Repeated dosed toxicity of hUC-MSCs
See Fig. 1 for detailed study schedule. Clinical symptoms were observed daily, observing the appearance, coat, activity, neurological signs, respiratory status, and body posture. All injection sites were examined for redness, swelling, induration, suppuration and necrosis. Body mass was measured with a floor scale. Body temperature was measured by anal thermometer. The Electrocardiogram (ECG) was recorded, and the indicators were calculated on the basis of the ECG recording, including heart rate, PR intervals, RR intervals, QRS durations, QT intervals, corrected QT intervals (QTc). Blood pressure was determined by non-invasive sphygmomanometry, including systolic blood pressure (SBP), diastolic blood pressure (DBP), and mean blood pressure (MBP). Urinalysis (including glucose, protein, bilirubin, urobilinogen, pH, specific gravity, occult blood, ketones, nitrite, white cell, and color) were performed using an AUTION AE-4020 automated urine chemistry analyzer. Blood was collected from a forearm vein. Hematologic analysis was performed using an ADVIA 2120 analyzer (Siemens; Munich, Germany), including white blood cell count (WBC), neutrophil count (Neut), lymphocyte count (Lymph), monocytecount (Mono), eosinophil count (Eos), basophil count (Baso). Serum was isolated and used for biochemical analysis using the automatic biochemical analyzer (7180, Hitachi, Japan), including alanine amino transaminase (ALT), spartate amino transaminase (AST), alkaline phosphatase (ALP), creatine kinase (CK), gamma glutamyl transpeptidase (GGT), lactate dehydrogenase (LDH), total bilirubin (TBIL), urea nitrogen (UREA), creatinine (CRE), glucose (GLU), total cholesterol (CHO), triglyceride (TG), total protein (TP), albumin (ALB), albumin/globulin ratio (A/G), serum potassium (Na+), serum natrium (K+), serum chlorine (Cl-), IgA, IgG, IgM, C3, and C4. Immunophenotyping of T lymphocyte was assessed by flow cytometry, including CD3+/CD4+T lymphocyte, CD3+/CD8+ T lymphocyte, CD4+/CD8+ ratio, CD4+CD25+Foxp3+ regulatory T cells (Treg). Flow cytometry was establishedto test the immunogenicity of stem cells (Fig. 2). hUC-MSCs were incubated with diluted serum samples for 30 minutes before incubating with goat anti rhesus IgG (H + L) antibody for the detection of anti-hUC-MSCs binding antibodies. The levels of TNF-α、IFN-γ、IL-2、IL-4、IL-5, and IL-6 in monkeys serum were evaluated by a BD Human Th1/Th2 Cytokine Kit II (BD, U.S.). The monkeys were anesthetized with an intramuscular injection of Zoletil 50 (0.1 mL/kg). Gross and histopathological examinations were performed, including: brain, pituitary gland, thyroid gland (with parathyroid glands), submandibular gland, spinal cord (cervical, thoracic, lumbar segment), thymus gland, sternum (bone marrow), heart, aorta, tongue, trachea, oesophagus, lungs (with bronchus), liver, gallbladder, kidneys, adrenal glands, spleen, pancreas, stomach, duodenum, jejunum, ileum, cecum, colon, rectum, testes, epididymis, prostate gland, seminal vesicles, ovaries, fallopian tubes, uterus (with cervix), vagina, bladder, bone (unilateral thigh bone), sciatic nerve, muscle (skeletal muscle), skin, mammary glands (females only), eyeballs, optic nerves, mesenteric lymph nodes, inguinal lymph nodes, site of injection, and site of lesion. Tissues and organs weighed include: brain, thyroid (including parathyroid), thymus, heart, lungs (including bronchi), liver, kidneys, adrenal glands, spleen, testes, epididymis, ovaries, uterus (with cervix).
In addition, peripheral blood of 300 µL was collected at 0, 5, and 30 minutes, 1, and 3 hours, 1, 3, 5, and 7days post the first administration, as well as 0, 5, and 30 minutes, 1, and 3 hours, 1, 3, 5, 7, 10, 14, and 29 days post the final administration. Tissue samples of blood, heart, liver, spleen, lungs, kidneys, brain, testes, epididymides, uterus, ovaries, stomach, intestine, fat, and skeletal muscle were collected, and the distribution of hUC-MSCs in blood was detected by Q-PCR method. DNA is extracted from various tissues using a blood and tissue kit (Qiagen, U.S.) and the concentration of elution DNA is adjusted to the actual range. The upstream and downstream primer sequences are "TGTCTTTTTCTTGTTTTGGAGGAA" and "CCAGACCACCCATAATCTTGTGT", respectively, and the probe sequences are "AGGAGCCCATCGGG". The primers above were designed and synthesized by Shanghai Shenggong Biological Engineering Co., Ltd. PCR reaction conditions were: 95°C for 10 mins, followed by 40 cycles of 95°C for 15 s and 60°C for 60 s. In this study, we used a TaqMan assay, in which a pair of primers and a specific fluorescent oligonucleotide probe was used. For each sample, three replicates were analyzed and the average of these replicates was calculated. Prior to PCR assay, DNA concentrations were measured with NanoDrop One to obtain genomic DNA content, and these concentrations were used to calculate the number of gene copies per nanogram of genomic DNA.
Animals were anesthesia by 35 mg/kg pentobarbital sodium, blood collection and necropsy were performed in a specific order (the Control Group, followed by the Low-dose Group and High-dose Group) to minimize potential confounders.