Animal samples
We collected female balb/c nude mice of 6 weeks old and divided them into two groups of 5 each for subcutaneous injection. With the significantly different ones removed, eventually 3 mice were selected as the experimental results. The size of tumor was measured each weak. Five weeks later, we killed all mice by cervical dissection, and collected and weighed the tumors.
Cell culture
We purchased 4 human HCC cell lines (HepG2, HepG3B, Huh7 and HCCLM3) and 1 normal liver cell line (LO2) from China Center for Type Culture Collection (Wuhan, China),which have been authenticated by STR and tested for mycoplasma contamination through Mycoplasma detection kit, and cultured them at 37℃ under humidified conditions of 5% (v/v) CO2 in Dulbecco’s Modified Eagle’s Medium (DMEM; Thermo Fisher Scientific, Waltham, MA, USA) with 10% fetal bovine serum (Gibco, Thermo Fisher Scientific, Waltham, MA, USA), 100 U/ml penicillin and 100 ng/ml streptomycin.
RT-qPCR assay
We extracted total RNA from the cells and tissues of HCC with Trizol reagent (Invitrogen, Carlsbad, CA) following the manufacturer’s instructions, and then conducted reverse transcription based on the instructions of the UEIris II RT-PCR System for First-Strand cDNA Synthesis (US Everbright®Inc, Suzhou, China). In the RT-qPCR assay, we used SYBR Premix Ex Taq (US Everbright®Inc, Suzhou, China) on an ABI 7900 system (Applied Biosystems, Foster City, CA, USA) with glyceraldehyde 3-phosphate dehydrogenase (GAPDH) adopted for endogenous control. Comparative quantification was detected using the 2−ΔΔCt method. Primers were purchased from Sangon Biotech (Shanghai, China), with sequences listed as below: GAPDH forward, 5’-GCTCTCTGC
TCCTCCTGTTC − 3’; GAPDH reverse, 5’-CGACCAAATCCGTTGACTCC-3’; PTEN forward, 5’-CGGCAGCATCAAATGTTTCAG-3’; PTEN reverse, 5’-AACTGGCAGGT
AGAAGGCAACTC-3’; miR-92a-3p, 5’-UAUUGCACUUGUCCCGGCCUGU-3’; Universal primer, 5’-GCGAGCACAGAATTAATACGAC-3’.
Cell transfection
Following the manufacturer’s protocol, we transfected miR-92a-3p inhibitor and inhibitor negative control (NC) separately into HepG2 and HCCLM3 cells with Lipofectamine 2000 transfection reagent (Invitrogen; Thermo Fisher Scientific, Waltham, MA, USA). 48 hours after transfection, we collected the cells to perform the assays below.
Cell counting kit-8 (CCK-8) assay
HepG2 and HCCLM3 cells were separately plated into 96-well plates and cultured. About 17–24 h later, the cells were transfected with miR-92a-3p inhibitor or inhibitor NC using Lipofectamine 2000 as per the manufacturer’s protocol, and then incubated for 0, 24, 48 and 72 h. Next, CCK-8 solution (Beyotime Institute of Biotechnology, Shanghai, China) was added. After 1 hour of incubation, the absorbance at 450 nm was measured by Multiskan FC (Thermo Fisher Scientific, Waltham, MA, USA).
Scratch wound healing assay
HepG2 and HCCLM3 cells were plated into 6-well plates. To create uniform wounds, a 10 µl tip was used for scraping before transfection (miR-92a-3p inhibitor or inhibitor NC). Exfoliated cells were removed by washing the wells thrice with phosphate-buffered saline (PBS). Then a medium containing 2% fetal bovine serum was added, and the cells were incubated in an incubator with 5% CO2 at 37°C, with photos magnified at 40× taken at 0, 24, 48 and 72 h respectively.
Transwell assay
The vertical migration and invasion abilities of cells were respectively assessed using Transwell chambers uncoated or coated with Matrigel (BD Biosciences, USA). After transfection with different treatment (miR-92a-3p inhibitor, NC inhibitor, NC inhibitor + si-NC, miR-92a-3p inhibitor + si-NC and miR-92a-3p inhibitor + si-PTEN), HepG2 and HCCLM3 cells were digested to a concentration of 1×105 cells/ml and seeded in the upper chamber containing serum-free medium, and 600 µl of 10% FBS-DMEM was added to the lower layer. After 24 h, the upper device was secured, washed carefully with PBS, and fixed with 4% polyformaldehyde for 20 min at room temperature. Then the chamber was stained for 20 min in a 24-well plate with 600 µl of crystal violet, and the stained cells were observed microscopically at a magnification of 40×.
Bioinformatics analyses
We selected miRDB (http://mirdb.org/) and TargetScan (http://www.targetscan.org/vert_72/) to perform target gene predictions for miR-92a-3p, and detected the intersection of the obtained genes with Venny (https://bioinfogp.cnb.csic.es/tools/venny/). Next, the STRING database (https://string-db.org/) was used for the protein-protein interactions of target genes, which were imported into Cytoscape. We obtained the top ten hub genes according to degree and calculated the enrichment modules through the Mcode in Cytoscape. Then, we conducted Kyoto Encyclopedia of Genes and Genomes (KEGG) pathway function enrichment analyses of target genes in FunRich, and performed overall survival (OS) and relapse free survival (RFS) analyses of target genes using Kaplan-Meier plotter in cBioPortal.
Western blot assay
Total proteins were extracted from HCC cells after transfection for 48 h using cell lysis buffer (Beyotime Biotechnology Shanghai, China). Protein samples were resolved through electrophoresis on 12% sodium dodecyl sulfate polyacrylamide gel electrophoresis (SDS-PAGE), and then transferred to polyvinylidene fluoride membrane which was blocked with 5% BSA at room temperature for 60 min. After incubation with primary antibody PTEN (1:1000, ABclonal) at 4oC overnight and secondary antibody (1:10000, ABclonal) at room temperature for 90 min, ECL reagents (Millpore, USA) were used to detect the signal of PTEN. We scanned the images of gels using Bio-Rad Gel Doc XR + system (Bio-Rad, Hercules, CA, USA), and adopted GAPDH as an internal control.
Dual luciferase reporter gene assay
Dual luciferase reporter gene assay corroborated the targeting relationships between PTEN and miR-92a-3p. To generate psicheck2- PTEN-WT and psicheck2-PTEN-MUT vectors, the wild type (WT) containing the predicted target site and the mutant type (MUT) with the binding site deleted were amplified and cloned into the psicheck2 plasmid. Afterwards, the luciferase vectors were respectively transfected into HEK293T cells along with miR-92a-3p inhibitor or inhibitor NC. 24 hours after transfection, following the manufacturer’s protocol, we measured the relative luciferase activity by normalizing the firefly luminescence to the Renilla luminescence using the Dual-Luciferase Reporter Assay System (Promega, Madison, WI, USA).
Immunohistochemistry (IHC) assay
IHC staining was carried out to study the influence of miR-92a-3p on HCC tissues in migration and invasion. Briefly, TMA sections were washed by PBS and incubated at 37°C overnight with primary antibodies, 1:750 rabbit polyclonal anti-Iba1 (Wako), 1:1000 anti-Mac2 (ATCC), 1:500 anti-cleaved caspase 3 (New England Biolabs), and 1:1000 rat polyclonal anti-BrdU (Axyll). The next day, TMA was washed with 0.1% Tween-20 and re-stained with DAPI. The paraffin-embedded mouse tumor sections were subjected to immunohistochemical analysis, and Ki67 and MMP9 (Proteintech, China) antibodies were used for immunohistochemical staining, respectively.
LinkedOmics and DAVID analysis
LinkedOmics (http://www.linkedomics.org/ login.php) (31) is an accessible open database with multi-omics data and clinical data on 32 cancer types and a total of 11,158 patients from The Cancer Genome Atlas (TCGA) project, offering a unique platform for biologists and clinicians to access, analyze and compare mutli-omics data within and across tumor types. In this study, we used LinkedOmics database to identify PTEN- associated genes and carry out gene expression correlation analyses of PTEN, and DAVID database for PTEN-associated genes Gene Ontology (GO) and KEGG pathway enrichment.
cBioportal analysis
The cBioportal for Cancer Genomics (http://cbioportal.org) (32) is an online website providing a rich diversity of resources for the exploration, visualization, and analysis of multidimensional data on cancer genomics. Since it allows survival analysis for a panel of genes, the cBioportal database was used for survival analysis. Besides, the mutation type of PTEN was also analyzed via the cBioportal database. Additionally, we used an integrated analysis via the cBioportal and ICGC(https://dcc.icgc.org/genes/)databases to identify the mutation frequency of PTEN in HCC.
Detection analysis of CRISPR-cas12a
Sample collection
10–15 pieces of embedded paraffin sections were taken and store at room temperature. DNA can be extracted directly with the paraffin-embedded tissue DNA extraction kit (Tiangen Biochemical Technology Co., Ltd., item number: DP331-02).
Primer design and crRNA preparation
Wild-type and mutant templates and amplification primers were designed with the reference to the specific detection site R130Q of the gene PTEN to be detected. At the same time, crRNA was designed for these mutant regions and the required oligonucleotides (crDNA) were synthesized. crDNA and cr-T7-F were annealed to prepare the transcription templates according to the steps of double-stranded target. Then HiScribe T7 Quick High Yield RNA synthesis kit (NEB) was used without enzyme to incubate the transcriptional templates at 37 ℃ for 16 hours.. After detection, 2ul DNase 1 was used to eliminate the unreacted template in the system. After purification, the required crRNA was obtained. Wild-type and mutant template sequences, amplification primers and crDNA were synthesized by Tianyi Huiyuan Company (Table 1).
Table 1
Wild-type and mutant template sequences, isothermal amplification primers and crDNA sequences
Primer
|
sequence
|
PTEN-R130Q WT
|
GCAGCAATTCACTGTAAAGCTGGAAAGGGACGAACTGGTGTAATGATATGTGCAT
|
PTEN-R130Q MUT
|
GCAGCAATTCACTGTAAAGCTGGAAAGGGACAAACTGGTGTAATGATATGTGCAT
|
R130Q-crDNA-Reverse
|
AAGCTGGAAAGGGATGAACTGGTGATCTACAAGAGTAGAAATTACCCTATAGTGAGTCGTATTAATTTC
|
cr-T7-F
|
GAAATTAATACGACTCACTATAGGG
|
Probe sequence
|
5’-FAM-CTCACTACAGACGCACGCTA-BHQ1-3’
|
PCR-R13OQ-Forward
|
GGCTAAGTGAAGATGACAATCATGTTGCAGC
|
PCR-R130Q-Reverse
|
TCTGGTCCTTACTTCCCCATAGAAATCTAG
|
Verification of Crispr-cas12a fluorescence detection system
Fncas12a was a protein to be detected. The 50-100ng template DNA with the total volume of 50 ul was added to the reagent mixture (containing 0.75uM crRNA, 1.5uM Fncas12a, 50pm probe and 3ul NEBuffer 3.1) And in order to read the fluorescence value and analyze the fluorescence curve, they were reacted at 37°C for 1h in the fluorescence detector As a result, all reactions were carried out at a constant temperature of 37–42°C.
Clinical sample testing
With 50ng DNA sample as template, RT-qPCR was performed using conventional primers. Detailed procedures are as below: samples were placed at 95°C for 5min, followed by 30 cycles of 95°C for 3min, 56°C for 10s, 72°C for 20s, and finally 72°C for 5min. The first-generation sequencing was performed after the electrophoresis test was qualified. Besides, 1-5ul of the amplified product was taken for Crispr-cas12a fluorescence detection.
Statistical analysis
All data in this work were presented as mean values ± SD, with GraphPad Prism 7.0 (La Jolla, CA, USA) adopted for all statistical analyses. We used student’s t test to compare two dependent groups, and two-way ANOVA with Tukey’s post hoc test to compare multiple groups. Survival analyses were performed by Kaplan-Meier survival curve and determined through Log-rank test. P < 0.05 indicates a statistically significant difference.