion on filter paper discs soaked in plant extracts. For the positive control two antibiotics (tetracycline and amoxicillin) was used, while distilled water with DiMethylSulfOxide (DMSO) was used as the negative control. This trial was conducted using a completely randomized experimental design featuring 13 treatments (comprising 10 plant extracts, 1 amoxicillin, 1 tetracycline, and 1distilled water + DMSO) in 3 replications. The second in vitro experiment carried out at the NARO, Uganda featured the same treatments as the previous trial. It was also conducted using a completely randomized design and utilized a YPG liquid culture medium (or Broth). The level of inhibition was measured by examining the turbidity (OD) of the medium at 600 nm using the NANODROP 2000c spectrophotometer, as detailed by [42].
At the IITA Kalambo research facility an additional trial was conducted to test inhibition of a list of plants known for their antibiotic properties collected in South Kivu [40, 41]. The test involved 19 methanolic extracts of the following plant species: Bidens pilosa (Asteraceae) BP, Citrus limon (Rutaceae) CL, Conyza sumatrensis (Asteraceae) CS, Eucalyptus eugenoides (Myrtaceae) EE, Euphorbia heterophylla (Euphorbiaceae) EH, Euphorbia hirta (Euphorbiaceae) EHi, Flower of Ageratum conyzoides (Asteraceae) ACf, Fruit of Ricinus communis(Euphorbiaceae) RCf, Gymnathemum amygdalinum (Vernionia amygdalina: Ndole) (Asteraceae) VA, Lantana camara (Verbenaceae) LC, Lantana trifolia (Verbenaceae) LT, Leaves of Ageratum conyzoides (Asteraceae) ACl, Leaves of Ricinus communis (Euphorbiaceae) RCl, Phyllantus niruri (Euphorbiaceae) PN, Piper nigrum (Piperacea) PNi, Psidium guajava (Myrtaceae) PG, Solanum aculeastrum (Solanaceae) SA, Tephrosia vogelii H. (Fabaceae) TV, rootstock of Zingiber officinale (Zingiberacea) ZO [46, 47]. The experiment was conducted using a completely randomized design with 21 treatments, which included 19 plant extracts, 1 tetracycline, and 1 distilled water + DMSO. The study was replicated 3 times. The Sisvar 5.6 software was used for analysis of variance, and the means were separated using the Tukey test at a significance level of 0.05.
Phytochemical Screening
For Alkaloids test, 20 mg was dissolved in 2% HCl and filtered with glass funnel. 1ml of Wagner’s reagent (1.27 g of iodine + 2 g of potassium iodide in 100 ml of distilled water) was added to 2ml of the filtrate. Brown solution was an indication for the presence of alkaloids [28, 48, 49, 50]. For flavonoids screening, 0.5 g was taken from plant extract and placed in test tubes. 10 ml of distilled water was added to test tube and mixed by shaking and filtered. Then 3 ml of the aqueous filtrate was mixed with 5 ml of ammonia (10%) added with 1 ml of concentrated sulphuric acid, which resulted in the formation of a yellow color for a positive test of flavonoids [48, 51]. To quantify phenolic compounds 2ml of the extract were mixed with 3–4 drops of 5% Ferric Chloride (FeCl3) solution. The formation of black color indicated the presence of phenols [28, 48, 51].
For terpenoids screening, 0.5 g of plant powder was filled in test tubes, the 10 ml of methanol was added and centrifuged.5 ml of the supernatant was mixed with 2 ml of chloroform added with 3 ml of sulfuric acid. The formation of the brown layer between the two solutions was confirmed the presence of terpenoids [48, 52]. Test for Saponins was completed with 1 gram of extract boiled in 5ml of distilled water, and shaken vigorously for five minutes. The persistence of the frothing confirmed the presence of saponin [48, 53]. For Tannins screening, 0.2 grams was dissolved in 5 ml of distilled water, heated in a water bath and filtered. Then2ml of 5% ferric chloride solution was added to 1ml of the filtrate. The blue color meant positive test of tannins [48, 53].
The PCR Results
The PCR results as illustrated in Fig. 1, confirmed the presence of Xvm in diseased banana leaves from Mahagi under code 32a (Fig.1), detected upon amplification of GspDm. This aligns with previous findings by [54], indicating the positive presence of Xvm in these samples. Thus, the bacterium used in these experiments is Xvm. For several years, researchers in the Great Lakes region have relied on the GspDm primer as a popular molecular biology tool to diagnose bacterial wilt [55]. The GspDm primer has proven to be effective in diagnosing bacterial wilt in the field, even without PCR amplification, as confirmed by the loop-mediated isothermal amplification (LAMP) method [56].
The first disease symptoms appeared 7 days after inoculation, with yellowing of the first/inoculated leaf as illustrated in Figure 2b. The second leaf showed symptoms after 18 days (Fig.2c), while all leaves wilted by the 36th day (Fig. 2d). Complete wilting of the plant was observed on the 47th day (Fig. 2e). Interestingly, symptoms appeared earlier on the plantlets compared to other studies. This could be due to the fact that the Xvm bacterium was more active in the high-altitude environment (1463 meters above sea level) with temperatures between 14° and 25°C as noted in [57] where the experiment was conducted. The bacterium only took 24 hours to grow in vitro on YPGA at Kalambo, whereas it took 72 hours at Kawanda in Uganda with temperatures are between 17° and 31°C as noted in Climate to Travel, [58]. The timing of symptom appearance was similar to the results of [54], who found that the first symptoms appeared as early as 12 days after inoculation and the latest at 35 days. In the same study, complete plant wilting occurred between day 46 and day 80 after inoculation. The development of bacterial wilt, which occurred from day 8 to day 47 in this experiment, could be explained by the fact that the tested variety was the susceptible highland cooking banana genotype ‘Mbwazirume’ (Musa AAA-EAH).
Plant extract yield by selected plant species.
In the first and second experiments, utilizing petroleum ether as a solvent, as shown in Figure 3, Aloe vera (9.44%), Capsicum frutescens (8.64%), and leaves of Ricinus communis (6.88%) exhibited high yields in plant extracts, while in the third experiment, using methanol as a solvent, illustrated in Figure 4, Psidium guajava (12.09%), leaves of Ricinus communis (10.72%), and Phyllanthus niruri (9.12%) demonstrated high productivity in plant extracts. The yield of plant extracts is influenced by various factors, including the type of solvent used and the duration of extraction [59]. Methanol is a well-known solvent for extracting numerous phytochemical groups and is recognized for its positive polarity, leading to good yields in extractions. It was observed that the extract yield from plant material was less than 13% (Figures 3 and 4)for all species studied when using a single maceration process. This was mainly due to the lack of specialized equipment for solvent recycling after evaporation. On the other hand, when a solvent recycling apparatus like Soxhlet was used, the extraction process was optimized, which took several days, and the extract yield increased to over 40% [60]. It is important to note that the yield of plants varies due to the age of leaves and plants, as well as environmental factors [61].
Inhibition and absorbance of plant extracts with petroleum ether at NARO Kawanda, Uganda.
Table 1: Zone of inhibition and absorbance (mm) for plant extracts assessed at NARO in Uganda.
The above results in table 1, indicate that only the extract of Ricinus communis’s leaves had antibacterial activity. The other tested species did not show any antibacterial activity. According to [28], the phytochemical groups present in Ricinus communis allow it to act differently on gram-negative bacteria species like Xcm. It can affect the cell wall, proteins, and DNA synthesis in different ways. The plant’s crude extract has a significant antibacterial power due to the presence of alkaloids, terpenoids, or polyphenols that inhibit the growth of some bacterial species. The observed inhibition can also be attributed to the hydrophobicity of the phytochemical compounds allowing them to disrupt the lipids of the bacterial cell membrane and mitochondrial membrane, thereby making the cell more porous to solutes and ions, leading to its imminent death. [28] observed an inhibition zone ranging from approximately 9 to 21 mm in leaves of R. communis on the same bacterium in Ethiopia, depending on the different concentrations used. However, as reported by [27], antibiotics are more effective than leaves of R. communis in inhibiting Xvm Bacteria.
Inhibition of the 19 methanolic extracts at IITA Kalambo in eastern DR Congo.
Table 2 : Zone of inhibition and absorbance (mm) for methanolic extracts.
The experiment conducted at IITA Kalambo using plant species collected in the Kivu region has expanded the list of medicinal plants from Kivu that are effective in controlling Xvm. Previously, only one extract, leaves of Ricinus communis RC as shown in Table 1, was known to be effective, but now 13 plants have been found to be effective (Table 2). Results in Table 2, indicate that the most effective plant was the extract of rootstock of Zingiber officinale ZO, which is locally known as Ginger. According to the Tukey test at 0.05, it was observed that the species of R. communis for leaves, T. vogelii and E. heterophylla exhibited a similar inhibition zone comparable to that of ZO (Table 2). Additionally, Three other plant species, namely Tephrosia vogelii and Ricinus communis (for its Fruit), displayed an inhibition zone similar to RCl, but distinct from that of ZO (Table 2). The rhizomes of this ZO plant are commonly used in the region as part of therapeutic beverages [62]. According to [63], Zingiber officinale (ginger) is as effective as the antibiotic streptomycin in inhibiting Xanthomonas oryzae pv. Oryzae [64] also found that ginger is more effective in inhibiting certain pathogenic bacteria (30mm diameter of inhibition) compared to antibiotics and could be used for developing broad-spectrum antibiotics. Although the mechanism of bacterial inhibition by ginger is not yet fully understood, the phytochemical screening of its extract revealed the presence of alkaloids, phenols, flavonoids, tannins, and terpenoids [65]. Flavonoids are known to inhibit various cellular processes in bacteria, while alkaloids inhibit ATP transport and substitute for some precursors of molecules necessary for bacterial development [66].
Phytochemical screening of the five most effective plant species
Table 3 : Result of phytochemical screening for the five most effective plant species.
|
Plant extract |
Alkaloids |
Flavonoides |
Phenolic |
Terpenoids |
Saponins |
Tannins |
|
Flower of A.conyzoides ACf |
+++ |
+ |
+++ |
+++ |
+++ |
+ |
|
Piper nigrum PNi |
+ |
+ |
+++ |
+ |
+++ |
+++ |
|
Frut of Ricinus communis RCf |
+++ |
+ |
+++ |
+ |
+ |
+++ |
|
Euphorbia heterophylla EH |
- |
- |
+++ |
+ |
+++ |
+ |
|
Tephrosia vogelii TV |
- |
|
+++ |
+++ |
- |
+++ |
|
Leaves of Ricinus communis RCl |
+ |
+++ |
+++ |
+ |
+ |
+++ |
|
Rootstockof Zingiber officinale ZO |
+ |
+ |
+++ |
+ |
- |
+++ |
+++ : Abundant ; + Moderate ; - Absent
Results presented in Table 3, indicate that all effective plant species found in this research share a rich amount of molecules from the phenol group, while molecules from the tannin and terpenoid groups are present in varying quantities. Phenol is a polar compound with antibacterial properties. Its mechanism of action involves denaturing bacterial cell proteins, which halts all protein-catalyzed metabolic activities [67]. Given that the antibiotic tetracycline used effectively inhibited this bacterium by also targeting proteins, it seems likely that phenol is one of the major compounds involved in this inhibition. Similar results to this research were obtained by [65] for Z. officinale; [28] for R. communis; [49] for E. heterophylla; [50] for T. vogelii; [68] for P. nigrum, and [69] for the flowers of A. conyzoide
The study underscores the promising antibacterial potential of 6 medicinal plants commonly used in Kivu against Xvm. Notably, Z. officinale and R. communis warrant special attention, while multiple species from the Euphorbiaceae and Myrtaceae families have also shown effectiveness in inhibiting Xvm. It's noteworthy that all of the plants with inhibiting properties were rich in phenol, indicating that protein denaturation could be a viable option for inhibiting the bacterium. Moving forward, further research should focus on the practical applications of these findings, e.g. to sterilize garden tools.
We confirm that this manuscript has not been published previously in any peer-reviewed journal, and it is not being considered for publication elsewhere. All co-authors have read and approved the final version of the manuscript.
Acknowledgments
This research was funded by the International Institute of Tropical Agriculture (IITA). Therefore, our thanks go to the IITA team that funded the completion through Canadian funds under the agreement Centre de Recherches pour le Développement international (CRDI).
Author Contribution
FM: Trial Management, data collection, analysis, writing and reviewAI: Writing and Review, LL: PCR analysis and interpretation, reviewGS: Microbiology (Isolation, culture and review)DD: Preparation of extracts, phytochemical screening and reviewLN: Supervision of Kalambo/IITA trials and reviewGB: Uganda's trials supervision and reviewGM: Analysis, Interpretation of results and review
- Marimo P, Caron C, Bergh IV, Crichton R, Weltzien E, Ortiz R. And Tumuhimbise R. Gender and Trait Preferences for Banana Cultivation and Use in Sub-Saharan Africa: A Literature Review. Africa Economic Botany. 2020; 74(2) : 226–241
- Karamura DA, Karamura EB, Tinzaara W. Banana cultivar names, synonyms and their usage in EasternAfrica. Kampala: Bioversity International; 2012
- Bezerra JA, Roewer SP, Andrade KL. Avaliação Do Conhecimento Sobre O Uso Da Banana Prata (Musa Spp.) Na Hidratação Capilar. REI. 2020; 12 (1): 1 – 12
- FAOstat (2019). Crops. [http://www.fao.org/faostat/en/#data/QC]. (Accessed on 16 June 2020).
- Mobambo P, Staver C, Hauser S, Dheda B, Vangu G. An innovation capacity analysis to identify strategies for improving plantain and banana (Musa spp.) productivity and value addition in the Democratic Republic of Congo. Acta Horticulturae. 2010; 879 : 821-828.
- Tinzaara W, Ssekiwoko F, Kikulwe E, Karamura E. Effectiveness of learning and experimentation approaches for farmers as a community based strategy for banana xanthomonas wilt management. Journal of Agricultural Extension and Rural Development. 2019; 11 (7) : 128-138
- Blomme G, Ocimati W, Amato S, zumFelde A, Kamira M, Bumba M, Bahati L, Amini D, Ntamwira J. Banana pest risk assessment along banana trade axes running fromlmlow to high altitude sites, in the Eastern DR Congo and in Burundi. African Journal of Agricultural Research. 2020; 16(9) : 1253-1269
- Blomme G, Dita M, Jacobsen KS, Pérez Vicente L, Molina A, Ocimati W, Poussier S, Prior P. Bacterial Diseases of Bananas and Enset : Current State of Knowledge and Integrated Approaches Toward Sustainable Management. Front. Plant Sci. 2020; 8:1290. https://doi.org/10.3389/fpls.2017.01290
- Ocimat W. Sustainability of banana-based agroecosystems affected by Xanthomonas wilt disease of banana, Thesis, Wageningen University & Research, 240 p. 2019
- Yirgou D, Bradbury JF. Bacterialwilt of Enset (Enseteventricosum) incited by Xanthomonas musacearumsp. Phytopathology, 1968; 58 : 111–112.
- Yirgou D, Bradbury JF. A note on wilt of banana caused by the enset wilt organism Xanthomonas musacearum. East Afr. Agr. For. J. 1974; 40 : 111–114.
- Tushemereirwe W, Kangire A, Smith J, Ssekiwoko F, Nakyanzi M, Kataama D, Musiitwa C, Karyeija R. An out break of bacterialwilt on banana in Uganda. Info Musa. 2003; 13 :44–45.
- Tushemereirwe W, Kangire A, Ssekiwoko F, Offord LC, Crozier J, Boa E, Ruterford M, Smith J. First report of Xanthomonas campestris pv. musacearum on banana in Uganda. Plant Pathol. 2004; 53, 802.
- Ndungo V, Bakelana K, Eden-Green S, Blomme G, An out break of banana Xanthomonas wilt (Xanthomonas campestris pv. musacearum) in the Democratic Republic of Congo. Info Musa. 2004; 13 : 43–44.
- Carter BA, Reeder R, Mgenzi SR, Kinyua ZM, Mbaka JN, Doyle K, Nakato V, Mwangi M, Beed F, Aritua V, Lewis-Ivey M.L, Miller SA, Smith JJ. Identification of Xanthomonas vasicola (formerly X.campestris pv. musacearum), causative organism of banana Xanthomonas wilt, in Tanzania, Kenya and Burundi. Plant Pathol.2010; 59 : 403–403.
- Nakato V, Mahuku G, Coutinho T. Xanthomonas campestrispv. Musacearum :a major constraint to banana, plantain and enset production in central and east Africa over the past decade, Molecular Plant Pathology 2018a ; 19(3) : 525–536
- Petsakos A, Kozicka M, Blomme G, Nakakawa JN, Ocimati W, Gotor E. The potential impact of banana Xanthomonas wilt on food systems in Africa: modeling scenarios of policy response and disease control measures. Front. Sustain. Food Syst. 2023; 7:1207913. https://doi.org/10.3389/fsufs.2023.1207913
- Tripathi L, Mwangi M, Aritua V, Tushemerelrwe W, Abele S, Bandyopadhyay R, Xanthomonas wilt, a threat to Banana Production in East and Central Africa, plant disease. 2009; 93 (5) : 440 – 451
- Studholme D, Wicker E, Abrare S, Aspin A, Broders K, Dubrow Z, Grant M, Jones J, Karamura G, Lang J, Leach, J, Mahuku G, Nakato G, Coutinho T, Bull C. Transfer of Xanthomonas campestris pv. arecae and X. campestris pv. musacearum to X. vasicola (Vauterin) as X. vasicolapv. Arecae comb. nov. and X. vasicola pv. Musacearum comb. nov. and Description of X. vasicola pv. Vasculorum pv. nov. Phytopathology, 2018; 110 (6): 1153-1160.
- Haile B, Adugna G, Handoro F. Physiological characteristics and pathogenicity of Xanthomonas campestris pv. Musacearum strains collected from enset and banana in Southwest Ethiopia African Journal of Biotechnology 2014; 13 (24) : 2425-2434
- Adriko J, Aritua V, Mortensen N, Tushemereirwe W, Kubiriba J, Lund S. Multiplex PCR for specific and robust detection of Xanthomonas campestri spv. musacearum in pure culture and infected plant material. Plant Pathol. 2012; 61 : 489e497.
- Biruma M, Pillay M, Tripathi L et al. Banana Xanthomonas wilt : a review of the disease, management strategies and future research directions. African Journal of Biotechnology 2007; 6 : 953–62
- Tahat MM, Sijam K. Ralstonia solanacearum : The bacterial Wilt Causal Agent. Asian Journal of Plant Sciences 2010; 9 (7) : 385 – 393.
- Aytenfsu M. and Haile B, (2020) Distribution and Management of BacterialWilt (Xanthomonas campestrispv.Musacearum) of Ensete (Ensetevetricosum) in Ethiopia : aReview, International Journal of Research in Agriculture and Forestry. 2020; 7 (2) : 40-53
- Blomme G, Dusingizimana P, Ntamwira J, Kearsley E, Gaidashova S, Rietveld A, Schagen BV, Ocimati W. Comparing effectiveness, cost-and time-efficiency of control options for Xanthomonas wilt of banana under Rwandan agro-ecological conditions Eur J Plant Pathol 160 : 487-501
- Yemata G, Fetene M. In vitro evaluation of the antibacterial activity of some medicinal plant extracts against Xanthomonas campestris musacearum, Ethiopian Journal of Science and Technology. 2017a; 10 (1) : 14-32
- Yemata G, Fetene M. In vitro antibactrerial activity of some antibiotics against Xanthomonas campestris pv. musacearum :Ensete ventricosum (Welw.) Cheesman Pathogen Journal of Phytopathology and Pest Management 2017b; 4 (1) : 48-57
- Yemata G, Desta B, Fetene M.. In Vitro antibacterial Activity of Traditionally Used Medicinal Plants against Xanthomonas Campestris Pv. Musacearum in Ethiopia. Biodiversitas. 2019 ; 20 (2), 555–561. https://doi.org/10.13057/biodiv/d200235
- Shalukoma C, Bogaert J, Duez P, Stévigny C, Pongombo C, Visser M. Les plantes médicinales de la région montagneuse de Kahuzi-Biega en République démocratique du Congo : utilisation, accessibilité et consensus des tradipraticiens Bois Et Forêts Des Tropiques, 2015 ; 326 (4), 43-55
- Masengo CA, Ngbolua JP, Butoto B, Gbolo B, Inkoto C, Mpiana P. Ethno-botanical survey of medicinal plants species traditionally used for treatment of diseases in Kasangulu Territory, D.R.Congo, Morocan Journal of Agricultural Sciences. 2023; 4 (2), 76-85 ;
- Konieczynski P, Zarkov A, Viapiana A, Chrubczynska EM, Wesolowski M, Studies on the chemical composition of plants used in traditional medicine in Congo. Open chemistry. 2022; 20: 370-378
- Fundiko MC, Biduaya FM, Mwassa A, Mokoso M. Antibacterial activities of 13 medicinal plants used against infectious and parasitic diseases in Kinshasa and its surroundings, D.R.Congo, International Journal of Biological and Pharmaceutical Sciences Archive 2022; 3 (2) : 39-47
- Bashige C, Bakari A, Okusa N, Kahumba B, Duez P, Lumbu S. Ethnobotanical study of plants used as antimalarial in traditional medecine in Bagira in Easter RD Congo. Journal of Pharmacognosy and Phytochemistry. 2020; 9(4) 01-14
- Kaboyi G, Imani B, Ndabaga C, Gendusa P, Kang JW. Quantitative EthonomedicinalStudy of Plants Used by the Population in Middle Plateaux of Uvira Territory (D.R.Congo). Forest Sci. Technol. 2021; 17 (3) : 144-154 https://doi.org/10.21203/rs.3.rs-291478/v1
- Syamasamba M, Kapiri M, Muhesi K, Mbayahi K, Mavinga M. Ethnobotanical study of plants used traditherapists for the treatment of Malaria in city of Butembo, North Kivu, East of the Democratic Republic of Congo. IJIAS 2022; 2 (3) 219 – 233.
- Kasrina K, Zukmadini AY. Ethobotanystudy of medicinal plants in Bengkulu as medium of studentlearning : The Euphorbiaceaefamily. Journal of Physics : Conferenceseries. 2021; 1731: 1-9
- Sharma M, Shama M, Bithel N, Sharma M. Etnobatany, Phytochemistry, Pharmacology and Nutritional Potential of Medicinal Plants from Asteraceae family. J. Mountain. 2022; 17(2): 67-83
- Saber RF, Munekata PE, Rizwan K, El-Nashar H, Fahmy NM, Aly SH, El-Shazly M, Bouyahya A, Lorenzo JM. Family Myrtaceae : The treasurehidden in the complex/diverse composition. Critical Reviews in Food Science and Nutrition. 2023; https://doi.org/10.1080/10408398.2023.2173720
- Smail A, Mourad A, Miloudia S, Mohamed E. Traditional Uses, Pharmacological, and PhytochemicalStudies of Euphorbia : A Review, Curent Topics in Medicinal Chemistry. 2022; 22 (19) : 1553-1570 https://doi.org/10.2174/1568026622666220713143436
- Nakakawa J, Mugisha J, Karamura E. Banana Xanthomonas wilt dynamics with mixed cultivars in a periodic environment, International Journal of Biomathematics. 2020; 13 (1).
- Haile B, Fininsa C, Terefe H, Chala A, Hussen S. Evaluation of enset (Ensete ventricosum) clones for resistance reaction against pathogenic Xanthomonas campestris pv. Musacearum isolates from south wester Ethiopia. Food & Agriculture. 2020; 6 (1773094),
- Sutton S. Accuracy of platecounts. J. Valid. Technol. 2011; 17(3) : 42–46.
- Mahuku GS. A simple extraction method suitable for PCR-based analysis, Fungal and Bacterial DNA. Plant Molecular Biology Reporter. 2004 22:71-81.
- Shrestha T, Lamichhane J. Assessment of phytochemicals, antimicrobial, antioxidant and cytotoxicity activity of methanolic extract of Tinospora cordifolia (Gurjo), Nepal J Biotechnol. 2021; 9 (1):18-23, https://doi.org/10.3126/njb.v9i1.38646
- Nasser K. Utilization of fungal and bacterial endopytes for the management of banana nematode Radopholus similis in East African Highland banana, thesis, Makerere University; 2023
- Balagizi I, Vayire K, Rati E. Les plantes médicinales du Kivu. Associzione San Francesco, ONLUS, Gênes, Italie; 2021
- Korangi V, Kubindana G, Fingu-Mabola J, Sulu A, Kasereka G, Matamba A, Ndindir J. Utilisation des biopesticides pour une agriculture durable en République Démocratique du Congo (Synthèse bibliographique), Revue Africaine d’Environnement et d’Agriculture. 2021 ; 02 : 53-67
- Harbone JB. Phytochemical Methods. Chapman & Hall, London; 1983.
- Okeniyi SO, Adedoyin BJ, Garba, S. Phytochemical Screening, Cytotoxicity. Antioxidant and Antimicrobial Activities of Stem and Leave Extracts of Euphorbia Heterophylla. Journal of Biology and Life Science. 2013; 4 (1)
- Anitha G, Sudarsanam G. Studies on antimicrobial activity of Tephrosia calophylla against Xanthomonas citri and salmonella typhi murium. International Journal of Applied Biology and Pharmaceutical Technology. 2013; 4 (1)
- Patle T, Shrivas K, Kurrey R, Upadhyay S, Jangde R, Chauhan R. Phytochemical screening and determination of phenolics and flavonoids in Dilleniapentagyna using UV–vis and FTIR spectroscopy, Spectrochimica Acta Part A. Molecular and Biomolecular Spectroscopy. 2020; 242 (118717) https://doi.org/10.1016/j.saa.2020.118717
- Sharma y, Velamuri R, Fagan J, Schaefer J, Streicher C, Stimson J. Identification and caracterization of Polyphenols and volatile Terpenoid Compounds in Diffrent Extracts of Garden Sage (Salvia officinaleis L.) Pharmacognosy Research. 2020; 12 (2) : 149-157
- Muharrami L. Munawaroh F. Ersam T, Santoso M. Phytochemical screening of ethanolic extract: a Preliminary Test on Five Medicinal Plants on Bangkalan, Jurnal Pena Sains. 2020; 7, (2), 96 – 102,
- Uwamahoro F, Bucagu C, Berlin A, Bylund H, Yuen J. Host Range and banana cultivars’ Susceptibility to Xanthomonas campestrispv. Musacearum in Rwanda. African Crop Science Journal. 2019 ; 27 (3) : 463-478 https://dx.doi.org/10.4314/acsj.v27i3.10
- Nakato V, Wicker E, Coutinho A, Mahuku G, Studholme D. A highly specific tool for identification of Xanthomonas vasicola pv. musacearum based on five Xvm-specific coding sequences. Heliyon. 2018b; https://dx.doi.org/10.1016/j.heliyon.2018.e01080
- Hodgetts J, Hall J, Karamura G, Grant M, Studholme D, Boonham N, Karamura E, Smith J. Rapid, specific, simple, in-field detection of Xanthomonas campestris pathovar musacearum by loop-mediated isothermal amplification .J. Appl. Microbial. 2015; 119 : 1651e1658.
- Metocity, 2024; https://www.meteocity.com/republique-democratique-du-congo/bukavu-v217831,
- Climate Traverl, 2024; https://www.climatestotravel.com/climate/uganda
- Oueslati S, Gharsalli W, Abdelkarim M, Ben Aissa-Fennira F, Ksour R. Biochemical evaluation and exploration of the antioxidant, antibacterial and anticancer potential of Zingiber officinale. Journal of New Sciences, 2018; 54, 3561-3568
- Valle SB, Ribeiro RS, Silva V, Martins TS, Pereira SS. Avaliação Da ExtraçãoPorSolventes Para Obtenção Do Extrato De Espinafre (TetragoniaTetragonioides), Congresso Brasileiro de engenharia quimica eminiciçao cientifica, Uberlandia. 2019.
- Chen XM, Ma Z, Kitts DD. Effects of processing method and age of leaves on phytochemical profiles and bioactivity of coffee leaves. Food Chemistry. 2018; 249:143–153.
- Muhesi K, Betti L, Din N, Kapiri M, Afiong H, Billong P. Ethnobotanical knowledge of Prunus africana (Hook. f.) Kalkman (Rosaceae) by people living in community forests in North Kivu, Eastern Democratic Republic of Congo. Ethnobotany Research and Applications. 2023; 26 (12)
- Ranjan RK, Bimala R, Jha PK. In vitro screening of plant extract to control bacterial leaf blight of rice disease caused by Xhanthomonas oryzae pv oryzae. Environment and Ecology. 2017; 35 (2) : 1348-1353.
- Sebiomo A, Awosanya A, Awofodu A. Comparative studies of antibacterial effect of some antibiotics and ginger (Zingiber officinale) on two pathogenic bacteria. Journal of Microbiology and antimicrobials. 2011; 3 (1) : 18-22
- Alkandarhi M, Kusumati A, Fikayuniar. Antibacterial Activity of Zingiber officinale Rhizome. International Journal of Psychological Rehabilitation. 2020; 24 (7) : 3701-3706
- Mabhiza D, Chitemerere T, Mukanganyama S. Antibacterial properties of alkaloid extracts from Callistemon citrinus and Vernonia adoensis against Staphylococcus aureus and Pseudomonas aeruginosa. International Journal of Medicinal Chemistry. 2016; 1 (8).
- Juariah S, Bakar FI., Bakar MF, Endrini S, Kartini S, Mohamad A, Hanafi AF. Antibacterial Activity of Red Ginger (Zingiber officinalevar. rubrum) and Black Turmeric (Curcuma caesia) Extracts as Growth Inhibitors of Klebsiella pneumonia. Trop J Nat Prod Res. 2023; 7(6) : 3658-3665
- Nahak G, Sahu R. Phytochemical Evaluation and Antioxidant activity of Piper cubeba and Piper nigrum. Journal of Applied Pharmaceutical Science. 2011; 1 (08) : 153-157
- Amadi BA, Duru MK, and Agomuo EN. Chemical profiles of leaf, stem, root and flower of Ageratum conyzoides. Asian J. Plant Sci. Res, 2012; 2 (4) : 428-432
No competing interests reported.