NMN partially rescues cuproptosis by upregulating sirt2 to increase intracellular NADPH

doi:10.21203/rs.3.rs-4112225/v1

Download PDF

Article

NMN partially rescues cuproptosis by upregulating sirt2 to increase intracellular NADPH

https://doi.org/10.21203/rs.3.rs-4112225/v1

This work is licensed under a CC BY 4.0 License

Journal Publication

published 20 Aug, 2024

Read the published version in Scientific Reports →

You are reading this latest preprint version

Cuproptosis is characterized by lipoylated protein aggregation and loss of iron–sulfur (Fe–S) proteins, which are crucial for a wide range of important cellular functions, including DNA replication and damage repair. Sirt2 and sirt4 are lipoamidases that remove the lipoyl moiety from lipoylated proteins using nicotinamide adenine dinucleotide (NAD⁺) as a cofactor. However, to date, it is not clear whether nicotinamide mononucleotide (NMN), a precursor of NAD⁺, affects cellular sensitivity to cuproptosis. Therefore, in the current study, cuproptosis was induced by the copper (Cu) ionophore elesclomol (Es) in HeLa cells. It was shown that Es/Cu treatment also increased cellular DNA damage level and induced G1 arrest. On the other hand, NMN treatment partially rescued cuproptosis in a dose-dependent manner, reduced cellular DNA damage level, and further increased the proportion of G1 phase cells. In addition, NMN upregulated the expression of Fe-S protein POLD1, without affecting the aggregation of lipoylated proteins. Mechanistic study revealed that NMN increased the expression of sirt2, as well as increased cellular reduced nicotinamide adenine dinucleotide phosphate (NADPH) level. Overexpression of sirt2 and sirt4 did not change the aggregation of lipoylated proteins, however, Sirt2, but not sirt4, increased cellular NADPH levels and partially rescued cuproptosis. Inhibition of NAD⁺ kinase (NADK), which is responsible for generating NADPH, abolished the rescuing function of NMN and sirt2 for Es/Cu induced cell death. Taken together, our results suggested that DNA damage and G1 arrest are characteristic features of cuproptosis. NMN can partially rescue cuproptosis by upregulating sirt2, increase intracellular NADPH content and maintain the level of Fe-S proteins, independent of the lipoamidase activity of sirt2.

Biological sciences/Biochemistry

Biological sciences/Cell biology

cuproptosis

DNA damage response

nicotinamide mononucleotide

sirt2

NADPH

A recent study by Tsvetkov and colleagues showed that excess copper (Cu) induces a novel form of regulated cell death (RCD) that is termed “cuproptosis”[1]. The aggregation of lipoylated mitochondrial enzymes and the loss of Fe–S cluster proteins are the two distinguished characteristics of cuproptosis. Fe-S clusters are conserved cofactors that are essential for redox reactions, enzyme catalysis, protein stability, and regulation of gene expression[2]. An estimated 60 human proteins contain Fe-S clusters, including key enzymes in DNA replication and repair, protein translation, and energy metabolism [3]. Specifically, during S phase of the cell cycle, Fe-S proteins are required for DNA replication [4]. Therefore, loss of Fe-S protein would suggest that cuproptosis might affect DNA replication and repair, and impair cell cycle. However, the effect of cuproptosis on DNA damage and cell cycle have not been clearly described.

In human, Fe-S cluster functions as sulfur donor for the biosynthesis of lipoic acid, and the lipoylation modification pathway are controlled by 3 enzymes, including Lipoyl(Octanoyl) Transferase 2 (LIPT2), Lipoic Acid Synthetase (LIAS), and Lipoyltransferase 1 (LIPT1) [5]. On the other hand, to date, only two lipoamidases, which remove the lipoyl moiety from the lipoylated protein, have been identified. The first one, Sirtuin 4 (Sirt4), was identified by Mathias and colleagues in 2014[6], while Sirt2 was identified in 2019, which exhibited about 400-fold higher delipoylation activity than Sirt4[7]. The sirtuins were originally identified as a family of nicotinamide adenine dinucleotide (NAD⁺)-dependent histone deacetylases [8], interestingly, Sirt2 and Sirt4 also depend on NAD⁺ for their lipoamidase activity[6, 7]. Since lipoylated dihydrolipoamide S-acetyltransferase (DLAT) and dihydrolipoamide succinyltransferase (DLST) aggregation is a key phenomenon of cuproptosis, it is of interest to know whether changes in sirt2 or sirt4 expression had any effect on cuproptosis via their lipoamidase activity. In addition, NAD⁺ can be converted to nicotinamide adenine dinucleotide phosphate (NADP) catalyzed by NAD⁺ kinase (NADK), and NADP⁺ then is reduced to NADPH by several dehydrogenases. In turn, NADPH serves as a donor of hydrogen and electrons, participating in Fe-S cluster biosynthesis[9]. Such information pointed to a potential regulatory role of NAD⁺ in cuproptosis. Besides its lipoamidase activity, sirt2 also is a play an important role in increasing intracellular NADPH levels through control the pentose phosphate pathway [10].

The study of NAD⁺ metabolism has been a hot topic in recent years. One key reason is that decreased NAD⁺ levels is associated with aging, and supplementation of NAD⁺ precursors, such as nicotinamide mononucleotide (NMN), can increase cellular NAD⁺ levels and showing beneficial effects in cell/animal models, as well as in preliminary clinical trials in human subjects [11] However, whether NMN can influence cuproptosis, let alone the underlying molecular mechanism, had not been examined. Thus, in this study, we investigated the impact of NMN on cuproptosis, and the results showed that NMN partially rescued cuproptosis. Further examination revealed that NMN upregulated the expression of lipoamidase sirt2 and increased intracellular NADPH. Nonetheless, and the lipoamidase activity of sirt2 was not required.

Cell lines, plasmids and chemicals.

HeLa cells were cultured in Dulbecco modified Eagle medium (DMEM) with 10% (v/v) of FBS, 2 mM glutamine, 1 mM sodium pyruvate, 100 U/mL penicillin and 100 mg/mL streptomycin at 37°C under 5% CO₂. The induction of cuproptosis was conducted as described by Tsvetkov [1]. Cells were grown in DMEM media with 10% (v/v) serum replacement (Gibco #10828028) and challenged with elesclomol (Es) and CuCl₂ (ratio 1:1) for 2 h, then cells were washed with PBS and cultured with DMEM with 10% copper free serum replacement before harvest.

The sirt2 (NM_012237.4)- and sirt4 (NM_012240.3)-expression plasmids were constructed using the pEX-1 vector.

Nicotinamide mononucleotide (NMN) (#GC16971), Tetrathiomolybdate (TTM) (#GC25991), Thionicotinamide (thioNA) (#GD22321), glycyrrhizic acid (GA) (#GN10553) were purchased from GlpBio Company (Montclair, CA, USA). CuCl₂ was purchased from Sinopharm Chemical Reagent Co., Ltd. (Shanghai, China).

RNA inference assay

The commercially synthesized siRNAs specifically targeting sirt2 (5’-CAGAGGCCAUCUUU GAGAUCA-3’), NADK (5’-GGAGAACATGATCGTGTAT-3’), or the non-specific control siRNAs (Riobo, Guangzhou, China) were transfected into HeLa cells using lipofectamine 3000 (Invitrogen, Carlsbad, CA, USA). The knockdown efficiency was confirmed by detecting the target genes' mRNA and protein levels.

Cell viability and cytotoxicity assays

Cell viability was determined with the CCK-8 kit (Beyotime, Shanghai, China). Briefly, cells were seeded into a 96-well plate and treated as indicated. At the end of treatment 10 µL CCK-8 reaction solution was added to each well, then the plates were placed in a humidity incubator for 40 min (37℃, 5% CO₂). The absorbance was measured at 450 nm using a SPARK microplate multimode reader (Tecan, Männedorf, Swiss). Each experiment was conducted at least three times independently.

Flow Cytometry Assay

The cell cycle distribution was determined by flow cytometry assay. In brief, cells were collected and fixed with 70% ethanol (Sangon Biotech, Shanghai, China) for 2 h and then stained with 0.3 mL propidium iodide (PI) (Beyotime Biotechnology, Shanghai, China) at 37℃for 30 min in dark. The cells were. The cell cycle distribution was examined using flow cytometry (BD, New Jersey, USA) and analyzed with the FCS Express Launcher software (De Novo Software).

Quantitative Real-time PCR (qPCR)

Total RNA was reverse transcribed using the Thermoscript™ RT-PCR System (Invitrogen, Carlsbad, CA, USA). qPCR was performed following the manufacturer’s instruction (Takara Bio Inc. Otsu, Japan) with specific primers (Table 1). qPCR data were presented using the 2-ΔΔCt method with β-actin as the internal control.

Table 1

Primer sequences for qPCR.
Primer	Sequence (5'-3')
DLAT	For: CGGAACTCCACGAGTGACC
	Rev: CCCCGCCATACCCTGTAGT
DLST	For: GAACTGCCCTCTAGGGAGAC
DLST	Rev: AACCTTCCTGCTGTTAGGGTA
POLD1	For: GACTACACGGGAGCCACTGTCA
POLD1	Rev: GTAACACAGGTTGTGGGCCATC
Sirt2	For: TGTCGCAGAGTCATCTGTTTGG
Sirt2	Rev: CGTCACCTCAGAGAAGATCTTC
Sirt4	For: ATACCAGACTACAGGTCAGA
Sirt4	For: GAAAGACGTCACCATCAGGA
NADK	For: GTCCTTTGATGGACGGAAGAGAC
NADK	Rev: GAGGCTCTCAAACCAGTCGCTC
β-actin	For: GGGAAATCGTGCGTGACAT
	Rev: GTCAGGCAGCTCGTAGCTCTT

Western blot

Cells were lysed in RIPA lysis buffer supplemented with 1x HALT protease inhibitor and allowed to homogenize at 4℃ for 30 min after lysis. Cell debris was removed by centrifugation for 15 min at 12,000 RPM. Protein concentration was determined by the bicinchoninic acid (BCA) method. Antibodies against β-Actin, GAPDH Antibodies against γH2AX, sirt2, sirt4, POLD1, DLAT, DLST were purchased from Abclonal Co., Ltd (Wuhan, China). The protein bands were visualized using an enhanced chemiluminescence kit (cofitt) and quantified by Image J software (National Institutes of Health) .

Immunofluorescence Assay

Cells were seeded on glass bottom plates (Corning, NY, USA) at a density of 5×10⁴/mL. After various treatments, cells were washed with 0.1% PBST twice, fixed with 4% paraformaldehyde for 30 min, and then incubated with blocking solution (1% bovine serum albumin (BSA), Sangon Biotech, Shanghai, China) for 30 min at room temperature. The cells were incubated with antibody against DLAT (1:200, ABclonal, Wuhan, China) overnight at 4°C. After washing with PBST trice, the slides were incubated with Rhodamine Labeled Goat Anti-Rabbit IgG (H + L) (1:200, ZSGB-bio, Beijing, China) for 2 h at room temperature in the dark. Nuclei were stained with DAPI (Beyotime Biotechnology, Shanghai, China) for 5 min. Finally, images were acquired using an Olympus confocal microscope, and ImageJ software (National Institutes of Health) was employed to analyze the intensity of immunofluorescence.

Measurement of NAD(H) and NADP(H) Levels

NAD(H) and NADP(H) were measured using the NAD⁺/NADH Assay Kit and NADP⁺/NADPH Assay Kit, respectively, following the manufacturer’s instructions (Beyotime, Shanghai, China). Briefly, cells were plated in six-well dishes at a density of 3×10⁵ cells/well overnight. After various treatments, cells were washed 3 times in ice-cold PBS and were extracted in 200 µL extraction buffer. To quantify the levels of NAD(H), 20 µL of cell lysates were pipetted into a 96-well plate and homogenized with an ethanol dehydrogenase working solution. For the determination of NADP(H) levels, 50 µL of lysates were dispensed into a 96-well plate and thoroughly mixed with a G6PD working solution. Followed by an incubation at 37℃ for 10 minutes, then the chromogenic solution was then added to the plate and the mixture was further incubated at 37℃ for 30 min. The absorbance was measured at 450 nm and analyzed using SPARK microplate multimode reader. The total concentration of NAD(H) and NADP(H) in the cell samples was calculated according to the standard curve. All measurements were repeated at least thrice in independent experiments.

Statistically Analysis

The data were presented as mean ± standard deviation of three independent experimental repeats. In order to exclude systematic errors, results of different batches for the same experiment were standardized based to the results of negative control groups in each group. GraphPadPrism 9.0 software was used for plotting, and One-Way ANOVA and/or Two-way ANOVA were used for multi-group data comparison. The Dunnett-t test was used for pairwise comparison, and P < 0.05 was considered statistically significant.

NMN partially rescues cuproptosis

Cuproptosis was induced in HeLa cells as described by Tsvetkov et al[1]. Dose-response analysis revealed that cell viability was reduced to 45.2% with 1.5 µM Es/Cu treatment (Fig. 1A), therefore, 1.5 µM Es/Cu was chosen in this study. To evaluate the possible protective effect of NMN, cells were pre-treated with 2, 4, or 8 mM nicotinamide (NMN) for 2 h, followed with 1.5 µM Es/Cu for 2 h, 100 µM TTM, the copper chelator, pre-treatment for 2 h was used as positive control. The results showed that NMN alone did not affect the cell viability (Fig. 1B); on the other hand, it could partially rescue copper-induced death in a dose-dependent manner (Fig. 1C). Aggregation of lipoylated DLAT is the prominent character of cuproptosis. We investigated the effect of NMN on DLAT and DLST expression. While copper decreased the expression of DLAT and DLST, pretreated with NMN increased the expression of DLAT and DLST in copper pulsed cells (Fig. 1D-I). however, NMN only has limited influence on the aggregation of lipoylated DLAT (Fig. 1J).

NMN attenuates cuproptosis-induced DNA damage and loss of Fe-S protein POLD1

Loss of Fe-S protein is an important feature of cuproptosis. Fe-S proteins play crucial roles in various physiological functions including DNA replication and repair. The DNA polymerase POLD1 is such a protein that contains Fe-S clusters and participates in DNA replication and DNA damage repair. In this study, we measured POLD1 protein level as an indicator for Fe-S protein level. As expected, copper decreased the protein level of POLD1, while NMN increased the level of POLD1 protein in Es/Cu treated cells, though less effective than the copper chelator TTM (Fig. 2C-D). We then measured the DNA damage level in cuproptotic cells. The DNA damage marker γH2AX protein levels were determined by Western-blot, and the results showed that copper significantly increased the levels of γH2AX protein, while NMN significantly attenuated this effect, though less effective than the copper chelator TTM (Fig. 2A-B). These findings indicated that DNA damage is also a characteristic for cuproptosis, NMN can mitigate cuproptosis-induced DNA damage, probably through inhibiting the loss of Fe-S proteins.

NMN partially rescues cuproptosis by the induction of G1/S arrest in Es/Cu treated cells

It is well known that actively proliferating cells are more sensitive to the genotoxic effects of DNA-damaging agents, which is the basis for many of the current chemotherapeutic drugs for cancer. On the other hand, cell cycle arrest is an important event for the DNA damage response (DDR), especially G1/S arrest, which could prevent cells entering the S phase and allow cells to repair the damaged DNA[12]. Thus, we examined the cycle distribution of cells under different treatments. The results showed that compared to Es/Cu-only treated cells, TTM co-treatment significantly increased the proportion of cells in the G1 phase (Fig. 3A-B). Similarly, NMN pretreatment also significantly increased the proportion of G1 cells (Fig. 3C-D), indicating the induction of G1/S arrest. To confirm whether G1 arrest contributed to the rescue of cuproptosis, glycyrrhizic acid (GA), a chemical known to induce G1/S arrest, was applied. It was found that GA increased the ratio of G1 phase cells and decreased cell viability in a dose-dependent manner (Fig. 3E-G). HeLa cells were then pretreated with 120 µM or 160 µM GA for 24 h, followed by 1.5 µM Es/Cu for 2 h to induce cuproptosis. The results showed that GA pretreated HeLa cells exhibited a small but significant increase of cell viability (Fig. 3H), suggesting that the G1/S arrest could render cells more resistant to cuproptosis. and this mechanism may, at least partially, contribute to the protective effects of NMN on cuproptosis.

NMN partially rescues cuproptosis via upregulating the expression of sirt2

Sirtuins are highly conserved nicotinamide adenine dinucleotide (NAD⁺)-dependent deacetylases, while Sirt2 and sirt4 are also recognized as lipoamidases. Thus, it is of interest to know whether there were any changes of expression/activity for Sirt2 and Sirt4. It was found that Es/Cu treatment decreased the expression of Sirt2 in HeLa cells, while NMN increased sirt2 expression. More importantly, NMN pretreatment elevated the expression of sirt2 in Es/Cu-treated cells (Fig. 4A-C). On the other hand, the expression level of sirt4 in HeLa cells was too low to be detected by either WB or qPCR. We then investigated the effect of changed expression of sirt2 on cuproptosis. HeLa cells were first transfected with sirt2 overexpression plasmid and cuproptosis was induced by Es/Cu, and the results indicated that overexpression of sirt2 rendered the cells more tolerant to cuproptosis (Fig. 4D-G). Then sirt2 expression was knocked down by transfection with siRNA targeting sirt2 (Fig. 4H-J), and the results showed that sirt2 knock down attenuated the protective effect of NMN on cuproptosis (Fig. 4K).

sirt2 rescues cuproptosis in lipoamidase independent manner

As the aggregation of lipoylated proteins is an important feature of cuproptosis, and NMN upregulated the expression of Sirt2, we further investigated whether the lipoamidase activity of sirt2 and Sirt 4 contributed to the protective effect of NMN. HeLa cells were also transfected with sirt4 overexpression plasmid, and the protein and mRNA expression level were determined using Western-blot assay (Fig. 5A). However, unlike sirt2, overexpression sirt4 had no influence on cuproptosis (Fig. 5B). Then the aggregation of DLAT protein was examined by immunofluorescent microscopy, and the results revealed no significant change in aggregated DLAT level in cells overexpressing sirt2 or sirt4 during cuproptosis (Fig. 5C). The results indicated that sirt2 rescued curproptosis in lipoamidase independent manner.

NMN and sirt2 partially rescue cuproptosis via increasing intracellular NADPH levels

Besides the lipoamidase activity, recent studies have also found that SIRT2 has the function of increasing intracellular NADPH[10, 13], while there was no evidence that the other lipoamidase, SIRT4, had the ability to increase intracellular NADPH. Interestingly, NADPH plays a crucial role in the biosynthesis of Fe-S clusters. We wanted to know whether the rescue of cuproptosis by sirt2 depends on its ability to increase intracellular NADPH levels. Indeed, it was found that Es/Cu treatment decreased NADH hand NADPH levels (Fig. 6A-B), while the NAD⁺ precursor NMN increased intracellular NADH and NADPH levels as expected (Fig. 6C-D). Also, overexpressing sirt2 increased intracellular NADPH levels, and siRNA knocking down sirt2 expression decreased intracellular NADPH levels. (Fig. 6E-F). In contrast, overexpression sirt4 did not influence NADPH levels (Fig. 6G).

Thionictotinamide (thioNA), an analog of nicotinamide, is a reversible competitive inhibitor of NAD Kinase (NADK), which catalyzes the transfer of a phosphate group from ATP to NAD⁺ to generate NADP⁺. Therefore, cells treated with 100 µM thioNA for 24 h showed significantly decreased intracellular NADH and NADPH levels (Fig. 6I-J) without significant changes in the cell viability (Fig. 6H). HeLa cells were pretreated with thioNA for 12 h also did not change the sensitive to Es/Cu induced cell death, but NMN cannot rescue cuproptosis in thioNA pretreated cells (Fig. 6K).

Since thioNA lowered both the NADH and NADPH concentrations, to further clarify the role of NADPH in cuproptosis. We then knocked down NADK by transfection with si-NADK (Fig. 6L-N). The levels of NADPH were decreased 24 and 48 h post si-NADK transfection, while the NAD levels remained unchanged (Fig. 6O-R). Interestingly, NADK knockdown cells cannot be rescued by NMN from cuproptosis (Fig. 6S). These results indicated that elevated NADPH is essential for NMN and sirt2 to rescue cuproptosis.

Cuproptosis is a newly discovered form of RCD, characterized by lipoylation protein oligomerization and loss of Fe-S proteins, distinguishing it from other forms of RCD [1]. Nonetheless, there are still many questions remain unanswered regarding this new type of cell death. In this study, we reported that increased DNA damage is also characteristic of cuproptosis. Also, our results demonstrated that the NAD⁺ precursor NMN can partially rescue cuproptosis by inducing G1/S arrest, upregulating sirt2, and increasing NADPH levels.

One possible explanation for the DNA damage during cuproptosis is the generation of reactive oxygen species (ROS), which has long been reported to be involved in Es-induced cell death [14, 15], and since ROS is known to induce DNA damage, it is conceivable to detect DNA damage during cuproptosis. Also, in DDR, distinct signaling pathways involving multiple proteins/molecules are activated to deal with the different types of DNA damage, leading to either cell cycle arrest to repair the damage, or cell death, depending on the degree of the damage[12]. Interestingly, certain Fe-S proteins play important roles of in DNA replication and repair, such as POLD1[16, 17]. During the process of lipoylation, Fe-S cluster is the sulfur donor [18, 19]. Lipoylation modification of DLAT and DLST, which is essential for their acyl transfer function, is triggered by aerobic oxidation [20]. When aggregated by copper, it leads to increased consumption of Fe-S clusters as the sulfur donor for lipoic acid synthesis, ultimately resulting in Fe-S cluster depletion and the loss of Fe-S proteins. Cells that under aerobic oxidation are nearly 1000-fold more sensitive to cuproptosis than cells undergoing glycolysis [1]. These findings suggest that the aggregation of lipoylated proteins leads to the loss of Fe-S proteins. In this study we also confirmed that Es/Cu downregulated the expression of POLD1, which may further elevate the DNA damage level.

NADPH is the H and electron donor for the Fe-S cluster biosynthesis process [9]. Therefore, theoretically, by modulating NAD⁺ metabolism to increase cellular NADPH level, it should be able to inhibit the loss of Fe-S clusters. A recent studieshave also found that NADPH affects the sensitivity of cuproptosis [21]. The NAD⁺ precursor NMN has been under intensive investigation for the past decade, due to its potent anti-oxidative and anti-aging effects [11]. Recently, we have reported the strong protective effects of NMN and NR on cisplatin-induced DNA damage as well as the decrease of cell viability of HeLa cells[22], therefore, it is of interest to see whether NMN can also protect cells from Es/Cu-induced DNA damage. As expected, Es/Cu-induced DNA damage was significantly inhibited by NMN pretreatment (Fig. 2A). Furthermore, the decreased expression of the Fe-S protein POLD1 by Es/Cu was also reversed.

As stated above, G1/S cell arrest is an important event during DDR, and it has been reported that the G1/S checkpoint cyclin Dependent Kinase Inhibitor 2A (CDKN2A, also known as P16) is a cuproptosis suppressor [1], it was hypothesized that G1/S arrest might contribute to the resistance of Es/Cu-induced DNA damage. Again, we were able to show that NMN pretreatment significantly increased the ratio of G1 phase cells, just as the the copper chelator TTM did. Based on these data, we speculate that G1/S arrest may contribute to the resistance HeLa cells to cuproptosis. Nonetheless, compared to the strong protective effect on DNA damage, NMN only caused a relatively small increase of cell viability, it is believed that the NAD + metabolic pathway only plays a minor role in Es/Cu-induced cell death.

To understand how NMN elicits its protective effect on cell viability, we noticed the two lipoamidases[6, 7], with interest, as they need NAD⁺ as cofactor[23]. Examination of these two enzymes revealed that Es/Cu decreased Sirt2 expression, while NMN upregulated the expression of sirt2. Furthermore, overexpression of sirt2 also caused a small but significant increase of cell viability after Es/Cu treatment, just as NMN treatment, indicating that Sirt2 may play a role in the inhibition cuproptosis. Conversely, knockdown of sirt2 abolished the protective effect of NMN on cuproptosis. Together, such results suggest that NMN could inhibit cuproptosis through the regulation of Sirt2.

Since sirt2 and sirt4 have the lipoamidase activity, we were wondering whether such enzymatic activity is required for the action of NMN. The level of aggregated lipoylated proteins was evaluated by immunofluorescence assay, and our results showed that overexpression of neither sirt2 nor sirt4 affected the level of aggregation of lipoylated protein. These results suggested that Sirt2 rescued cuproptosis in a lipoamidase-independent manner. Recently, Sun reported that Sirt2 delactylates METTL16, an atypical methyltransferase, inhibiting its activity, while AGK2, a SIRT2-specific inhibitor, induces cuproptosis [24].

To further explore the mechanism of rescue cuproptosis by NMN and sirt2, we compared the function of sirt2 and sirt4. Besides its lipoamidase activity, sirt2 also serve as the controller of the pentose phosphate pathway (PPP), which is the major NADPH- producing process[10]. Sirt2 activates Glucose-6-Phosphate Dehydrogenase (G6PD) and enhances NADPH production [25, 26]. Therefore, intracellular NADH and NADPH levels were examined under different conditions. It was found that copper reduced intracellular NADH and NADPH content in HeLa cells. NMN, as expected, increased intracellular NADH and NADPH levels. In contrast, only overexpression of Sirt2 increased intracellular NADPH but not sirt4. NADK is important for the generation of NADPH, and thioNA is a NADK inhibitor [27]. Both the NADH and NADPH levels were decreased by thioNA, and NMN cannot rescue cuproptosis in thioNA pretreated cells, suggesting that either NADH or NADPH might mediate the action of NMN. To determine which one was responsible, we further knockdown NADK by si-NADK, and knockdown of NADK only decreased NADPH level. On the other hand, NMN did not affect the sensitivity of NADK-knockdown cells to cuproptosis. These data suggested that NMN and sirt2 rescue cuproptosis via elevating intracellular NADPH level. However, the detailed mechanism of how NADPH protects cells from cuproptosis needs to further investigated.

Taken together, the results demonstrate that increased DNA damage and decreased NADPH are important features of cuproptosis. G1/S arrest contributes to the resistance of cuproptosis. NMN can partially rescue cuproptosis, and its mechanism includes upregulation of POLD1 to counteract copper death-induced DNA damage, as well as upregulation of sirt2 to increase NADPH levels.

Author Contributions: X. T., J.Y. and C. D. conceived and designed the study. Y.Z., S.Q., C.D., carried out the experiments. Y.Z., S.Q., Y.C. analyzed the data. Y.Z. and S.Q. wrote the first draft of the manuscript, X.T., J.Y. and C. D. revised the manuscript. All authors have read and approved the final manuscript.

Funding This research was funded by the National Natural Science Foundation of China (Nos. 32270186, and 81772168), Zhejiang Provincial Natural Science Foundation (Nos. LY23H190001 and LQ18H190003), the Huadong Medicine Joint Funds of the Zhejiang Provincial Natural Science Foundation (No. LHDMZ24H040001), Hangzhou Bio-medicine and health industry development support science and technology project (Nos. 2021WJCY144, 2022WJC016) and Postgraduate research and innovation promotion program of Hangzhou Normal University (No. 1115B20500437).

Data Availability The data used in this study are available from the corresponding author on reasonable request.

Consent for publication Not Applicable.

Conflict of Interest The authors declare that they have no conflict of interest.

Tsvetkov P, Coy S, Petrova B, et al. (2022) Copper induces cell death by targeting lipoylated TCA cycle proteins. Science 375 (6586):1254-1261.
Lill R. (2009) Function and biogenesis of iron-sulphur proteins. Nature 460 (7257):831-838.
Andreini C, Banci L, Rosato A. (2016) Exploiting Bacterial Operons To Illuminate Human Iron-Sulfur Proteins. J Proteome Res 15 (4):1308-1322.
Zhang C. (2014) Essential functions of iron-requiring proteins in DNA replication, repair and cell cycle control. Protein Cell 5 (10):750-760.
Rowland EA, Snowden CK, Cristea IM. (2018) Protein lipoylation: an evolutionarily conserved metabolic regulator of health and disease. Curr Opin Chem Biol 42:76-85.
Mathias RA, Greco TM, Oberstein A, et al. (2014) Sirtuin 4 is a lipoamidase regulating pyruvate dehydrogenase complex activity. Cell 159 (7):1615-1625.
Xie Y, Chen L, Wang R, et al. (2019) Chemical Probes Reveal Sirt2's New Function as a Robust "Eraser" of Lysine Lipoylation. J Am Chem Soc 141 (46):18428-18436.
Covarrubias AJ, Perrone R, Grozio A, Verdin E. (2021) NAD(+) metabolism and its roles in cellular processes during ageing. Nat Rev Mol Cell Biol 22 (2):119-141.
Maio N, Rouault TA. (2020) Outlining the Complex Pathway of Mammalian Fe-S Cluster Biogenesis. Trends Biochem Sci 45 (5):411-426.
Wu LE, Sinclair DA. (2014) SIRT2 controls the pentose phosphate switch. EMBO J 33 (12):1287-1288.
Song Q, Zhou X, Xu K, Liu S, Zhu X, Yang J. (2023) The Safety and Antiaging Effects of Nicotinamide Mononucleotide in Human Clinical Trials: an Update. Adv Nutr 14 (6):1416-1435.
Jackson SP, Bartek J. (2009) The DNA-damage response in human biology and disease. Nature 461 (7267):1071-1078.
Viswanath P, Batsios G, Ayyappan V, et al. (2021) Metabolic imaging detects elevated glucose flux through the pentose phosphate pathway associated with TERT expression in low-grade gliomas. Neuro Oncol 23 (9):1509-1522.
Hasinoff BB, Yadav AA, Patel D, Wu X. (2014) The cytotoxicity of the anticancer drug elesclomol is due to oxidative stress indirectly mediated through its complex with Cu(II). J Inorg Biochem 137:22-30.
Kirshner JR, He S, Balasubramanyam V, et al. (2008) Elesclomol induces cancer cell apoptosis through oxidative stress. Mol Cancer Ther 7 (8):2319-2327.
Fuss JO, Tsai CL, Ishida JP, Tainer JA. (2015) Emerging critical roles of Fe-S clusters in DNA replication and repair. Biochim Biophys Acta 1853 (6):1253-1271.
Pijuan J, Maria C, Herrero E, Belli G. (2015) Impaired mitochondrial Fe-S cluster biogenesis activates the DNA damage response through different signaling mediators. J Cell Sci 128 (24):4653-4665.
Ren X, Yan J, Zhao Q, et al. (2023) The Fe-S cluster assembly protein IscU2 increases alpha-ketoglutarate catabolism and DNA 5mC to promote tumor growth. Cell Discov 9 (1):76.
Moseler A, Kruse I, Maclean AE, et al. (2021) The function of glutaredoxin GRXS15 is required for lipoyl-dependent dehydrogenases in mitochondria. Plant Physiol 186 (3):1507-1525.
Solmonson A, DeBerardinis RJ. (2018) Lipoic acid metabolism and mitochondrial redox regulation. J Biol Chem 293 (20):7522-7530.
Lu J, Ling X, Sun Y, et al. (2023) FDX1 enhances endometriosis cell cuproptosis via G6PD-mediated redox homeostasis. Apoptosis 28 (7-8):1128-1140.
Qiu S, Shao S, Zhang Y, et al. (2024) Comparison of protective effects of nicotinamide mononucleotide and nicotinamide riboside on DNA damage induced by cisplatin in HeLa cells. Biochem Biophys Rep 37:101655.
Yoshino J, Baur JA, Imai SI. (2018) NAD(+) Intermediates: The Biology and Therapeutic Potential of NMN and NR. Cell Metab 27 (3):513-528.
Sun L, Zhang Y, Yang B, et al. (2023) Lactylation of METTL16 promotes cuproptosis via m(6)A-modification on FDX1 mRNA in gastric cancer. Nat Commun 14 (1):6523.
Wang YP, Zhou LS, Zhao YZ, et al. (2014) Regulation of G6PD acetylation by SIRT2 and KAT9 modulates NADPH homeostasis and cell survival during oxidative stress. EMBO J 33 (12):1304-1320.
Xu SN, Wang TS, Li X, Wang YP. (2016) SIRT2 activates G6PD to enhance NADPH production and promote leukaemia cell proliferation. Sci Rep 6:32734.
Tedeschi PM, Lin H, Gounder M, et al. (2015) Suppression of Cytosolic NADPH Pool by Thionicotinamide Increases Oxidative Stress and Synergizes with Chemotherapy. Mol Pharmacol 88 (4):720-727.

No competing interests reported.

sourceimagesforWB.docx

Download PDF

Journal Publication

published 20 Aug, 2024

Read the published version in Scientific Reports →

Editorial decision: Revision requested
15 May, 2024
Reviews received at journal
12 May, 2024
Reviews received at journal
01 May, 2024
Reviewers agreed at journal
23 Apr, 2024
Reviewers agreed at journal
22 Apr, 2024
Reviewers invited by journal
22 Apr, 2024
Editor assigned by journal
22 Apr, 2024
Editor invited by journal
09 Apr, 2024
Submission checks completed at journal
04 Apr, 2024
First submitted to journal
16 Mar, 2024

You are reading this latest preprint version

NMN partially rescues cuproptosis by upregulating sirt2 to increase intracellular NADPH

Status:

Journal Publication

Version 1

Abstract

Figures

Introduction

Materials and methods

RNA inference assay

Cell viability and cytotoxicity assays

Flow Cytometry Assay

Quantitative Real-time PCR (qPCR)

Western blot

Immunofluorescence Assay

Measurement of NAD(H) and NADP(H) Levels

Statistically Analysis

Results

NMN partially rescues cuproptosis

NMN attenuates cuproptosis-induced DNA damage and loss of Fe-S protein POLD1

NMN partially rescues cuproptosis by the induction of G1/S arrest in Es/Cu treated cells

NMN partially rescues cuproptosis via upregulating the expression of sirt2

sirt2 rescues cuproptosis in lipoamidase independent manner

NMN and sirt2 partially rescue cuproptosis via increasing intracellular NADPH levels

Discussion

Declarations

References

Additional Declarations

Supplementary Files

Status:

Journal Publication

Version 1