The Occurrence of Resistomes, Virulence Factors and Clonal Diversity of Escherichia coli and Staphylococci Isolated from the Semen of Men Attending Infertility Clinic in Lagos

doi:10.21203/rs.3.rs-4084048/v1

Download PDF

Research Article

The Occurrence of Resistomes, Virulence Factors and Clonal Diversity of Escherichia coli and Staphylococci Isolated from the Semen of Men Attending Infertility Clinic in Lagos

https://doi.org/10.21203/rs.3.rs-4084048/v1

This work is licensed under a CC BY 4.0 License

Version 1

posted

You are reading this latest preprint version

Male factor infertility accounts for 40–60% of global couples suffering from infertility. Multiple antibacterial resistances have constituted a serious impediment against the effective eradication of non-specific bacteria etiology of male infertility; resistant genes are spread within and across bacterial species; producing progeny that are difficult to treat. This study, analyzed resistance genes, virulence factors, and clonal characteristics of E. coli and Staphylococci recovered from the semen of infertile men attending urology clinics in Lagos. A total of 16 E. coli and 48 Staphylococci isolated from 226 infertile men were found to be MDR and were suspected of harboring resistomes. Escherichia coli specific oligonucleotide primers were designed according to TEM, SHV, CTX-M-type and OXA β-lactamase, TEcoli (tuf), and bac DNA sequences, and Staphylococci Mec A, Fem A, ermA and others genes deposited in the GenBank were identified using PCR method. Clonal characteristics and biodiversity were determined by RAPD using oligonucleotides S30 5׳- GTGATCGCAG that had non-palindromic sequences. The DNA fingerprints of the isolates were compared for biodiversity by visual inspection of the band profiles. The gel images were digitalized and stored as TIFF. These files were converted, normalised, and analysed with GelWorks 1D software (version 3.00, UV products, England). DNA fingerprints detected by computer were carefully verified by visual examination to correct unsatisfactory detections. Genetic relationships were established by scoring the presence (1) or absence (0) of each RAPD polymorphic band. The percent of similarity between the strains was estimated by using the coefficient of Dice. Cluster analysis of similarity matrices was performed by UPGMA tool. The data were submitted to the computer programme to transform the polymorphic bands of the oligonucleotide into a dendrogram. Escherichia coli had a 25% prevalence of blaCTx-M gene and Staphylococci had 22.6% MecA and 12.9% FemA genes. Phylogenetically, E. coli had a narrow diversity of 2 main groups and 3 clusters from a single genetic origin, with > 50% similarity. Group 1 had a different genetic identity and required further sequencing as a local strain from Lagos. Staphylococci were more diverse as there were 6 main groups and 11 clusters with 10–90% similarity. Group 4 had a different genetic origin and requires further sequencing as a local strain. This study concludes the relatively high occurrence of the blaCTx-M gene among E. coli and MecA genes among Staphylococci and these calls for concern. The presence of non-typeable genotypes is novel and underscores the need for a national programme for bacterial typing.

Lagos male infertility MDR bacteria

resistomes and Phylogenecity

Infertility is fast becoming a worrisome development as male and female contributory factors affect about 15% of couples globally¹. Genetic factors and couples microbiota are two major possible risk factors of infertility^{2, 3}. Microbial genital tract infections could be specific (e.g., chlamydosis, gonorrhea, ureaplasmosis and trichomoniasis caused by Chlamydia trachomtis, Neisseria gonorrhoea, Ureaplasma urealyticum and Trichomonas vaginalis respectively) and non-specific (caused by: enterobacteriaceae, Staphylococci, Streptococci, Klebsiella spp., E. coli. and Candida spp. [fungus]) ^{4, 5}.

Infections of the male genital-urinary tract may contribute to male infertility by adversely affecting spermatozoa production and development⁶, function^{6, 7, 8} and transportation⁸. Specifically, microorganisms’ contamination of semen might affect the spermatozoa function in different ways: (i) By direct contact with sperm cells; by the help of some organelles such as pili; causing agglutination of motile sperm, reducing the ability of the acrosome reaction, and also causing alterations in cell morphology. (ii) Elicit a local inflammatory reaction leading to an increase in reactive oxygen species (ROS). (iii) Induction of sperm autoantibodies, (iv) Production of cytotoxic factors. (v) Infection treatment with antibiotics for a long time may lead to defects in the sperm cells⁹. The most frequently isolated microorganism in male patients with genital tract infections or semen contamination is Escherichia coli ¹⁰. Also, Staphylococcal species are commensal bacteria and major human pathogens mediating various reproductive tract infections¹. Both pathogens are implicated in some infection-induced male infertility. Specifically, pathogenic E. coli possess adhesins which is an important virulent factor in determining urogenital infection risk¹¹. It is an adherence factor that facilitates the colonization of the urogenital carnal or sperm cells of the patients. Over 250 E. coli serotypes have been recognized based on O, H and K antigens and have been largely classified into five key phylogenetic pedigrees: A, B1, B2 and D, and non-aligned group E¹². According to peer reports, extra-intestinal pathogenic E. coli strains are typically derived from the phylogenetic group B2 ¹³. They usually possess unique adhesins such as P, S, or Dr to aid their colonization in the genital tract, and possess toxins, for example, haemolysin and cytotoxic necrotizing factor 1 (NF-1) usually to elicit inflammatory responses that perhaps are responsible for the development of genital inflammatory symptoms¹⁴.

On the other hand, Staphylococcal surface factors binding with sperm membrane proteins are said to impair sperm functions directly¹ (Dutta. A positive association between azoospermia, the presence of microorganisms, and poor semen quality in male infertility has been severely reported ^{5, 15, 16, 17.}

Microbial pathogens associated with seminal fluid contamination could be clinically eradicated according to Zeyad et al.⁹.The success of the treatment of infections depends on the appropriate use and effective antimicrobial agents directed against the pathogens¹⁹. However, recent developments have shown that bacterial mutations and abuse of antimicrobial agents among other factors, enhances the spread of drug resistance traits among bacteria by providing the selective pressure required for the emergence and spread of resistomes ^{18, 20, 21}.

The World Health Organisation (WHO) has named antibiotic resistance as one of the three most important public health threats of the 21st century²². The great challenges posed by the rapid generation and transmission of antibacterial resistomes have been revealed²³. Bacterial antibiotic resistance can be attained through two major mechanisms namely: intrinsic and acquired mechanisms²⁴. Intrinsic mechanisms are those specified by naturally occurring genes found on the host chromosome, such as AmpC β-lactamases of Gram-negative bacteria and Multi-Drug Resistance (MDR) efflux system^{24, 25}. The development of acquired resistance can be a result of mutations in chromosomal genes or due to the acquisition of external mobile genetic elements

(Mobile genetic elements are DNA segments that encode enzymes or other proteins that mediate the movement of DNA within genomes [intracellular mobility] or between bacterial cells) of resistance, likely obtained from intrinsically resistant organisms present in the environment²⁶. The basis for mutational gene transfer could be horizontal or vertical gene transfer mechanisms ^{18, 24}. For instance, among the Ambler class A Extended–Spectrum Beta Lactamases (ESBLs) mainly TEM, SHV, and CTX-M and KPCs genes conferring resistance to 3rd generation cephalosporin and carbapenem antibiotics achieve their activities by irreversible alteration or inactivation of the B-lactam antibiotics by the enzymes²⁷. The TEM-type ESBLs were first identified in 1965 from E. coli and TEM-1 is the most widespread among the Enterobacteriaceae and in particular, E. coli ²⁷. Within the sulfhydryl (SHV) enzyme groups, the SHV-1 is the most common. These resistomes coding for TEM and SHV enzymes have quite rapid mutational rates, resulting in a high level of diversity in enzyme types and thus increasing the scope of antibiotic resistance clinically. The CTX-M enzymes are spread horizontally among the ‘ESKAPEE’ pathogens (bacteria including Enterococcus faecium, Staphylococcus aureus, Klebsiella pneumoniae, Acinetobacter baumannii, Pseudomonas aeruginosa, Enterobacter spp. and E. coli).

Among the Ambler class B ESBLs (metallo-B-lactamases) (MBLs) -requiring Zn²⁺ as a cofactor including the so-called New Delhi gene (NDM-1), bacterial pathogens harboring these genes are resistant to all the B-lactam antibiotics, except the aztreonam. Genes encoding for MBLs are usually plasmid-born and as such rapidly spread among bacterial organisms²⁷.

For Ambler class C (AmpC) enzymes encode chromosomally and result in a somewhat low level resistance among narrow-spectrum cephalosporins group of antibiotics; including the penicillinase and cephalosporinase enzymes. However, acquisition of transmissible plasmid mediated resistance genes increases the production of more AmpC, thereby inducing more resistance. AmpC enzyme inactivates penicillin, most of the cephalosporins, and azitronam ²⁸

For Ambler class D, the oxacillin hydrolyzing (OXA) enzyme; sub-groups of this class of enzymes have been described namely: OXA 11, 14, and 16 among others; they produce carbapenemases said to possess low catalytic efficiency and also porin deletion activities ²⁸.

These genes spread to other bacteria (commensals and pathogens); and pose health threats to the young, old, and the sick, by making antibacterial treatment difficult and further making them vulnerable to infectious diseases, particularly as the microbiota equilibrium is disturbed ²⁹.

The increasing incidence and spread of MDR pathogens generally is a risk factor for a possible epidemic; for instance, E. coli bacteria carrying the mcr-1 gene, which can make bacteria resistant to colistin (a last-resort antibiotic for some multidrug-resistant infections) was found in a bacterial isolate from urine samples from a patient in Pennsylvania in May 2016 and has rapidly spread to other places³⁰. Again, the emergence of fosA3 (fosfomycin resistance gene), usually plasmid-mediated, isolated among CTX-M-producing and MDR E. coli strains is said to have spread from animals and patients in China, Japan, and South Korea ^{31,32, 33, 34, 35}.

The resistance genes are spread among the bacterial organisms, particularly among the so-called ‘ESKAPEE’ group of pathogens (highly virulent and prone to antibiotic resistance) mentioned before, making infectious disease management difficult.

On the other hand, S. aureus strains possess mecA gene that encodes an altered penicillin-binding protein 2 (PBP2) and this altered enzyme, with reduced affinity for β-lactam drugs, is referred to as PBP2a. Methicillin resistance is mediated by mecA and is usually acquired by horizontal transfer of a mobile genetic element called SCCmec³⁶. Strains carrying the mecA gene may express it homogenously (all cells in the population being resistant) or heterogeneously (only a few cells producing sufficient PBP2a to be resistant).

The danger posed by Beta-lactamase and methicillin resistant pathogens was reported by Rozalska and Szewczyk³⁷. In their study, a report of 60% SCC (Staphylococcal Chromosomal Cassette) mecA gene from 361 Staphylococcus Cohnii spp. Cohnti isolated in Poland was made. Their study further reported phenotypic diversities that suggested Staphylococci's ability for long-lasting existence in hospital environments and on human skin³⁷. These isolates were reported to carry in their cells many plasmids with a wide range of sizes (< 2 to > 56 Kb) and differ in plasmid patterns. Their study also, reported community-acquired methicillin resistance(C-MRSA) of short ‘SCCMec’ genes using multilocus sequence typing. In the last two decades, Staphylococci have shown a trend of increasing virulence³⁸. Coagulase negative Staphylococci (CoNS) have generally been regarded as saprophytes or organisms with no or very low virulence. However, there has been an increase in the documentation of human infections due to CoNS, especially with S. epidermidis³⁸. Again C-MRSA outbreaks have been reported worldwide and homologous recombination still contributed to the evolution of these species over the long term³⁸. In another multiplex PCR study 60% of Staphylococci isolated from Belgium were reported to be mecA positive and femA gene was specific for Staphylococcus aureus, mecA and femA are the genetic determinants of methicillin resistance found between 310 and 686-bp regions respectively³⁸. Coagulase-negative Staphylococci lack femA gene³⁹. Those who are susceptible lack mecA gene

Globally, efforts are channeled toward understanding the extent of the spread of genes conferring MDR among bacteria and the molecular characteristics of such genes. For instance, Turner et al⁴⁰ reported that MRSA colonization may increase the risk of infection, and clonal characteristics of the infecting strains match the colonizing strains in as much as 50–80% of cases; this underscores the importance of understanding resistome traffic and disease epidemiology between the hospital and community settings and their biodiversity. Conversely, genetic Knowledge of resistance genes is a modern tool aiding the appropriate choice of antibiotics for the effective treatment of diseases occasioned by such pathogens. This knowledge helps countries to make surveillance policies to contain the spread of resistomes and formulate drug control policies. Achieving the above requires the availability of local data on bacterial pathogens and their clonal diversity. Much is not known about the occurrence, the extent of spread of some of these resistomes among E. coli and Staphylococci isolated from the seminal fluid of males seeking fertility help, and the clonal diversity of the organism. Therefore, in other to generate information on antibacterial resistance genes’ occurrence and clonal diversity, this study was designed to study MDR E. coli and Staphylococci progeny harboring resistomes from seminal fluids of infertile men from Lagos, Nigeria.

Study Design

We undertook a cross-sectional study, involving consecutive adult male partners of infertile couples (defined as men with inability to assist in achieving pregnancy after two year of regular unprotected intercourse) ⁴¹.

Study Site

The sampling was a multi-centre study involving infertile patients from the clinical science Department, Nigerian Institute of Medical Research (NIMR), Yaba, the department of Obstetrics and Gynaecology, University of Lagos Teaching Hospital, Idi Araba and the Saints. Mulumba and David Surulere Catholic Parish clinic, Lawanson, Lagos.

Study population

We studied a total of 226 [calculated from UNICEF/UNDP/WHO⁴² methodology for sample estimation] out of 1,066 patients who attended the clinics within the study period.

Criteria

Inclusion

Adult couples aged 18 years and above with inability to conceive after 12 months of regular unprotected intercourse were recruited. Only such male partners with clinical request for seminal fluid analysis (SFA) and bacteriological culture request were studied

Exclusion

Those with poor quality culture specimen were excluded. Those on active antibiotics treatment or were exposed to antibiotics in the last 14 days were excluded and those who declined consent were excluded⁴³.

Ethical Issues

Approval

The ethical clearance to conduct this research was granted by the Nigerian Institute of Medical Research Institutional Review Board (NIMR IRB) according to the Helsinki Declaration, signed and dated the 28^th. Sept. 2009. The study took place between October 2009 and December 2014.

Informed consent

The consent of each participant was obtained in writing in a private room after proper education of the participant on the study procedure.

Specimen

Pure culture of two most prevalent bacterial isolates from the previously pre-qualified patients were identified and subjected to molecular procedure

Specimen Processing

The experiments were carried out at the Center for Infectious Disease Research, Microbiology department and molecular biology/biotechnology department of the Nigerian Institute of Medical Research Lagos, Nigeria.

Bacterial identification

Bacteria were identified using standard methods^{44, 45}. Isolates were further confirmed by API system (enterobaceriaceae Biomerieux, Lyon, France). Invitro antibiotic susceptibility profile was performed by modified standard disc diffusion technique, as described by Kirby Bauer and the outcome interpreted by Clinical and Laboratory Institute Standard (CLSI) interpretative criteria⁴⁶. A MDR strain was identified when any E. coli that was resistant to ≥ 3 of the following classes of antibiotics: fluroquinolones, betalactams, aminoglycosides and nitrofurantoin or any three of the classes of antibiotics⁴⁷. Staphylococci were tested against sulfonamides, chloramphenicol, macrolides, aminoglycosides, cephalosporins, floroquinolones and others⁴⁶.

PCR procedure

Bacteria preparation for PCR procedure

Bacterial strains were grown from frozen stocks, kept at -80⁰C brain heart infusion (BHI) medium (Beckton, Dickinson, Canada) containing10% glycerol, and cultured on sheep blood, chocolate and sub cultured onto Muller Hinton agar (Oxoid, UK)⁴⁸.

Primer handling

The lyophilized oligo pellets were briefly centrifuged before opening, to prevent loss of the pallet. Stock solution 100uM (100pmole per μl) was made with buffered solution of TE (10mM Tris, pH 7.5 – 8.0, 1mM EDTA). Working solution was made from the stock solution with sterile, nuclease-free water to prevent inhibition of enzymatic reaction according to the manufacturer’s instruction.

Amplification of specific ESBLs genes and RAPD fingerprinting by PCR

Primer design

The specific oligonucleotide primers were designed according to TEM, SHV, CTX-M-type and OXA β-lactamase DNA sequences deposited in the GenBank. The nucleotide sequence, accession numbers and gene position on the ladder were as presented in Table 1. Multiple nucleotide sequence alignments were performed with the CLC Workbench programme. Coding

sequences were detected with the Artemis programme and primers were designed with the Perl

primer proramme⁴⁹.

Table 1: List of multiple primers used

Gene	Function	Tem.(°C)	Nucleotide Sequences (5’-3’)	Accession no	Amplicon size (bp)
SHV-F	bla gene	60	CGCCTGTGTATTATCTCCCT
SHV-R		62	CGAGTAGTCCACCAGATCCT	EF125011	293
TEM-F	bla gene	60	TTTCGTGTCGCCCTTATTCC
TEM-R		58	ATCGTTGTCAGAAGTAAGTTGG	B282997	403
CTX-M-F	bla gene	60	CGCTGTTGTTAGGAAGTGTG
CTX-M-R		62	GGCTGGGTGAAGTAAGTGAC	DQ303459	569
OXA-F	bla gene	60	ATGGCGATTACTGGATAGATGG
OXA-R		60	AGTCTTGGTCTTGGTTGTGAG	L07945	701
mecA-F	methicillin resistance	58	GTAGAAATGACTGAACGTCCGATAA
mecA -R		58	CCAATTCCACATTGTTTCGGTCTAA	Geha et al., ⁵⁰	310
femA -F	methicillin resistance	60	AACAGCTAAAGAGTTTGGTGCC
femA -R		58	CATCACGATCAGCAAAAGCT	NC007793	647
ermA-F	macrolide,lincosamide, streptogramin B resistance	61	GAACCAGAAAAACCCTAAAGACAC
ermA-R		64	ACAGAGTCTACACTTGGCTTAGGATG	NC002952	513
ermC-F	macrolide,lincosamide, streptogramin B resistance	58	ATATCTTTGAAATCGGCTCAGG/
ermC-R		61	GTGAGCTATTCACTTTAGGTTTAGG	NC007792	420
TstaG422	tuf (elongation factor) Staphylococci	66	GCCCGTGTTGAACGTGGTCAAATCA
TstaG765	tuf (elongation factor) Staphylococci	58	TIACCATTTCAGTACCTTCTGGTAA	C4414
S30	RAPD	39	GTGATCGCAG	S4415
bac-F	Virulent factor	64	CGGCGTGCCTAATACATGCAAG	S4416
bac-R		64	GGCATGCTGATCCGCGATTACTA	S4417
tst-F	Virulent factor	60	ATGGCAGCATCAGCTTGATA
tst-R			TTTCCAATAACCACCCGTTT	J02615	350
1.TEcol 1553 2.TEcol 1754	Tuf (elongation factor Tu ) E. coli	60	TGGGAAGCGAAAATCCTG CAGTACAGGTAGACTTCTG	Maheux et al⁴⁸	212
sea	enterotoxin	60	GGATATTGTTGATAAATATAAAGGAAAAAAG/ GTTAATCGTTTTATTATCTCTATATATTCTTAATAGT	DQ6411670	439

DNA extraction E. coli

Cells from 1.5ml of the overnight culture were harvested by centrifugation at 12,000 rpm for 5 minutes. Plasmid DNA was extracted by alkaline lysis method according to the manufacturer’s instructions using alkaline lysis kit (Quiagen, Germany)⁵¹.

PCR amplification of ESBLs genes from the isolates were conducted using specific primers (Table 1) using uniplex PCR procedure.

PCR protocol for E. coli ESBL genes

For Escherichia coli, bla TEM, SHV, CTX-M, OXA specific primers listed in Table 1 were employed for identification of the presence of ESBL gene among the MDR bacterial isolates. Amplification reactions were carried out under the following conditions: initial denaturation at 94°C for 3 minutes, followed by 35 cycle of denaturation at 94°C for 45 seconds. Annealing were carried out at 60°C for TEM, SHV and CTX-M and at 62°C for OXA for 30 seconds and extension at 72°C for 1 minute, and a final extension at 72°C for 3 minutes. Gene ladder (Fermentase SM0241 effective size range: 80 to 1000 kb) was used to assess expressed genes⁴⁹. The PCR was carried out in a 50-μl volume with 30 pmol of each primer, 200 µM deoxynucleoside triphosphates, 1.5 mM Mgcl₂, and 0.5 U of the Expand PCR system (Roche Biochemicals, Mannheim, Germany) in the reaction buffer provided by the enzyme manufacturer⁵¹.

RAPD-PCR Reaction Conditions for E. coli

RAPD-PCR was performed in 25 μL reaction volume containing 50 ng genomic DNA, 0.4 μL (5 pmole) primer, 1.5 μL dNTPs (25mM), 3μL 10X assay buffer with MgCl₂(15 mM), 0.5μL (3 U/μL) of Taq DNA polymerase (Bangalore Genei Pvt Ltd). DNA was amplified by PTC 200 MJ Research thermocycler programme (Bio Rad) to provide initial denaturation of 5 minutes at 94^οC, followed by second denaturation of 45 cycles of 1 minute at 94^οC. Primer annealing for 1 minute at 35^οC was followed by initial extension for 2 minutes at 72^οC and final extension at 72^οC for 5 minutes⁵². One negative control (the reaction mixtures less chromosomal DNA) was used in each primer reaction. PCR products were resolved by electrophoresis in 1.2% agarose gel with 1% TAE buffer containing ethidium bromide. A low range DNA ruler/ pBR322DNA/Hinf1digest (Bangalore Genei) marker was used as a molecular size standard. Amplified bands for their presence scored as (1), or absence (0) and similarity indices were calculated as SI = 2 (Nab)/Na+Nb), where SI= level of band sharing between band a and b, Nab = number of band sharing between band a and b, Na = total numbers of band for lane a, and Nb = total numbers of bands for lane b. Genetic relatedness were expressed as dendrogram⁵².

DNA Extraction Staphylococci

Strains were grown on brain heart infusion agar at 37^ο C overnight. Genomic DNA used as target for all molecular methods was extracted using a Qiagen (Hilden Germany) DNA extraction kit according to the manufacturer’s instruction with the modification that 20μl of lysostaphin (1mg/ml; Sigma) and 20μl of lysozyme (100mg/ml Qiagen) were added at the cell-lysis step. The concentration of DNA was estimated spectrophotometrically⁵³.

PCR protocol for Staphylococcus species

A typical 25-μl PCR mixture contained 2.5 μl 10xPCR reaction buffer, 25 pmole of each primer, 200μM concentrations of each dNTP, 2 μl Mgcl₂ 25 mM (2 mM final concentration) 0.75 U of Taq polymerase, and 3 μl bacterial suspension. PCR was performed in the Thermocycler, (PTC 200 MJ Research thermocycler). The parameters for amplification were as follows: initial denaturation at 94^oC for 4 min, second denaturation of 30 cycles of 1 minute each at 94^oC, followed by annealing for 1 min. at 55 – 60 ^oC (depending on the primer). Then initial extension of1 minute at 72^oC and a final extension step at 72^oC for 10 minutes. Amplicons were separated on 1.5% agarose gel, stained with ethidium bromide. The optimization of PCR was made after⁵⁴. The primers (Table 1) were designed with “Pick Primers” programme (http://biotools.umassmed.edu) according to the sequences found at NCBI database⁵⁴.

RAPD-PCR Reaction Conditions for Staphylococci

RAPD-PCR assay was carried out as described by Reinoso et al⁵⁵, briefly 25 ng of the chromosomal DNA was used per reaction. Amplifications were performed in 25 μl of buffer solution containing 3 μM of oligonucleotides, 200 μM of each deoxynucleoside triphosphates (dNTP) (Promega, Madison, USA), 3.5mM MgCl² and 2.5U of DNA Taq polymerase (Promega). The oligonucleotides S30 5׳- GTGATCGCAG that had non-palindromic sequences were used for DNA amplification. Mixtures were overlaid with mineral oil and amplification was performed in a PTC 200 MJ Research thermocycler (Bio Rad). The amplification consisted of a cycle of pre-denaturation at 94^οC for 5 min, followed by heat denaturation of 40 cycles of 1 minute at 93^οC. The oligonucleotides were annealed for 1.30 minutes at 37^οC and extended for1 minute at 72^οC. A final extension step at 72^οC for 8 minutes was included in all amplifications. A negative control of the same reaction mixture with water instead of chromosomal DNA was included in each run. The procedure was repeated twice. Amplified products were separated by electrophoresis in a 1.5% agarose gel (Promega) in 0.5 X TBE buffer at a constant voltage of 4 V/cm stained with Sliver stain of ethidium bromide (0.5 mg/ ml). A 10, 000 bop amplicon size DNA marker (Promega) was used as a DNA molecular size standard.

Dendrogram (genomic tree pattern analysis)

The phylogenetic tree was constructed after Random Amplification Polymorphic DNAs (RAPD) procedure and the gel image established. The S30 primer contains an S30 premix without Amino acid sequence for RAPD fine structure and mapping of genes without cloning steps. The DNA fingerprints of the isolates were compared for biodiversity by visual inspection of the band profiles. Subsequently, gel images were digitalized and stored as Tagget Image Files Format (TIFF). These files were converted, normalized and analysed with GelWorks 1D software (version 3.00, Ultra Violet products, England). DNA fingerprints detected by computer were carefully verified by visual examination to correct unsatisfactory detections. Genetic relationships were established by scoring the presence (1) or absence (0) of each RAPD polymorphic band. The per cent of similarity between the strains were estimated by using the coefficient of Dice⁵⁶. Cluster analysis of similarity matrices was performed by Unweighted (i.e. that all distances contribute equally to each average that was computed) Pair Group Mathematical Averages (UPGMA)⁵⁷. The data were submitted to the computer programme to transform the polymorphic bands of the oligonucleotide into dice distance called dendrogram⁵⁵.

A total of 16 E. coli and 48 Staphylococcus species were found to be MDR and had moderately high prevalence of resistance genes. Escherichia coli harbored blaCTXM gene (25 %), blaSHV and OXA genes had 6 % respectively. The Staphylococci had 22.6% MecA gene and 12.9% FemA gene.

In figure 1 below, lane M shows bands for 100 bp molecular weight standard. Lane 1 was the negative control (E. coli ATCC 25922- ESBLs negative), and lane labeled A (lane 4), shows positive amplification bands corresponding to 293 bp specific for Bla_SHVgene in E. coli (AP 78/11) species isolated from Surulere Local Government Area (LGA), Lagos state, representing 6.3% prevalence. Bla_SHV is a group A ESBLs gene most commonly found in some Gram-negative bacteria. It is plasmid-mediated ampicillin resistant gene among these species.

Lane M in figure 2 shows bands for Ikb molecular weight standard (Bioneer South Korea). Lane 4 shows positive amplification bands corresponding to 701bp specific for OXA gene in E. coli species studied. This represents 6.3% prevalence of OXA gene within the population studied. This gene is a group D plasmid mediated β-lactamase variety, which could hydrolyze oxacillin and related anti-staphylococcal penicillin. It confers resistance to ampicillin and cephalothin. They exhibit high hydrolytic activity against oxacillin and cloxacillin found among E. coli resistant to ceftazidime.

In figure 3, lanes 4, 5 and 9 had distinct bands, sample number 4 had multiple bands one of which corresponds to the 569 bp targeted. Others may have amplified randomly. This study reports 25 % prevalence of bla_CTX-M gene. This is a group-A β-lactamase gene conferring resistance to cefotaxime-M found on the chromosome of resistant organisms.

Figure 4 shows TEcoli (tuf) gene at amplicon 212 bp. It is elongation factor Tuf for Escherichia coli 0157:H7 EDL933 (Positive control) which is a pathogenic trait, usually employed for diagnostic purposes. This study reports 18.8% prevalence of pathogenic sub-type among the population studied. Escherichia coli ATCC 25922 were used as reference negative control.

In figure 5 above, Lane labeled -ve was a negative control (Methicillin susceptible Staphylococcus aureus standard ATCC25923) and M, 100 bp gene ladder. Lanes 17 - 32, 35 36, 38, 39, 43, 44, 46, 47, shows no positive amplification bands for MecA gene in the Staphylococcus species tested. Lanes 33, 34, 37, 40, 41, 42, 45, shows positive amplification bands corresponding to 310 bp specific for MecA gene in the Staphylococcus species. Some species showed positive faint multiple bands; however, they do not have the bands corresponding to the gene of interest. This study therefore reports MecA prevalence of 22.6 % Methicillin resistance in Staphylococci caused by the acquisition of an exogenous gene that encodes an additional β-lactam-resistant Penicillin Binding Protein (PBP), termed PBP 2a (PBP2’). It was reported to have originated from a mobile genetic element called Staphylococcal Cassette Chromosome Mec (SCCmec) invariably inserted into orfX gene of methicillin-resistant Staphylococci, and is the genetic basis for methicillin resistance⁵⁴.

The ermA (erythromycin- resistant methylase) is a gene demonstrating macrolide, lincosamid and streptoreamine B resistance among some Gram positive bacteria. We report 3.2 % prevalence of ermA resistant gene among the population studied as shown in figure 6.

In figure 7, Some Staph. strains expressed multiple bands in lanes 25, 38, 40, 41 and 45; they are unique bands that did not correspond with the targeted genes..

Figure 7 shows femA at 647 base pair in lanes 19, 38, 39 and 45, representing 12.9 % prevalence of femA gene within the population studied. There are other expressed multiple bands in lanes 25, 38, 40, 41 and 45; they are unique bands that did not correspond with the targeted genes. This may form bases for further studies. femA gene is a chromosomally encoded factor, occurring naturally in Staphylococcus species, which is essential for expression of high-level methicillin resistance.

In this study, we could not find Bacterial Artificial Chromosome (Bac) gene -an insert cloning system for analyzing genomic structure for E. coli. Also, Thiosulphate Sulfur-Transferase (tst) gene -a protein that codes Toxic Shock Syndrome (TSS). None of the staphylococci expressed the presence of this virulent factor and Sea gene that is a specific enterotoxin A gene specific for Staphylococcus aureus.

ive control waslablled –ve (Neg ative). Lanes 6 Figure 8: RAPD gel image of multiple bands of polymorphism used for DNA fingerprinting of E. coli studied

Figure 8 shows RAPD gel image of multiple bands of DNA fingerprinting of the E. coli strains studied. Lanes 6 and 12 are non-typeable strains, probably unique to the study area that requires further sequencing.

In figure 9, a Dendrogram showing the genetic distance of E. coli obtained with the use of RAPD primer OPA.S30. The review was conducted by the statistical method NTSYS with the coefficient of similarities. Strain numbered negative control was the reaction mixture less the DNA oligonucleotide.

The figure 9 above presents the dendrogram of the clinical isolates. The strains were placed into groups, 1 and 2 which fall into 3 clusters. Cluster 1 had two isolates belonging to the same clone. Cluster 2 had two subgroups A and B. Sub group A had 2 strains with about 80 % similarity and a strain with 50% similarity. Sub group B had 3 strains; two of such had 90% similarity and a clone with about 80% similarity. Cluster 3 had two groups.

Figure 10 shows the gel image of polymorphs of the Staphylococci studied. Lanes 6, 12 and 21 appear to be non-typeable strains requiring further sequencing; they may be strains peculiar to the study area. This shows the extent of diversity of Staphylococci, which is usually broad and ubiquitous.

Figure 11 above shows dendrogram with distinct clustering. The study generated 6 main groups with 11 clusters (1 – 11). Cluster 1 of group1 was further categorized into sub-clusters A and B having about 40 % similarity. This group had about 90% of the strains isolated from Mushin LGA, Lagos state. The group 2 with 2 clusters and sub-cluster A and B harbored majority of isolates from Yaba LGA of Lagos state. Isolates from Surulere area cut across all groups probably because the hospital from where the strains were isolated is a faith-based outfit that ran free gynecological care for the public. Only group 1 cluster 2A and 5 clusters 7A, and 5 clusters 8 A had about 80% similarity. Majority of Staphylococci had cluster diversity > 50% similarity.

The Staph auras dendrogram generated 6 main groups with 11 clusters (1 – 11) figure 11. Cluster 1 of group1 was further categorized into sub-clusters A and B having about 40 % similarity. This group had about 90% of the strains isolated from Mushin LGA Lagos state. The group 2 with 2 clusters and sub-cluster A and B harbored majority of isolates from Yaba LGA of Lagos state. Isolates from Surulere cut across all groups; the hospital from isolates were gotten is a faith-based clinic that ran free gynecological care for the public. Only group 1 cluster 2A and 5 clusters 7A, and 5 clusters 8A had about 80 % similarity. Majority of Staphylococci had cluster diversity > 50% similarity. The cluster harboring strains from Yaba LGA showed that strains might have emanated from one clone.

On the molecular characterization of two most prevalent bacterial isolates, 16 surviving E. coli and 31 Staphylococci were characterized using PCR multiple primers presented in table 1 above. The organisms were MDR strains. In recent times antibiotics has been implicated in promoting genetic variability of bacteria. In addition to resistant variants, antibiotics have also shown to select mutator clones thereby stimulating evolution towards further resistance⁵⁴; hence, resistance to antibiotics has threatened the entire world as mentioned by WHO⁵⁸. From this study, 6.3% prevalence each of bla_SHV and OXA genes were recorded among E. coli studied. They were Ambler group A and D ESBLs gene respectively found usually among Gram-negative organisms as reported by Drawz & Bonomo ⁵⁹.

Ambler group A enzymes are known to be plasmid mediated ampicillin resistant gene, while group D (serine oxacillinases) could hydrolyze oxacillin and penicillin. It confers resistance to coxacillin, extended-spectrum cephalosporin (OXA-type ESBLs), and carbapenems (OXA-type carbapenemases)⁵⁹. Generally speaking, OXA enzymes are resistant to inhibition by clavulanate, sulbactam, and tazobactam and are found among E. coli resistant to ceftazidime ⁵⁹. In addition, 25 % prevalence was recorded of blaCTX-M gene -a group A β-lactamase gene conferring resistance to cefotaxime antibiotic. The gene CTX-M arose by plasmid transfer from preexisting chromosomal ESBL genes from Kluyvera spp., which typically are nonpathogenic commensal organisms⁵⁹. The identification of genes homologous to those from enterobacteriaceae is not surprising given the prevalence of resistance genes among members of this family. Global spread of CTX-M producing multidrug resistant E. coli strains among the urinary tract infections in community setting has been reported since 2006⁶⁰. It has been reported that CTX-M ESBLs represent important enzymes found in isolates from the community and are the most commonly isolated ESBLs in many parts of the world, particularly Europe⁶¹. However, what is worrisome is that this specific amplicon also amplified other none targeted genes (figure 3). Amplified multiple genes that resembled bla_TEM genes from some unusual sources were equally reported by Fouhy et al⁶². This could provide an insight into other possible novel/unusual sources of resistance genes, including those that the culture-based approaches would fail to detect routinely. This requires further studies.

The entire strains positive for ESBLs genes had MIC as low as 4mg/L to as high as 256 mg/L (report not included here). However, not all phenotypically positive strains were positive genetically. The reason may be that the targeted gene was different from the actual gene conferring the resistance to the organism. Again, in this study a strain of E. coli harbored 3 different resistant genes namely bla_SHV, bla_CTX-Mand OXA. This single strain could be source of spread of resistomes vertically or horizontally within the community.

Recall that carbapinamases groups were assigned based on amino acid homology into Ambler group A ESBLs (TEM, SHV, CTX-M and KPC), they are serine carbapenemases known to hydrolyze and cause resistance to oxyimino-cephalosporines (ceftazidime and cefotaxime) and Aztreonam, mostly amongst enterobacteriaceae^{63, 64}. From similar previous studies, TEM and SHV ESBL types were the major families of ESBLs associated with resistance with gram negative pathogens. Today CTX-M (specifically CTX-M-15, CTX-M-14 & CTX-M-27 respectively) enzymes are the most dominant ESBL type globally⁶⁵. The report of this CTX-M prevalence of 25 % from the community is worrisome. As at 2021, about 243 variants of TEM and 228 variants of SHV have been reported⁶⁵.

Again, Class B - metallo-β-Lactamases (IMP, VIM and SPM), are zinc (Zn²⁺) mediated B-lactamase enzymes that can induce hydrolysis of a variety of beta lactams antibiotics except monobactam (aztreonam)⁶⁶. Both groups exhibit different mechanisms of hydrolytic effect on β-lactam drugs. This group of enzyme tends to evade all recently produced β-lactam-β-lactamase inhibitor combinations thereby making disease treatment difficult⁶⁷. However, this study did not cover all variants of these genes.

Group C (Amp C) are either resident chromosomal genes (cAmpCs) or plasmid-encoded (pAmpCs) and can either be inducible or constitutive, resulting in different resistance phenotypes⁶⁸. Usually, pAmpCs is common in community-acquired infections by the Enterobacteriaceae family; the phenotypic screening result has been published in another report. Essentially, The Ambler C group contains important enzymes such as the penicillinase and cephalosporinase, their activities results in low level resistance to the so called narrow-spectrum cephalosporin antibiotics. In this study, neither group B nor C resistomes were reported, most probably because those that were expressed phenotypically were not targeted genetically and this calls for further study.

For group D – (OXA) known as oxacillinase type β-lactamase-encoding genes is one of the most important carbapenem resistance mechanisms making disease treatment difficult⁶⁶. Although this report recorded low (6%) prevalence rate among E. coli, Singh et al⁶⁹ reported 40 % prevalence OXA-48 prevalence among E. coli isolates. Although the study designs, site/population and period of time (2017 vs 2022) are at variance. Conversely, it could underscore the rapid rate of spread of this resistome over the years.

The presence of these enzymes makes treatment with certain broad-spectrum cephalosporin almost impossible, leading to high morbidity and sometimes mortality. Worst still, some enzymes have been associated with resistance to other non-betalactam antibiotics like aminoglycosides and chloramphenicol⁷⁰, which are hitherto drugs of choice among resource poor countries like Nigeria.

Furthermore, this study reports 18.8 % prevalence of enterohemorrhagic E. coli 0157:H7 EDL933 -a pathogenic sub-type from the semen of some fertility care-seeking men. Enterohemorrhagic Escherichia coli O157 (EHEC O157), also known as verocytotoxin producing or shiga toxin producing pathogen⁷¹. Cattles are the natural reservoir of the organism; contributing as a major zoonotic source. The public health concerns of EcO157 became known at first after its first outbreak reported in the USA in 1982⁷¹. The primer TEcoli employed in this study is a virulent factor gene (Tuf); an elongation factor for Escherichia coli 0157:H7 EDL933, which is a specific pathogen housekeeping gene, used for diagnostic purposes. Although, E. coli is by far the most common pathogen isolated from urinary tract infections (UTI), and frequently originates from the patient’s own intestinal flora, the presence of this strain in semen portends danger. From previous reports, only some members of the normal flora elicit an infection in persons without local or general predisposing conditions to UTI⁷². Special components or products, called virulence factors, enable E. coli cells to colonize selectively the mucosal uro-epithelium, evoke an inflammatory reaction and eventually proceed from the lower urinary tract to the renal cavities and tissues⁷². Those strains associated with UTI are called uropathogenic E. coli. Essentially, it is instructive to note that the presence of enterohemorrhagic E. coli in the semen is worrisome. This Shiga-like toxin (SLT)-producing E. coli is well recognized as a human pathogen causing serious illness as mentioned before, in the form of hemorrhagic colitis and hemolytic-uremic syndrome, capillary thrombosis, diarrhoea^{73, 74}. The pathogenic mechanisms utilized by this strain in the course of semen infection are poorly characterized, but it seems to involve the production of Shiga-like toxins (SLTs). One of these toxins, Shiga-like toxin II (SLT-II), expressed either alone or in concert with Shiga-like toxin I (SLT-I), seems to be produced by most E. coli 0157:H7 strains associated with human disease⁷³. The epidemiology of E. coli 0157:H7 infections are poorly understood. Large outbreaks of O157:H7 infection have occurred all over the world including Fukuoka, Okayama, Osaka and Hiroshima in Japan in 1996, central Scotland in 1996, Germany from 1988 through 1998 and multistate outbreaks in the US in the past few years⁷⁴. The greater concern is the practice of oral sex, which is becoming a norm among young adults and homosexuals practicing anal sex. Mostly, men with retrograde ejaculatory challenges may harbor this organism. Thus, the patronages of this kind of sex life could cause outbreak of diarrhea and other toxigenic diseases. Isolation of this strain was equally reported from UTI in Germany⁷⁴. There is poor documentation of outbreaks in Africa. As agent of infertility, E. coli has been reported to induce apoptosis in human sperm by direct cytotoxic activity of bacterial toxins⁷⁵.

Considering Staphylococci, the most isolated Gram-positive organism from this study, mecA prevalence of 22.6% was found. Methicillin resistance in staphylococci is caused by the acquisition of an exogenous gene that encodes an additional β-lactam-resistant penicillin-binding protein (PBP), termed PBP 2a (PBP2’). It is reported to have originated from a mobile genetic element called Staphylococcal cassette chromosome Mec (SCCmec) invariably inserted into orfX gene of methicillin-resistant Staphylococci, and is the genetic basis for methicillin resistance⁵⁴. The presence of the mecA gene is the “gold standard” for determining methicillin resistance ⁵³. A multicenter study in Southwestern Nigeria confirmed resistance to methicillin by the detection of the mecA gene applying PCR method and reported a lower prevalence rate of 1.4% ⁷⁶. Shittu et al.⁷⁷ reported two S. aureus strains in semen isolates from Meiduguri (Northern Nigeria) harboring mecA, tet and ermA genes among others. Although, Adesida et al.⁷⁶ reported that SCCmec gene as the major the clones of MSSA that circulates in Nigeria, and the MRSA incidence was still low, there was sharp increase from low (1.4%) in 2005 to 42.3% high by 2015 as reported by Alli et al.⁷⁸ in Oshogbo South West Nigeria of MecA gene. This shows that epidemic looms in Nigeria, although Enwuru et al.⁷⁹ reported 17% prevalence of MecA genes from Lagos hospital isolates. Most of these studies were restricted to Staphylococcus aureus alone and geographical location and environmental factors might be a source of variability. Rozalska & Szewczyk ³⁷, for instance, reported 60% SCC MecA gene from 361 Staphylococcus Cohnii spp. Cohnti isolated in Poland and another 60% of MecA genes were reported from Belgium⁸⁰. These are higher than this report and general prevalence reported in Nigeria. However, site of bacterial isolation and geographical location may be factors of variability as mentioned before. Also, mecA gene positive Staphylococci isolates were reported to carry in their cells many plasmids with a wide range of sizes (<2 to > 56 Kb) and differ in plasmid patterns³⁷. However, Xiaoliang et al.⁸¹ reported that some clinical S. aureus may be methicillin resistant on an in vitro susceptibility testing but lacks the MecA gene.

On the other hand, prevalence of 12.9% was reported of femA gene among the Staphylococcus species studied. femA gene is a chromosomally encoded factor, occurring naturally in Staphylococcus aureus, which is essential for expression of high-level methicillin resistance. According to Feng et al. ⁸⁰, mecA and femA are the genetic determinants of methicillin resistance found between 310 and 686-bp amplicon regions. Coagulase negative Staphylococci lack femA gene and those that are susceptible lack MecA gene ^{37, 38}. However, certain researchers have reported it among CoNS^{82, 83}. The implications of this is that CoNS are adjudged to be non-pathogenic, but a reservoir of dangerous genes conferring resistance. Acquisition of the SCCmec gene by some multi-resistant MSSA and coagulase negative strains could make infection control measures extremely difficult and could have serious consequences; horizontal gene transfer is a threat to public health, because previous report on isoelectric focusing observed transfer of beta- lactamases carried by R-factor vertically and horizontally among bacterial pathogens⁸⁴.

In this study, S. aureus enterotoxin A gene (sea) was negative, probably because the isolates were from semen (naturally sterile) or it is absent specifically with the targeted primer. Many bacteria produce secreted virulence factors called exotoxins. Exotoxins are often encoded by mobile genetic elements; they are virulence genes that are responsible for many of the symptoms associated with the human disease, particularly with certain strains of Staphylococci⁸⁵.

This study found 3.2% prevalence of ermA resistant gene among the Staphylococci. The ermA (erythromycin- resistant methylase) is a gene demonstrating macrolide, lincosamid and streptoreamine B resistance among some Gram positive bacteria. This was seen among CoNS that was multidrug resistant. Macrolide, Lincosamide, and Streptogramin (MLS) antibiotics are widely used in the treatment of Staphylococcal infections. Shittu et al.⁷⁷ reported 6 strains of Staphylococcus aureus from wounds and semen among the population they studied. All the 6 were from Maiduguri, northern Nigeria. None was reported in Lagos. Juda et al.⁸⁶, reported prevalence of 14.8% among S. epidermidis isolates from Nigeria. The ermA gene was detected in a rather high per cent of methicillin-resistant coagulase-negative Staphylococci (16.7%) in France⁸⁷. It was reported that CoNS are potential reservoirs of antibiotic resistance genes, which can be transferred to S. aureus not only in vitro but also in vivo⁸⁸. Erythromycin resistance among CoNS was previously reported to result from a methylase encoded by different erm family genes that can be horizontally transferred to recipient strains⁸⁹. Hence, surveillance of erythromycin resistance and MLS_B resistance in CoNS at phenotypic and genetic levels can provide important information regarding their current epidemiology. The double-disk diffusion technique with erythromycin and lincomycin (or clindamycin) is useful to guide interpretation of the susceptibility test in clinical bacteriology laboratories⁹⁰.

In this study, the Clonality of resistant E. coli was determined using Rapid Amplification Polymorphic DNAs (RAPD) PCR. The primer used was operon (OPA) S30. The S30 system contains an S30 premix without amino acids for RAPD fine structure, mapping of genes without cloning steps. Figure 8 shows the E. coli strains finger printing with lanes 6 and 12 showing non-typeable strains. Dhanashree et al.⁹¹ reported 5 non-typeable strains using RAPD PCR from North America. It is interesting that both strains were found within Ikate community of Surulere LGA of Lagos state makes the strains unique and should be subsequently sequenced.

Figure 9 is the dendrogram showing the clonal dissemination of E. coli strains between the communities. The dendrogram generated 2 main groups (group 1and 2), and three clusters (clusters 1, 2 and 3) which are isolates from a single phylogenetic group, closely related and indicative of how far the strains isolated from the communities were closely related. For instance, cluster 3 had two groups. Group A cut across Main Land, Surulere and Mushin LGAs of Lagos. It has two strains from Yaba and another from Ikate with 80% similarity. The strain EC4 appears to be single strain of about 66% similarity. The two strains (Ap514 and 784) are from different phylogenetic origin and could be sequenced further as local control strains. This method could be of good use in tracking sources and routs of transmission of ESBLs resistant bacterial strains and their public health challenges. Generally, E. coli causes diseases in intestinal and extra-intestinal environments through acquired virulence factors, horizontal gene transfer, genetic recombination and natural selection⁹².

For S. aureus, RAPD-PCR biodiversity showed broader clonal characteristics. The dendrogram obtained clearly showed distinct clustering and generated 6 main groups with 11 clusters (1 – 11) figure 11, Cluster 1 of group1 was further categorized into sub-clusters A and B having about 40% similarity. This group had about 90% of the strains isolated from Mushin LGA, Lagos state. The group 2 with 2 clusters and sub-cluster A and B harbored majority of isolates from Yaba, LGA, Lagos state. Isolates from Surulere cut across all groups; the hospital from where the specimens were collected is a faith-based outfit that ran free gynecological care for the public. Only group 1 cluster 2A and 5 clusters 7A, and 5 clusters 8A had about 80% similarity. Majority of Staphylococci had cluster diversity > 50% similarity. The cluster harboring strains from Yaba LGA showed that strains might have emanated from single phylogenetic origin.

If the clonality is related with the existence of resistance gene, three out of the four Staphylococci progeny that expressed femA gene, were Staphylococcus aureus (SA) as expected, however, one was CoNS and expressed both femA and mecA genes. This is not in agreement with the majority reports that femA is specific for SA³⁸. However, homologous genes for femA presence have been reported among CoNS in certain studies^{82, 83}. The latter is in line with this present report. Out of those, one was from group 4 cluster 7; another, from group 6 cluster 10 A, and one from group 2 cluster 4 A. All the three isolates were from Surulere LGA of Lagos state, including the CoNS that harbored both femA and mecA genes. The strains harboring mecA gene were mainly from Mushin LGA of Lagos. The implication is that the genes are most probably vertically transmitted.

Generally speaking, Abdulgader et al.⁹³, in a review article of 34 reports from 15 countries on “Molecular epidemiology of Methicillin-resistant S. aureus in Africa” reported adequate genotyping data and that there were no clear distinctions observed between MRSA responsible for hospital and community infections in the clonal diversities in Africa. However, the review further remarked that some clones are limited to specific countries or regions; including Nigeria. The spread of various clones between the hospital and community settings has made the dichotomous ranking difficult⁹³.

While, the genetic analysis using RAPD typing has been acknowledged to be one of the best tools for analyzing the genetic correlation among the closely related bacterial population⁹⁴, there are other methods: e.g. Restriction Fragment Length Polymorphism (RFLP), Amplified Fragment Length Polymorphism (AFLP) and others⁹⁵. Research cost and easy handling influenced the choice of the technique employed in this study. There is therefore need to further engage in a larger population bacterial diversity surveillance studies to tract the dynamics of resistomes and mobile genetic elements in and within microbiota of man, animal and the environment.. This will close the gaps on lack of adequate data on bacteria and antibiotics surveillance for effective control of spread of resistance genes in Nigeria in particular and Africa in general.

Contrary to the general suggestion that infertile couple be assessed as a unit, it was very difficult to assert in view of African cultural background, treating man as super human who finds it difficult to openly discuss sex health challenges in the presence of the wife. The RAPDs technology provides indirect data that is only useful when converted into distance measures. This enables frequency data and distance measures to be determined for each genotype class, but does not enable the classes to be ordered or grouped. Data based on DNA sequences or restriction site mapping, on the other hand, provide the means of both classifying individuals into different classes and of assessing relationships among the classes, these views are equally expressed by Ehling-Schulz & Messelhausser⁹⁵.

TIFF

Target Image Files Format

RAPD

Random Amplification Polymorphic

PCR

Polymerase Chain Reaction

RFLP

Restriction Fragment Length Polymorphism

AFLP

Amplified Fragment Length Polymorphism

MRSA

Methicillin Resistant Staphylococcus aureus

CoNS

Coagulase Negative Staphylococcus

IRB

Institutional Review Board

UPGMA

Unweighted Pair Group Mathematical Averages

CLSI

Clinical Laboratory Institute’s Standard

SCCmec

Staphylococcal Cassette Chromosome Mec)

Authors Contributions

CAE and BAI considered and designed the research, and CAE, BAI and MAF developed the laboratory protocols. CAE, NVE, and MAF performed the field trips and conducted the laboratory experiments. BAI & FON supervised the work. FON, BAI, and CAE conducted the data entry and interpreted the findings using relevant statistical packages. CAE and FON wrote the draft of the manuscript and reviewed the literature. All the authors have read and approved the final manuscript.

Ethics Approval and Consent to participate

Ethical approval of the study was granted by the Institutional Review Board (IRB) of the Nigerian Institute of Medical Research (NIMR), Yaba, Lagos. No: NIMR IRB dated 28^th. September, 2009. The study was conducted in conformity with all stipulated ethical protocols according to the Helsinki Declarations. Written informed consent from the patients was obtained after the objectives and procedures of the study were carefully explained to each of the potential participants. All records of the participants’ identity were kept confidential in the course of the study. Results were made available to the participants where necessary to seek for help with their urologist.

Consent for publication

Not applicable in this study

Conflict of Interest

Authors declare no conflicting of interest

Author Details

¹Center for Infectious Disease Research, Microbiology Department and Molecular Biology and Biotechnology Department, Nigerian Institute of Medical Research (NIMR), 6 Edmund Crescent (Off Murtala Mohammed Way) PMB, 2013, Yaba, Lagos-Nigeria.

²Faculty of Pharmacy and Faculty of Medical Science, Lagos University Teaching Hospital (LUTH), Idiaraba, Lagos, Nigeria

Acknowledgements

I express my deep appreciation to my supervisor Prof. Oluwadun Afolabi of blessed memory, a professor of Microbiology of the famous Olabisi Onabanjo University (OOU), Ogun State and the entire faculty officers for their various helps and commitments. I appreciate Professor Oliver Ezechi, Director Research, Clinical Science Department, Nigerian Institute of Medical Research, Yaba, Lagos for his expertise contributions. Also, I appreciate the laboratory staff of both the CIDR and the Molecular & Biotechnology Department of NIMR where the experiments were carried out. I thank the urologists and nurses at the various study centres where the samples were sourced and in particular Mr. Jide Bamiro of O & G laboratory of the Lagos University Teaching Hospital (LUTH), idiaraba, Lagos.

Funding

The research was a self-funded PhD. Academic program.

Availability of data and materials

The specific oligonucleotide primers were designed according to DNA sequences deposited in the GenBank “https://www.ncbi.nlm.nih.gov/genbank/" The primers were designed with the “Pick Primers” program (http://biotools.umassmed.edu) according to the sequences found at NCBI database⁵⁴. All other data generated are either published previously or are contained in this report.

Dutta S, Sengupta P, Izuka E et al. U. Staphylococcal infections and infertility: mechanisms and management. Mol Cell Biochem. 2020; 474 (1–2):57–72. https://doi.org/10.1007/s40142-013-0027 Accessed 15 Jan. 2024.
Zorrilla M, Yatsenko AN. The Genetics of Infertility: Current Status of the Field. Curr Genet Med Rep. 2013;1(4). 10.1007/s40142-013-0027-1.
Bhattacharya K et al. Reproductive Tract Microbiome and Therapeutics of Infertility. Middle East Fertility Society Journal. 2023; 28, (1): 1–14, https://doi.org/10.1186/s43043-023-00136-8. Accessed 15 Jan. 2024.
Gerais AS, Rushwan H. Infertility in Africa. Popul Sci. 1992;12:25–46.
Onemu SO, Ibeh IN. Studied on the significance of positive bacterial semen cultures in male fertility in Nigeria. J Fertility Woman’s Med. 2001;46(4):210–4.
Bar-chama N, Fisch H. Infection and pyospermia in male infertility. World J Urol. 1993;11(2):76–81.
Imade GE, Towobola OA, Sagay AS, Otubu JA. Sexually transmitted diseases and medico-social factors associated with male infertility in Nigeria. Archives of AIDS Research. 1993; 7(3–4): 245–252, 7. Accessed November 2000 from.[email protected]:www.dralpani.com/successstories-45htm.
Sikka SC, Andrology Lab. Corner: Role of Oxidative Stress and Antioxidants in Andrology and Assisted Reproductive Technology. Journal of Andrology. 2004; 2 5(1): 5–18. Retrieved 29 June 2000 from 10.1002/j.1939-4640. 2004.tb02751.x.
Zeyad A, Amor H, Eid-Hammadeh M. The Impact of Bacterial Infections on Human Spermatozoa. Int J Women’s Health Reprod Sci. 2017;5(4):243–52.
Diemer T, Huwe P, Ludwig M, Schroeder-Printzen I. Influence of autogenous leucocytes and Escherichia coli on sperm motility parameters in vitro. Andrologia. 2003;35:100–5.
Sarowska, Jolanta et al. Virulence Factors, Prevalence and Potential Transmission of Extraintestinal Pathogenic Escherichia coli Isolated from Different Sources: Recent Reports. Gut Pathogens. 2019; 11. https://doi.org/10.1186/s13099-019-0290-0. Accessed 16 Jan. 2024.
Ingle DJ et al. In Silico Serotyping of E. Coli from Short Read Data Identifies Limited Novel O-loci but Extensive Diversity of O:H Serotype Combinations within and between Pathogenic Lineages. Microbial genomics. 2016; 2 (7). https://doi.org/10.1099/mgen.0.000064. Accessed 16 Jan. 2024.
Manges Amee R et al. Global Extraintestinal Pathogenic E. coli (ExPEC) Lineages. Clinical Microbiology Reviews. 2019; 32 (3). https://doi.org/10.1128/CMR.00135-18. Accessed 16 Jan. 2024.
Lixin Z, Betsy F. Molecular Epidemiology of E. coli Mediated Urinary Tract Infections: Frontiers in Bioscience. 8, e235–244, Jan. 1, 2003.
Mogra NN, Dhruva AA, Kothari LK. Non-specific Seminar track infection and male infertility: a bacteriological study. J Postgrad Med. 1981:\;;27(2):99–104.
Moretti E, Capitani S, Figura N. Presence of bacteria species in semen and sperm quality. J Assist Reproductive Genet. 2009;2:47–56.
Abarikwu SO. Causes and Risk Factors for Male-Factor Infertility in Nigeria: A Review. Afr J Reprod Health. 2013;17(4):150–66.
Barlow M, Reik RA, Jacobs SD. High rate of mobilization for bla_CTX-MS. Emerging Infectious Disease, CDC. 2008; 14(3):423 – 28.
Lewis R. The Rise of Antibiotic Resistance Infections. The Food and Drug Administration, USA, Consumer Magazine, September issue.1995; 1–5.
Cohen ML, Auxe RV. Drug resistant Salmonella in the United States: an epidemiologic perspective. Science. 2017;234(4779):964–70.
Li J, Ahmed S et al. Antimicrobial Activity and Resistance: Influencing Factors. Frontiers in Pharmacology, Xie S, Ahmed S, Antimicrobial Activity and Resistance: Influencing Factors. Frontiers in Pharmacology. 2017: vol. 8, https://doi.org/10.3389/fphar.2017.00364. Accessed 16 Jan. 2024.
World Health Organization. Antimicrobial, Resistance. Global Report on Surveillance 20 Avenue Appia, 1211 Geneva 27 – Switzerland, 2014; 1–256.
Katale BZ, Misinzo G, Mshana SE, et al. Genetic diversity and risk factors for the transmission of antimicrobial resistance across human, animals and environmental compartments in East Africa: a review. Antimicrob Resist Infect Control. 2020;9:127. https://doi.org/10.1186/s13756-020-00786-7.
Munita JM, Arias CA. Mechanisms of Antibiotic Resistance. Microbiol Spectre. 2016;4(2):1–37. 10.1128/microbiolspec.VMBF-0016-2015.
McManus MC. Mechanisms of bacterial resistance to antimicrobial agents. American Journal of Health System Pharmaceuticals. 1997; 54:1420 – 1433.
Frost LS, Leplae R, Summers AO, Toussaint A. Mobile genetic elements: the agents of open source evolution. Nat Rev Microbiol. 2005;3(9):722–32. 10.1038/nrmicro1235.
Santajit S, Indrawattana N. Mechanisms of Antimicrobial Resistance in ESKAPE Pathogens. Biomed Res Int. 2016; 2016:2475067. 10.1155/2016/2475067.
Bush K, Jacoby GA. Updated functional classification of beta-lactamases. Antimicrob Agents Chemother. 2010;54(3):969–76. 10.1128/AAC.01009-09.
Shalini K, Colleen JT, Ashley EF et al. Environmental Hotspots for Antibiotic Resistance Genes. MicrobiologyOpen. 2021; 10 (3). https://doi.org/10.1002/mbo3.1197. Accessed 5 Feb. 2024.
2016; Center for disease Control (CDC). National Center for Emerging and Zoonotic Infectious Diseases., America. ttps://www.cdc.gov/ncezid/pdf/accomplishments-2016, 1–20.
Wachino J, Yamane K, Suzuki S, et al. Prevalence of fosfomycin resistance among CTX-M-producing E. coli clinical isolates in Japan and identification of novel plasmid-mediated fosfomycin-modifying enzymes. Antimicrob Agents Chemother. 2010;54:3061–4. http://dx.doi.org/10.1128/AAC.01834-09.
Lee SY, Park YJ, Yu JK, et al. Prevalence of acquired fosfomycin resistance among extended-spectrumB-lactamase producing E. coli and K. pneumonia clinical isolates in Korea and IS26-composite transposon surrounding fosA. J Antimicrob Chemother. 2012;67:2843–7. http://dx.doi.org/10.1093/jac /dks319. 3.
Ho PL, Chan J, Lo WU, et al. Plasmid-mediated fosfomycin resistance in E. coli isolated from pig. Vet Microbiol. 2013a;162:964–7. http://dx.doi.org/10.1016/j.vetmic.2012.09.023.
Ho PL, Chan J, Lo WU, et al. Dissemination of plasmid-mediated fosfomycin resistance fosA3 among multidrug-resistant Escherichia coli from livestock and other animals. J Appl Microbiol. 2013b;114:695–702. http://dx.doi.org/10.1111/jam.12099. 6.
Ho PL, Chan J, Lo WU, et al. Prevalence and molecular epidemiology of plasmid-mediated fosfomycin resistance genes among blood and urinary Escherichia coli isolates. J Med Microbiol. 2013c;62:1707–13. http://dx.doi.org/10.1099/jmm.0.062653-0.
Shore AC, Coleman DC. Staphylococcal cassette chromosome mec: recent advances and new insights. Int J Med Microbiol. 2013;303(6–7):350–9. 10.1016/j.ijmm.2013.02.002.
Rozalska EM, Szewcizyk EM. Staphylococcus cohnii Hemolysins –Isolation, purification and Properties. Folia Microbiology. 2008; 53(6): 521–526. Retrieved 5 December 2013 from http://www.biomed.cas.cz/mbu/folia/.
Feng Y, Chen CJ, Su LH, Hu S, Yu J, Chiu CH. Evolution and pathogenesis of Staphylococcus aureus: lessons learned from genotyping and comparative genomics. Federation Eur Microbiol Soc (FEMS) Microbiol Reviews. 2008;32:23–37.
Vannuffel P, Gigi J, Ezzedine H, et al. Specific detection of methicillin-resistant Staphylococcus species by multiplex PCR. J Clin Microbiol. 1995;33(11):2864–7.
Turner NA et al. Methicillin-resistant Staphylococcus Aureus: An Overview of Basic and Clinical Research. Nature Reviews Microbiology. 2019; 17(4): 203–218, https://doi.org/10.1038/s41579-018-0147-4. Accessed 15 Jan. 2024.
World Health Organization. WHO Reproductive Health Indicators for Global Monitoring: report of the second interagency meeting. 2001; Geneva: WHO/RHR/01.19: 1–51.
UNICEF/UNDP/WHO /World Bank. Special Programme for Research and Training in Tropical Disease (TDR). Guideline for preparing a grant Application to the TDR Steering Committee for implementation. 2004; Research: 16–17.
Pfizer, Labs. Patients information. LAB-0372-6.1b: Division of Pfizer Inc NY. NY 10017. Revised November 2021.https://www.accessdata.fda.gov/drugsatfda_docs/label/2021/05.
Shaban SF. Male infertility overview: assessment, diagnosis and treatment. University of North Carolina School of Medicine Press, Chapel Hill. NC. 2007; 1–20.
Cheesbrough M. Microbiological Tests. District Laboratory Practice in Tropical Countries. New York: Cambridge University Press; 2006. pp. 1–266. https://doi.org/10.1017/CBO9780511543470.002.
Clinical Laboratory Standards Institute (CLSI). Methods for dilution antimicrobial susceptibility tests for bacteria that grow aerobically, (6th ed.) approved standard M7-A6. CLSI, Wayne, Pa. 2003.
Sahm D, Thornsberry C, Mayfield D, Jones M, Karlowsky J. Multidrug-resistant urinary tract isolates of E. coli: prevalence and patient demographics in the United States in Antimicrob. Agents Chemother. 2001;45:402–6.
Maheux AF, Picard FJ, Boissinot et al. Analytical comparison of nine PCR primer sets designed to detect the presence of E. coli /Shigella in water samples. Water r e s e arch 2009; 4 3: 3 0 1 9 – 3 0 2 8. Retrieved 19 April 2014 from www.elsevier.com/locate/watres.
Bali EB, Leyla-Acik L, Sultan N. Phenotypic and molecular characterization of SHV, TEM, CTX-M and extended-spectrum β-lactamase produced by Escherichia coli, Acinobacter baumannii and Klebsiella isolates in a Turkish hospital. Afr J Microbiol Res. 2010;4(8):650–4.
Geha DJ, Uhl JR, Gustaferro CA, Persing DH. Multiplex PCR for identification of methicillin-resistant Staphylococci in the clinical laboratory. J Clin Microbiol. 1994;32:1768–72.
Pagani L, Emanuela D, Roberta M, Marco MD, Multiple. CTX-M-Type Extended-Spectrums -β-Lactamases in Nosocomial Isolates of Enterobacteriaceae from a Hospital in Northern Italy. J Clin Microbiol. 2003: 4264–9.
Maity B, Guru PY. Genetic diversity and molecular characterization of pathogenic Escherichia coli from different species of laboratory rodents. Indian J Biotechnol. 2007;6:210–5.
Ghebremedhin B, Olugbosi MO, Raji AM, et al. Emergence of a Community-Associated Methicillin-Resistant S. Aureus Strain with a unique Resistance Profile in Southwest Nigeria. J Clin Microbiol. 2009;47(9):2975–80.
Craciunas C, Butiuc-Keul A, Flonta M, Almas A, Brad A, Sigarteu M. Development of a PCR assay for identification of antibiotic resistance determinants at Staphylococcus aureus Analele University din Oradea - Fascicula Biologie Tom.XVII. 2010; (2):248–252.
Reinoso E, Bettera S, Frigerio C, DiRenzo M. RAPD-PCR analysis of Staphylococcus aureus strains isolated from bovine and human hosts. Microbiol Res. 2004;159:245–55.
Dice LR. Measurements of the amount of ecologic association between species. Ecology. 1945;26:297–302.
Sneath PHA, Sokal RR. Numerical taxonomy: the principles and practice of numerical classification. San Francisco, W.H. Freeman and Company. 1973: 1–573. Retrieved 10 February 2014 from ISBN: 0716706970.
World Health Organisation (WHO). Antimicrobial resistance: Key Facts 2023 https://www.who.int/news-room/fact-sheets/detail/antimicrobial-resistance.
Drawz SM, Bronomo RA. Three Decades of β-Lactamase Inhibitors. Clin Microbiol Reviews. 2010;23(1):160–201.
Marialouis XA, Santhanam A, Antibiotic Resistance. RAPD- PCR typing of Multiple Drug Resistant Strains of E. coli from Urinary Tract Infection (UTI). J Clin Diagn Res 2016; 10(3): DC05 - DC09.
Pitout JDD, Hamilton N, Church DL, Nordmann P, Poirel L. Development and clinical validation of a molecular diagnostic assay to detect CTX-M-type β-lactamases in Enterobacteriaceae. Clin Microbiol Infestations. 2007;13:291–7.
Fouhy F, Ross RP, Fitzgerald GF, Stanton C, Cotter PD. A degenerate PCR-based strategy as a means of identifying homologues of aminoglycoside and β-lactam resistance genes in the gut microbiota. BioMed Cent (BMC) Microbiol. 2014;14:25. http://doi.org/10.1186/1471-2180-14-25.
Rodrigues C, Joshi P, Jani SH, Alphonse M, Radhakrishnan R, Mehta A. Detection of β-lactamase in nosocomial Gram negative clinical isolates. Ind J Med Microbiol. 2004;22(4):247–50.
Jenkins S. Recent changes in Gram Negative Resistance: Algorithms for detecting and reporting ESBLs, AmpC and KPC- producing organisms. 40th. Annual Symposium Diagnostic and Clinical Challenges of 20th Century Microbes Philadephia, Health & Medicine, Education. 2010: 1–60. http://www.slideshare.net/featured/category/education.
Castanheira M et al. Extended-spectrum β-lactamases: An Update on Their Characteristics, Epidemiology and Detection. JAC-Antimicrobial Resistance.2021; 3 (3) https://doi.org/10.1093/jacamr/dlab092. Accessed 29 Jan. 2024.
Bradford PA. Extended-spectrum beta-lactamases in the 21st century: characterization epidemiology, and detection of this important resistance threat. Clin Microbiol Reviews. 2001;14(4):933–51.
Boyd SE, Livermore DM, Hooper DC, et al. Metallo-β-Lactamases: Structure, Function, Epidemiology, Treatment Options, and the Development Pipeline. Antimicrob Agents Chemother. 2020;64(10):e00397–20. 10.1128/AAC.00397-20.
Meini S, Tascini C, Cei M, et al. AmpC β-lactamase-producing Enterobacterales: what a clinician should know. Infection. 2019;47(3):363–75. 10.1007/s15010-019-01291-9.
Singh S, Pathak A, Fatima N et al. Characterisation of OXA-48-like carbapenemases in E. coli and K. pneumoniae from North India. Biotech. 2023; 3(13): 134. https://doi.org/10.1007/s13205-023-03537-8.
Thenmozhi S, Moorthy K, Sureshkumar BT, Suresh M. Antibiotic Resistance Mechanism of ESBL Producing Enterobacteriaceae in Clinical Field: A Review. Int J Pure Appl Bioscience. 2014;2(3):207–26.
Islam MZ, Musekiwa A, Islam K. Regional Variation in the Prevalence of E. coli O157 in Cattle: A Meta-Analysis and Meta-Regression, Zhang Q, editor PLoS ONE. 2014; 9(4): e93299. 10.1371/journal.pone.0093299.
Emody L, Kerenyi M, Nagy G. Virulence factors of uropathogenic Escherichia coli International Journal of Antimicrobial Agents. 2003; 22: S29 - S33. .
Bohm H, Karch H. DNA Fingerprinting of Escherichia coli 0157:H7 Strains by Pulsed-Field Gel Electrophoresis. J Clin Microbiol. 1992;30(8):2169–72.
Wua C-F, Valdes JJ, Bentley WE, Sekowski JW. DNA microarray for discrimination between pathogenic 0157:H7 EDL933 and non-pathogenic Escherichia coli strains. Biosens Bioelectron. 2003;19:1–8. .
Villegas V, Schulz M, Sotom L, Sanchez R. Bacteria induce expression of apoptosis in human spermatozoa. Apoptosis. 2005;10:105–10. Doi: 1007/s 10495-005-6065-8.
Adesida SA, Boelens H, Babajide B, et al. A. Major epidemic clones of Staphylococcus aureus in Nigeria. Microb drug Resist. 2005;11:115–21.
Shittu AO, Okon K, Adesida S, et al. Antibiotic resistance and molecular epidemiology of Staphylococcus aureus in Nigeria. BioMed Cent (BMC) Microbiol. 2011;11:92. http://www.biomedcentral.com/1471-2180/11/92.
Alli OA, et al. Association of virulence genes with mecA gene in Staphylococcus aureus isolates from Tertiary Hospitals in Nigeria. Indian J Pathol Microbiol. 2015;58(4):464–71. 10.4103/0377-4929.168875.
Enwuru NV, Adesida SA, Enwuru CA et al. Genetics of bi-component leukocidin and drug resistance in nasal and clinical Staphylococcus aureus in Lagos, Nigeria. Microbial Pathogenesis. 2018; 115: 1–7.
Feng Y, Chen CJ, Su LH, et al. Evolution and pathogenesis of Staphylococcus aureus: lessons learned from genotyping and comparative genomics. Federation Eur Microbiol Soc (FEMS) Microbiol Reviews. 2008;32:23–37.
Xiaoliang BA, Ewan MH, Giles FE. Novel mutations in penicillin-binding protein genes in clinical S. aureus isolates that are methicillin resistant on susceptibility testing but lack the Mec-gene. J Antimicrob Chemother. 2014;69:594–7.
Vannuffel P, Heusterspreute M, Bouyer M et al. Molecular characterization of femA from S. hominis and S. saprophyticus, and femA based discrimination of Staphylococcal species. Research in microbiology. 1999; 150: 129–141.
Veras JF, do Carmo LS, Tong LC, et al. A study of the enterotoxigenicity of coagulase-negative and coagulase-positive Staphylococcal isolates from food poisoning outbreaks in Minas Gerais, Brazil. Int J Infect Dis. 2008;12:410–5.
Mathew A, Harris AM, Miologyarshall MJ, Ross GW. The use of analytical isoelectric focusing for detection and identification of beta-lactamases. J Gen Microbiolog. 1975;88(1):169–78.
Casas V, Magbanua J, Sobrepena G et al. Reservoir of Bacterial Exotoxin Genes in the Environment – Research article. International Journal of Microbiology. 2010: 1–10. (ID 754368), 10.1155/2010/754368/.
Juda M, Chudzik-Rzad B, Malm A. The prevalence of genotypes that determine resistance to macrolides, lincosamides, and streptogramins B compared with spiramycin susceptibility among erythromycin-resistant S. epidermidis. Memórias do Instituto Oswaldo Cruz., Rio de Janeiro (Multiple languages). 2016; 111(3): 155–160. ISSN: 0074–0276; 1678–8060.
Lina G, Quaglia A, Reverdy ME, et al. Antimicrob Agents Chemother. 1999;43(5):1062–6. PMCID: PMC89111.
Otto M. Coagulase-negative Staphylococci as reservoirs of genes facilitating MRSA infection: Staphylococcal commensal species such as S. epidermidis are being recognized as important sources of genes promoting MRSA colonization and virulence. BioEssays. 2013;35(1):4–11. 10.1002/bies.201200112.
Vitali LA, Petrelli D, Lamikanra A, et al. Diversity of antibiotic resistance genes and staphylococcal cassette chromosome mec elements in faecal isolates of coagulase-negative Staphylococci from Nigeria. Br Med Council (BMC) Microbiol. 2014;14(106):1471–2180. https://doi.org/10.1186/1471-2180-14-106.
Waites K, Johnson C, Gray B, et al. Use of clindamycin disks to detect macrolide resistance mediated by ermB and mefE in Streptococcus pneumoniae isolates from adults and children. J Clin Microbiol. 2000;38:1731–4.
Dhanashree B, Mallya SP. Molecular typing of enteropathogenic Escherichia coli from diarrheagenic stool samples. J Clin Diagn Res. 2012;6(3):400–44.
McNally A, Cheng L, Harris SR, Corander J. The evolutionary path to extraintestinal pathogenic, drug-resistant Escherichia coli is marked by drastic reduction in detectable recombination within the core genome. Genome Biology and Evolution. 2013; 5(4): 5699–71010. 1093/gbe/evt038.
Abdulgader SM, Shittu AO, Nicol MP, Kaba M. Molecular epidemiology of Methicillin-resistant Staphylococcus aureus in Africa: a systematic review. Front Microbiol. 2015;6:348. 10.3389/fmicb.2015.00348.
Abou-Dobara MI, Deyab MA, Elsawy EM, Mohamed HH. Antibiotic susceptibility and genotype patterns of E. coli, K. pneuomoniae and P. aeruginosa isolated from urinary tract infected patients. Pol J Microbiol. 2010;59(3):207–12. http://www.pjmonline.org/.
Ehling-Schulz M, Messelhausser U. Bacillus next generation diagnostics: moving from detection toward subtyping and risk-related strain profiling - Review article. Front Microbiol. 2013;4:32.

No competing interests reported.

Download PDF

Version 1

posted

You are reading this latest preprint version

The Occurrence of Resistomes, Virulence Factors and Clonal Diversity of Escherichia coli and Staphylococci Isolated from the Semen of Men Attending Infertility Clinic in Lagos

Status:

Version 1

Abstract

Figures

Background

Materials and Methods

Results

Discussion

Conclusion and recommendation

Study Limitations

Abbreviations

Declarations

References

Additional Declarations

Status:

Version 1