Cell culture
Two PA cell lines, GH1 and RC-4B/C, were obtained from Jennio Biotech (Guangzhou, China). The cells were cultured in RPMI1640 medium, supplemented with 100 U/mL penicillin, 100 mg/mL streptomycin, and 10% fetal bovine serum (FBS). All cell cultures were incubated under the following conditions: 95% humidity, 5% CO2 and 37°C.
Exosome isolation
Exosomes were collected via serial ultracentrifugation. Briefly, the supernatants of GH1 and RC-4B/C cells were subjected to ultracentrifugation at 110,000 × g for 70 min, and the exosomes obtained were purified by centrifugation at 110,000 × g for 1 h. The exosomes were then resuspended in PBS, filtered through 0.22-mm filters (C8848, Millipore, Boston, MA), and stored at -80°C in PBS until further experiments.
Transmission electron microscopy (TEM)
Purified exosomes were fixed in 2% paraformaldehyde, then a drop of exosome fractions floated on a nickel TEM grid lined with a formvar/carbon film and a mesh size of 400. The sample was stained with 2% uranyl acetate and imaged on a TEM (Hitachi H7600, Japan) at 80 kV.
Nanoparticle tracking analysis (NTA)
The sizes and numbers of exosomes were analyzed on the NanoSight NS300 system (Malvern Instruments, Westborough, MA, USA). In conclusion, exosomes were resuspended in PBS, diluted by a factor of 100–500 to yield between 20 and 100 objects per frame, then injected into sample chambers at room temperature, equipped with a 488-nm laser and a high-sensitivity sCMOS camera. A minimum of 200 completed tracks were examined per video, and the data analyzed using the NTA analytical 2.3 software (Shanghai XP Biomed Ltd., Shanghai, China).
Cell transfection
Short hairpin RNA (shRNA) targeting AFAP1-AS1 (sh-AFAP1-AS1-1: CCGGGAGTACATCACCTCAAATTATCTCGAGATAATTTGAGGTGATGTACTC-TTTTTT; sh-AFAP1-AS1-2: CCGGAGGCAGAACTGGAGAAGAAATCTCGAGATTTCTTCTCCAGTTCTGCCTTTTTTT), and negative control (NC: CCGGTTCTCCGAACGTGTCACGTCTCGAGACGTGACACGTTCGGAGAATTTTTT) lentivirus were purchased from Genechem (Shanghai, China), and were used to infect PA cell lines in the presence of polybrene (Sigma-Aldrich, St. Louis, MO, USA) at a concentration of 8 µg/mL. Puromycin (Thermo Fisher Scientific, Waltham, MA, USA) was included during transfections to select stable clones. Transfection efficiency was verified by quantitative real-time reverse transcription-polymerase chain reaction (qRT-PCR). Wild-type AFAP1-AS1 and mutant plasmids, as well as that overexpressing HuR, were constructed by Genechem (Shanghai, China). PA cells were transfected using Lipofectamine 3000 (Invitrogen, Carlsbad, CA, USA), according to the manufacturer's instructions.
CCK-8 assay
Approximately 3000 cells were first seeded and incubated overnight in 96-well plates, then treated with control exosomes, AFAP1-AS1-knockdown exosomes, HuR plasmid or AFAP1-AS1-knockdown exosomes + HuR plasmid for 0, 24, 48, 72h. CCK-8 reagent (10 µl/well) was added to the cells at specified time points, incubated for 2 h, then absorbance measured at 450 nm using a microplate reader (Thermo Fischer Scientific, Waltham, MA, USA).
Colony formation assay
Cells were seeded in 6-well plates, at a density of 1,000 cells per well, then incubated for two weeks at 37°C. Next, the cells were fixed with 4% paraformaldehyde and subsequently stained with 0.5% crystal violet.
Wound healing assay
PA cells were first seeded in 6-well plates, and incubated at 37°C until they reached 100% confluency. Next, a pipette tip was used to create a scratch, and wound closure was imaged after 48 h using a microscope equipped with a digital camera. Relative migration distance was measured using ImageJ software, by determining the fraction of cell coverage across the scratch. Relative migration distance was calculated using the following formula: (%) = migration area/total area × 100%.
Transwell assay
Matrigel coated invasion and polycarbonate membrane inserts with an 8 µm pore size were used in the Transwell assays. Approximately 1 × 104 cells were introduced to the upper chamber, while 10% FBS was simultaneously administered to the lower chamber. After 24h, the chambers were fixed and stained with 0.05% crystal violet for 2 h. The cells in the upper surface were delicately scraped off, the stained cells observed under a microscope equipped with a digital camera.
RNA extraction and qRT-PCR
Total RNA was extracted from PA cell lines using the TRIzol Reagent, according to the manufacturer's protocol. The RNA was reverse transcribed to cDNA using the PrimeScript RT reagent Kit (Takara, China), then subjected to qRT-PCR using the SYBR-Green PCR Master Mix (Takara, China). Amplification was performed on the applied Biosystems Quant Studio system (Thermo Fisher Scientific). Expression of the target genes was normalized to that of β-actin, and analyzed using the 2−ΔΔct method. Primer sequences are listed in Supplementary Table 1.
Subcellular fractionation
Nuclear and cytoplasmic RNA was isolated using the nuclear or cytoplasmic RNA purification Kit (Thermo Fischer Scientific), according to the manufacturer’s instructions. Cells were initially lysed on ice for 10 min using cell fraction buffer, then cytoplasmic and nuclear fractions separated via centrifugation for 5 min at 500 g. The RNA was converted to cDNA, then subjected to qRT-PCR using β-actin and U6 as cytoplasmic and nuclear markers, respectively.
RNA-fluorescence in situ hybridization (FISH)
This was performed using the Fluorescent in Situ Hybridization Kit (Ribo, Guangzhou, China), according to the manufacturer’s instructions. Briefly, cells were seeded onto cover slides, and AFAP1-AS1 detection achieved using a specific probe labeled with Cy3. Detection was done on a Nikon Eclipse Ti microscope equipped with a digital camera (Nikon, Kanagawa, Japan).
Extracellular acidification rate (ECAR) assay
ECAR and mitochondrial oxygen consumption rate (OCR) assays were performed using the Seahorse XF24 Extracellular Flux Analyzer (Agilent Technologies, Santa Clara, CA, USA), according to the manufacturer's instructions. Briefly, 8000 cells/well were seeded in a Seahorse XF96 culture microplate, rinsed with Seahorse buffer, then mixed with Seahorse buffer supplemented with oligomycin (1 µM), FCCP (1 µM) or rotenone (1 µM) to measure OCR. Similarly, glucose (10 mM), oligomycin (1 µM) or 2-deoxy-glucose (2-DG, 100 mM) were added to measure the ECAR. The obtained data were analyzed using the Seahorse software.
Lactate assay
Lactate concentration in cell supernatants was measured using a lactate assay kit (Nanjing Jiancheng Bioengineering Institute, Nanjing, China), according to the manufacturer’s instructions.
Mice xenograft assay
30 Male Nod-SCID mice (six weeks), were procured from the Laboratory Animal Center of Southern Medical University (Guangzhou, China), and randomly allocated into five groups (6 mice/group) prior to inoculation. Control, exosomes, NC exosomes, sh-AFAP1-AS1-1 exosomes, and sh-AFAP1-AS1-2 exosomes treated-GH1 luciferase cells (1 × 106) in 0.2 ml PBS were delivered into the tail veins of Nod-SCID mice. Cell metastasis was monitored weekly through Bioluminescence imaging on the IVIS system (Xenogen, Alameda, CA, USA), with mice receiving 150 mg/kg D-luciferin potassium salt (Caliper Life Sciences, Hopkinton, MA). The protocol used in animal experimental procedures was approved by the Institutional Animal Care and Use Committee of GuangZhou First people’s hospital, South China University of Technology (K-2021-041-01).
Hematoxylin-Eosin staining (H&E)
Paraffin-embedded lung tissue sections from mice were dewaxed via heating at 65°C for 2 h, hydrated, then cell nuclei and cytoplasm stained with hematoxylin and eosin solution (Biosharp, Anhui, China), respectively. The slices were then dried, and preserved in neutral resin (SCR, Shanghai, China).
Cycloheximide (CHX) chase assay
AFAP1-AS1-silenced exosomes treated GH1 cells were treated with cycloheximide (50 mg/ml) from 0 to 12 h, proteins extracted from the cell lysates using a lysis buffer containing 2% SDS, separated via SDS-PAGE, followed by western blot targeting the HuR antibody.
Western blot and coimmunoprecipitation (co-IP) assays
Proteins were extracted from PA cell lines using the RIPA buffer with protease inhibitor (Thermo Scientific, USA), and quantified using the BCA kit. to the proteins were separated on a 10% SDS-PAGE, transferred to polyvinylidene fluoride membranes (Millipore, USA). The membranes were hybridized overnight with primary antibodies CD9 (1:1000; Abcam, Cambridge, MA, USA), CD81 (1:1000; Proteintech, China), TSG101 (1:1000; Abcam), Alix (1:1000; Affinity, China), CDK2 (1:1000; Abcam), Cyclin D1 (1:5000; Proteintech), p21 (1:1000; Abcam), p27 (1:1000; Affinity), N-cadherin (1:5000; Abcam), Vimentin (1:1000; Abcam), MMP9 (1:1000; Abcam), E-cadherin (1:1000; Abcam), HuR (1:1000; Abcam), SMURF1 (1:1000; Proteintech), hexokinase-2 (HK2) (1:1000; Abcam) and pyruvate kinase-M2 (PKM2) (1:1000; Abcam) at 4°C, then incubated with a secondary antibody at room temperature for 1 h. Finally, the signal emanating from the membrane was detected using an ECL kit. For co-IP assay, 500 µg of proteins were first incubated overnight with primary antibodies HuR (Abcam), and SMURF1 (Proteintech) at 4°C, followed by a 4-h incubation with protein A/G beads at 4°C. The immunoprecipitated proteins were then eluted from the beads and subjected to western blot analysis using the indicated antibodies.
Ubiquitination assay
AFAP1-AS1-knockdown exosomes treated cells were treated with MG-132 (20 µM) for 8 h, proteins extracted using the IP lysis buffer, and incubated for 3 h with anti-HuR antibody at 4°C. The proteins were incubated overnight with A/G beads (Invitrogen) at 4°C. Precipitate protein complexes were subjected to western blot with anti-ubiquitin antibody (Cell Signaling Technology, Beverly, MA, USA).
RNA pulldown assay
Cells were transfected for 24 h with Biotin-labeled AFAP1-AS1 (GenePharma, Shanghai, China), lysed using lysis buffer containing magnetic beads, and incubated at room temperature with gentle rotation for 30 min. Next, the biotin-coupled RNA-coated beads were washed 4 times, purified, and subjected to western blot assay.
RNA-binding protein immunoprecipitation (RIP) assay
Cells were lysed with RIP lysis buffer, using magnetic beads washed with RIP wash buffer, followed by addition of anti-HuR (Abcam) and anti-IgG antibodies, then incubated for 30 min at room temperature. Total RNA was used as control during the RIP process. The samples were incubated overnight at 4°C, washed 5 times with the RIP wash buffer. Total RNA was extracted using the TRIzol method, reverse transcribed to cDNA, then subjected to qRT-PCR to determine expression of AFAP1-AS1.
Statistical analysis
Data were statistically analyzed using SPSS 22.0 (IBM, Chicago, USA) and GraphPad Prism 9.0 (San Diego, USA) software, and presented as means ± standard deviation. Comparisons between and among groups were performed using Student’s t-test and analysis of variance, respectively, and data with P-values of less than 0.05 considered statistically significant.