Over-expression of long non-coding RNA LINC00342 as diagnostic biomarker for Kidney Renal Clear Cell Carcinoma

doi:10.21203/rs.3.rs-4112383/v1

Download PDF

Research Article

Over-expression of long non-coding RNA LINC00342 as diagnostic biomarker for Kidney Renal Clear Cell Carcinoma

https://doi.org/10.21203/rs.3.rs-4112383/v1

This work is licensed under a CC BY 4.0 License

Version 1

posted

You are reading this latest preprint version

Background: Kidney renal clear cell carcinoma (KIRC), being the most common type of renal cancer, exhibits a high mortality and recurrence rate primarily because a significant number of patients are already in advanced stages at the time of diagnosis. Identifying a biological marker for early-stage KIRC has become a top priority. Recently, some studies have shown that long non-coding RNA LINC00342 promotes the proliferation, invasion, and migration in gastric cancer, colorectal cancer and non-small cell lung cancer through a variety of ways. However, the involvement and mechanism of linc00342 in KIRC is still unclear. The aim of this study was to examine the diagnostic and prognostic value of linc00342 in KIRC, to investigate the effects of linc00342 on the biological functions of KIRC cells, and to explore potential mechanisms of linc00342 in KIRC.

Methods: We downloaded the linc00342 expression data and clinical information of KIRC from the TCGA database and constructed a prognostic prediction model. In vitro, the effect of silencing linc00342 on KIRC cell proliferation, apoptosis, metastasis, and invasion was measured by colony-formation assay, flow cytometric analysis, wound-healing assay and Transwell assay, respectively.

Results: Firstly, our predictive model was established by using TCGA database. Secondly, Linc00342 was involved in various biological functions of KIRC by using gene ontology (GO) and Kyoto Encyclopedia of Genes and Genomes (KEGG) pathway analysis. Thirdly, In vitro, linc00342 was overexpressed in KIRC by RT-qPCR in tissue and cell models. Moreover, we found that linc00342 can inhibit cell apoptosis and promote cell proliferation, invasion, and migration.

Conclusion: To our knowledge, our study is the first to construct a nomogram prediction model by combining the gene expression of linc00342 with clinical data, and confirmed that linc00342 can be an independent prognostic factor of KIRC through in vitro validation.

Kidney renal clear cell carcinoma (KIRC)

prognostic

nomogram

linc00342

Renal cell carcinoma (RCC), a common aggressive urinary cancer, has a high incidence worldwide, accounting for about 3% of adult malignancies [1]. Three common pathological subtypes of RCC are kidney renal clear cell carcinoma (KIRC), kidney renal papillary cell carcinoma (KIRP), and kidney chromophobe renal cell carcinoma (KICH). Among them, KIRC is the most common subtype, accounting for 70–75% of cases, followed by KIRP at 10–16% and KICH at 5% of cases [2]. Effective treatments of KIRC include surgery, radiofrequency ablation, and targeted drug therapy such as sunitinib and pazopanib [3, 4]. However, most KIRC patients are in the advanced stage and have distant metastasis at the time of diagnosis, leading to their poor prognosis and high recurrence rate. Finelli et al found that the recurrence rate of RCC after surgery is approximately 25% [5]. Poor prognosis and high recurrence of RCC makes it urgent to discover potential early-stage biomarkers to improve overall survival (OS).

As a type of non-protein-coding RNAs (lncRNAs) with length over 200 nucleotides, aberrantly expressed lncRNA is insinuated to be tightly linked with diagnosis and prognosis of numerous malignancies, including KIRC [6]. Apart from chromatin modification [7, 8]. lncRNA also perform functions in transcription and post-transcription by interacting with DNA, mRNAs, and proteins [9]. Another competing endogenous RNA (ceRNA) mechanism hypothesis is that lncRNAs regulate the expression of target genes by interacting with miRNA [10–13]. Mounting evidence has indicated lncRNA can be used as diagnostic and prognostic indicator for cancers [14, 15]. Recently, research on the mechanism of lncRNAs in KIRC has been a hot topic. The lncRNA MALAT1 is reported to modify the progression of KIRC by regulation of miR-194-5p/ACVR2B and may be used as a novel therapeutic target in KIRC [16]. LINC01711 promotes the progression of KIRC and serves as a potential biomarker for the early diagnosis and prognosis of KIRC patients [17]. LncRNA SARCC is confirmed to control tumorigenesis via altering the androgen receptor and miRNA 143-3p signals [18]. As one of the long intergenic non-coding RNAs (lincRNAs), linc00342 has been verified to perform oncogenic functions in lung cancer [19, 20], gastric cancer [21], Hepatocellular Carcinoma [22], and colon adenocarcinoma [23]. Li et al. observed the correlation between LINC00342 and ccRCC by constructing a three-glycolysis-related lncRNA signature [24], however, the predictive nomogram model only containing linc00342 expression has not been established. Our research was aimed to explore the difference of linc00342 expression between KIRC and kidney normal cells, and to study the correlation between linc00342 and prognosis through biological and clinical data analysis; Moreover, linc00342 was identified by PCR in KIRC.

2.1 Analysis of linc00342 expression in KIRC based on GEPIA and the Cancer Genome Atlas (TCGA) database

To investigate the expression of linc00342 in different cancers, we input linc00342 into the GEPIA database (http://gepia.cancer-pku.cn/). |Log2FC| = 1 and P-value = 0.01 was referred as cutoff. Then linc00342 gene expression data and clinical information of KIRC patients were downloaded from the TCGA database (https://gdc.cancer.gov/) for further study.

2.2 Construction of predictive nomogram model

Univariate and multivariate Cox regression analysis was performed to discover independent prognostic factors of KIRC. A value of P < 0.05 was considered to significant. The factors included linc00342 expression, age, gender, and TMN stages, all obtained from TCGA database. A nomogram predictive model was applied to study the significance of linc00342 expression in KIRC based on the multivariate Cox regression analysis.

2.3 GO function and KEGG pathway analysis

To elaborate the potential functions of linc00342 in the tumorigenesis of KIRC, we perform Gene Ontology (GO) function annotation and Kyoto Encyclopedia of Genes and Genomes (KEGG) pathway analysis using the David database (https://david-d.ncifcrf.gov/). P < 0.05 was considered as significant. The results of GO functions (including biological processes, cellular components, and molecular functions) were visualized using R packages “ggplot2 and GOplot”. The relationships between related genes and both GO functions and KEGG pathways were shown using Cytoscape (version: 3.7.2).

2.4 Protein-protein interaction (PPI) network and Pearson’s correlation analysis

To investigate the relationship among linc00342 related genes, we put the related genes into the string database (https://string-db.org/). 0.900 was set as interaction score in the network. Finally, we used Cytoscape (version: 3.7.2) for hub gene analysis. In Cytoscape, MCC was used as calculation method and cytoHubba plugin was used to obtain the first 10 hub genes. The Starbase database (http://starbase.sysu.edu.cn/) was used to evaluate the correlation between linc00342 and hub genes.

2.5 Cell culture and transfection

OSRC2 and ACHN KIRC cell and HK-2 normal kidney cell were provided by Peking Union Medical College Hospital. RPMI-1640, 10% fetal bovine serum, 1% double antibiotic (100 X penicillin-streptomycin) and MEM, purchased from GIBCO (Waltham, MA, USA), were used to prepare cell culture medium. The linc00324 shRNA1, shRNA2, and shRNA3 plasmids were introduced into OSRC2 and ACHN cells, and the shRNA with the best silencing effect was selected for subsequent functional experiments. The transfected cells were cultured in an incubator with 5% CO₂ at 37°C.

2.6 Real-time quantitative polymerase chain reaction (RT-qPCR)

Trizol (Vazyme, Nanjing, China) was added into the cell culture medium to extract RNA. The transcription level of linc00324 was detected by qPCR. The primers for qPCR were TCCACAGACACTACCCAAAGC linc00324-F, GCAGTTCACTCTGCTGCTTC LINC00324-R; TCATTGACCTCAACTACATGG GAPDH-F, TCGCTCCTGGAAGATGGTG GAPDH-R. The relative expression of linc00342 was calculated by the formula: relative expression = 2^ (GAPDH Ct-target gene Ct). Three repeated experiments were carried out for each group, and the mean and standard deviation were used to plot the result.

2.7 Colony-formation assay

The OSRC2 and ACHN KIRC cells were pipetted into single cell suspension with the corresponding medium and cultured in the incubator at 37℃ with 5% CO₂ for 7 days. Then crystal violet dye (Solarbio, Beijing, China) was added to each well for staining. After removing crystal violet, we rinsed the wells three times with tap water and took pictures for analysis.

2.8 Flow cytometric analysis

According to the manufacturer’s instructions, the resuspended cells were centrifuged at 1000 g for 5 min, then 5 µl of Annexin v-FITC and 10 µl of propidium iodide (PI) (Cwbiotech, Beijing, China) staining solution were added. Annexin V-FITC fluoresces green and propidium iodide (PI) fluoresces red. The red fluorescence was detected by flow cytometry at the excitation wavelength of 488 nm.

2.9 Wound-healing assay

The cells were grown in 6-well plates until reaching 80% confluence. A 200-µl pipette tip was used to remove cells along a straight line drawn through the center of the culture plate. PBS was used to remove non-adherent cells, then cultured in an incubator with 5% CO₂ at 37℃. Photos were taken at 0 and 24 hours for further study.

2.10 Transwell assay

25 µl Matrigel (BD Biosciences, San Jose, CA, USA) was added to the Transwell plate chamber and allowed to gel at 37℃ for 30 mins. 200 µl of cell suspension (4 × 10⁴ cells) was added to the upper part of the Transwell plate and 700 µl complete medium (Gibco, Waltham, MA, USA) was added to the lower chamber of Transwell culture plate, then cultured at 37℃ and 5% CO₂ for 24 h. The cells were rinsed three times with PBS after 30 min of crystal violet staining. All experiments were repeated three times.

2.11 Statistical analyses

IBM SPSS Statistics 22(IBM, USA) and GraphPad Prism 8 (GraphPad Software Inc., USA) were used to conduct statistical analyses. The Kaplan–Meier method was applied for analysis of overall survival (OS). Univariate and multivariate Cox regressions were performed independent prognostic factors analysis. Results are considered significant when P < 0.05 (*), P < 0.01 (**) or P < 0.001 (***).

3.1 Aberrant expression of linc00342 in various tumors

Significant expression differences between the tumor group and the normal group were observed in the adrenocortical carcinoma (ACC), breast invasive carcinoma (BRCA), cholangiocarcinoma (CHOL), colon adenocarcinoma (COAD), lymphoid neoplasm diffuse large B-cell lymphoma (DLBC), glioblastoma multiforme (GBM), kidney renal clear cell carcinoma (KIRC), acute myeloid leukemia (LAML), lung adenocarcinoma (LUAD), lung squamous cell carcinoma (LUSC), ovarian serous cystadenocarcinoma (OV), pancreatic adenocarcinoma (PAAD), pheochromocytoma and paraganglioma (PCPG), prostate adenocarcinoma (PRAD), rectum adenocarcinoma (READ), skin cutaneous melanoma (SKCM), stomach adenocarcinoma (STAD), testicular germ cell tumors (TGCT), thyroid carcinoma (THCA), thymoma (THYM), uterine corpus endometrial carcinoma (UCEC), uterine carcinosarcoma (UCS) in GEPIA dataset. High expression in tumor relative to normal tissue was found in CHOL, DLBC, KIRC, LAML, PAAD, PCPG and THYM; low expression in tumor relative to normal tissue was found in ACC, BRCA, COAD, GBM, LUAD, LUSC, OV, PRAD, READ, SKCM, STAD, TGCT, THCA, UCEG and UCS. (Fig. 1A, 1B, 1C, P < 0.05). Meanwhile, we downloaded the gene expression and clinical information (including survival time and survival state) of linc00342 in KIRC from the TCGA database. The expression of linc00342 in KIRC was significantly higher than in normal tissues (Fig. 1D, P < 0.001), and in the receiver operating characteristic (ROC) curve, the area under the curve (AUC) was greater than 0.5, indicating that linc00342 has significant diagnostic value in KIRC (Fig. 1E, AUC = 0.889, 95%CI, 0.860–0.919). The results of survival analysis suggested that the 5-year survival rate of patients with high expression of linc00342 in KIRC was significantly lower than that of patients with low linc00342 expression (Fig. 1F, P < 0.05).

3.2 The prognostic role of linc00342 in KIRC

In order to better study the importance of linc00342 in the prognosis of KIRC, we conducted univariate and multivariate Cox analysis on the clinical data from KIRC patients (including linc00342 gene expression, age, gender, clinical stage), and constructed a nomogram prognosis prediction model based on the multivariate Cox analysis. Univariate analysis results suggested that linc00342 gene expression and clinical stage (TMN) might be independent factors for KIRC prognosis (Fig. 2A, p < 0.01), and multivariate analysis illustrated that linc00342 expression level was an independent factor for KIRC prognosis (Fig. 2B, P < 0.01). The nomogram prediction model results suggested that KIRC patients with the higher linc00342 expression had poorer 3-year and 5-year OS (Fig. 2C). We then plotted validation curves to evaluate the prediction model. The blue line was not far from the diagonal, suggesting the predicted probabilities were consistent with the observed proportions (Fig. 2D).

3.3 GO annotation and KEGG pathway enrichment analysis

Linc00342-related genes obtained from the MEM dataset (https://biit.cs.ut.ee/mem/) were used to conduct functional analysis through the David database (https://david-d.ncifcrf.gov/). Enriched GO terms and their target genes and P values are shown in Fig. 3A, 3B, including cell cycle, cell cycle arrest, M phase, cell division, mRNA metabolic process, RNA splicing, RNA processing, DNA repair, negative regulation of gene expression, and nuclear division, all of which may be associated with the tumorigenesis of KIRC (P < 0.05). KEGG pathway analysis demonstrated that linc00342 related genes were involved in a variety of significant cancer-associated pathways, such as MAPK signaling pathway, mTOR signaling pathway, insulin signaling pathway, NOD-like receptor signaling pathway, Wnt signaling pathway and GnRH signaling pathway (P < 0.05). The detailed data of KEGG analysis are listed in Table. A network was plotted by Cytoscape to present the relationship between the GO terms, KEGG terms and their correlated genes. (Fig. 3C, 3D)

3.4 Protein-protein interaction (PPI) network and Pearson’s correlation analysis

In the PPI network (Fig. 4), nodes represent proteins, edges represent protein-protein associations, and line color indicates the type of interaction. Through correlation analysis based on the Starbase database, CCAR1 (r = 0.578, P = 6.20e-49), HNRNPA1 (r = 0.089, P = 4.07e-02), HNRNPA2B1 (r = 0.649, P = 3.31e-65), HNRNPD (r = 0.410, P = 4.62e-23), HNRNPL (r = 0.422, P = 1.62e-24), RBM5 (r = 0.805, P = 5.46e-123), SRSF5 (r = 0.698, P = 2.57e-79), SRSF7 (r = 0.542, P = 3.92e-42), SRSF11 (r = 0.795, P = 8.14e-118), and WDR33 (r = 0.411, P = 4.e-02) (Fig. 5A-5J) all have significant relationships with linc00342.

3.5 High expression of linc00342 in KIRC cells

RT-qPCR analysis showed linc00342 was remarkably upregulated in OSRC2 and ACHN KIRC cells compared with normal kidney cells. (Fig. 6A, P < 0.05).

3.6 shRNA with the highest knockdown efficiency was selected

To investigate the potential mechanism of linc00342 in tumorigenesis of KIRC, linc00342 shRNA#1, #2, #3 were transfected into OSRC2 and ACHN KIRC cells to knock down the expression of linc00342. ShRNA#2 had the highest knockdown efficiency (Fig. 6B) and was used for further studies.

3.7 Depletion of linc00342 retards proliferation in KIRC cells.

Colony-formation assays revealed decreased cell proliferation in OSRC2 and ACHN KIRC cells transfected with the linc00342 shRNA#2, compared with control group with scrambled shRNA (Fig. 7, P < 0.01). The results indicated that downregulation of linc00342 could inhibit the proliferative properties of KIRC cells.

3.8 Silencing linc00342 accelerates cell apoptosis and arrests cell cycle in G0/G1

Base on the results of flow cytometry analysis, we found that along with the knockdown of linc00342 in OSRC2 and ACHN KIRC cells, the cell apoptotic rate in linc00342-shRNA-KIRC cells was elevated compared with linc00342-scramble-KIRC cells. (Fig. 8A, P < 0.05). Furthermore, the results showed linc00342-silencing KIRC cells were arrested in G0/G1. (Fig. 8B, P < 0.05)

3.9 Knocking down linc00342 exhibited significantly reduced migration and invasion ability

By comparing the results of transfection with linc00342-scramble and linc00342-shRNA, it was revealed that after knocking down linc00342, the post-healing width of the scratches as a percentage of the original scratch width was significantly lower than in the control group, indicating linc00342 can promote the migration ability of OSRC2 and ACHN KIRC cell lines. (Fig. 9A, P < 0.05) Furthermore, similar findings were obtained via a Transwell assay, in which the density of KIRC cells transfected with the linc00342-shRNA was remarkably decreased compared with controls. (Fig. 9B, P < 0.001) Accordingly, we drew the conclusion that linc00342 had the properties that promoted migration and invasion in KIRC.

Kidney cancer, the most common malignant tumor of renal parenchyma, is a malignancy originating from the urinary tubule epithelial system. Siegel et al. reported there were 65,349 new KIRC cases and 14,970 deaths due to KIRC in the United States in 2018 [25]. Surgery and radiotherapy are of no avail to patients with late-stage KIRC, leading to high mortality and recurrence rates. There is thus an urgent need to find early-stage diagnostic markers to improve OS of KIRC patients. As indicated by numerous publications, lncRNA, which is featured by non-protein-coding, presently is involved in tumorigenesis and progression of various cancers. Recently, advances in bioinformatics tools bring improvements in analysis, facilitating diagnosis and treatment for enormous cancers. TCGA, a large-scale genomics-based database with the expression data and clinical information on 33 cancer types, provides a molecular basis for understanding the pathogenesis of tumors. Nomograms derived from statistical models are used to improve cancer prognostication by integrating diverse clinical variables [26].

In our study, we verified the expression and functions of linc00342 in KIRC through bioinformatics analysis, prognostic model construction and in vitro test. We first observed aberrant expression of linc00342 in a majority of tumors based on the GEPIA database. After that, we used the gene expression and clinical data downloaded from TCGA to construct a nomogram prediction model. Analysis of that TCGA data showed that the expression of linc00342 in KIRC tissues was significantly higher than that of normal paracancerous tissues (P < 0.001), and the ROC curve suggested that linc00342 had diagnostic significance for KIRC (AUC = 0.889, 95%CI, 0.860–0.919). Li et al. constructed a three-glycolysis-related lncRNA signature (including AC009084.1, AC156455.1, and LINC00342) and found the signature was correlated with prognosis in ccRCC (24). However, the predictive nomogram model only containing linc00342 expression has not been established. In our study, a nomogram containing linc00342 expression and clinical data based on multivariate analysis indicated that the overexpressed linc00342 level was responsible for the poor OS of KIRC, which is consistent with the results of the survival curve. Together, the bioinformatics analysis suggested that linc00342 may be related to the diagnosis and prognosis of KIRC.

In vitro, we found that linc00342 was indeed higher in KIRC cells than in the normal control group. Subsequently, to understand the pathogenesis of linc00342 in KIRC, we used the David database to conduct functional analysis of linc00342 related genes. As showed by GO annotation analysis, linc00342 was related with cell cycle, cell cycle arrest, M phase, cell division, mRNA metabolic process, RNA splicing, RNA processing, DNA repair, negative regulation of gene expression, and nuclear division, indicating that linc00342 may play carcinogenic roles by affecting the cell cycle. The in vitro experiments in our study verified the hypothesis. Previous studies showed that linc00342 is associated with proliferation, migration and invasion in non-small cell lung cancer, gastric cancer, hepatocellular Carcinoma and colon cancer [20–24]. We have found that linc00342 is abnormally expressed in KIRC and is associated with prognosis of KIRC, so we wonder linc00342 affects the biological functions of KIRC. In vitro, we found that depletion of linc00342 retarded cell proliferation, accelerated cell apoptosis, and significantly reduced migration and invasion ability in KIRC cells. Previous studies have elucidated the potential mechanism of linc00342 in the progression of tumors. Chen QF et al demonstrated linc00342 regulated cell growth and metastasis in non-small cell lung cancer via targeting miR-203a-3p [19]. Linc00342 was also found to promote gastric cancer progression by targeting miR-596[21] and the miR-545-5p/CNPY2 axis [27]. Linc00342 was clarified to regulate proliferation, invasion, and migration of Primary Hepatocellular Carcinoma Cells by Regulating the Expression of miRNA-19a-3p, miRNA-545-5p, and miRNA-203a-3p [22]. Li et al. suggested linc00342 may influence the biological behavior of KIRC through the Wnt/β-catenin pathway [24]. In addition to Wnt/β-catenin pathway, our stud showed linc00342-related genes were enriched in other important signaling pathways – MAPK, mTOR, NOD-like receptor and GnRH – that are reported to play key roles in KIRC [28–31]. The effect of these KEGG pathways on the progress of KICC was not explored in our current study. Undoubtedly, experiments in vivo and in vitro are still needed to validate this point.

Our study provides the evidence that linc00342 is overexpressed in KIRC cells and has a significant prognostic value for KIRC patients. Moreover, our study indicates linc00342 suppresses apoptosis, promotes proliferation, migration, and invasion in KIRC cells. In conclusion, our study, to our knowledge, is the first time to construct a nomogram model only based on linc00342 expression and find linc00342 can be used as an independent prognostic factor for KIRC.

Acknowledgments

Our thanks go to all members who helped to carry out this project.

Funding

This work was supported by grants from Chinese National Nature Science Foundation (NO. 82072833).

Conflict of interest

The authors have no conflicts of interest to declare.

Contributions:

Conceived and designed the experiments: Di Guan and Hao Ping. Performed the experiments: Di Guan, Peng Xiang and Dan Liu. Analyzed the data: Di Guan and Dan Liu. Contributed reagents/materials/analysis tools: Di Guan. Wrote the paper: Di Guan.

Miller KD, Siegel RL, Lin CC, et al (2016) Cancer treatment and survivorship statistics, 2016. CA Cancer J Clin 66:271–89.
Shuch B, Amin A, Armstrong AJ, et al (2015) Understanding pathologic variants of renal cell carcinoma: distilling therapeutic opportunities from biologic complexity. Eur Urol 67:85–97.
Atkins MB, Tannir NM (2018) Current and emerging therapies for first-line treatment of metastatic clear cell renal cell carcinoma. Cancer Treat Rev 70:127–37.
Alonso-Gordoa T, García-Bermejo ML, Grande E, et al (2019) Targeting Tyrosine kinases in Renal Cell Carcinoma: "New Bullets against Old Guys". Int J Mol Sci 20.
Finelli A, Ismaila N, Russo P (2017) Management of Small Renal Masses: American Society of Clinical Oncology Clinical Practice Guideline Summary. J Oncol Pract 13:276–8.
Cabianca DS, Casa V, Bodega B, et al (2012) A long ncRNA links copy number variation to a polycomb/trithorax epigenetic switch in FSHD muscular dystrophy. Cell 149:819–31.
Huarte M (2015) The emerging role of lncRNAs in cancer. Nat Med 21:1253–61.
Huarte M, Guttman M, Feldser D, et al (2010) A large intergenic noncoding RNA induced by p53 mediates global gene repression in the p53 response. Cell 142:409–19.
Ørom UA, Derrien T, Beringer M, et al (2010) Long noncoding RNAs with enhancer-like function in human cells. Cell 143:46–58.
Karreth FA, Tay Y, Perna D, et al (2011) In vivo identification of tumor- suppressive PTEN ceRNAs in an oncogenic BRAF-induced mouse model of melanoma. Cell 147:382–95.
Tay Y, Kats L, Salmena L, et al (2011) Coding-independent regulation of the tumor suppressor PTEN by competing endogenous mRNAs. Cell 147:344–57.
Keniry A, Oxley D, Monnier P, et al (2012) The H19 lincRNA is a developmental reservoir of miR-675 that suppresses growth and Igf1r. Nat Cell Biol 14:659–65.
Wang J, Liu X, Wu H, et al (2010) CREB up-regulates long non-coding RNA, HULC expression through interaction with microRNA-372 in liver cancer. Nucleic Acids Res 38:5366–83.
Xiu B, Chi Y, Liu L, et al (2019) LINC02273 drives breast cancer metastasis by epigenetically increasing AGR2 transcription. Mol Cancer 18:187.
Li Z, Qin X, Bian W, et al (2019) Exosomal lncRNA ZFAS1 regulates esophageal squamous cell carcinoma cell proliferation, invasion, migration and apoptosis via microRNA-124/STAT3 axis. J Exp Clin Cancer Res 38:477.
Ye Y, Zhang F, Chen Q, et al (2019) LncRNA MALAT1 modified progression of clear cell kidney carcinoma (KIRC) by regulation of miR-194-5p/ACVR2B signaling. Mol Carcinog 58:279–92.
Zhang H, Zhang Y, Gao L, et al (2023) Cuproptosis-related LINC01711 promotes the progression of kidney renal clear cell carcinoma. Am J Cancer Res 13:2617–29.
Zhai W, Sun Y, Guo C, et al (2017) LncRNA-SARCC suppresses renal cell carcinoma (RCC) progression via altering the androgen receptor(AR)/miRNA-143-3p signals. Cell Death Differ 24:1502–17.
Chen QF, Kong JL, Zou SC, et al (2019) LncRNA LINC00342 regulated cell growth and metastasis in non-small cell lung cancer via targeting miR-203a-3p. Eur Rev Med Pharmacol Sci 23:7408–18.
Tang H, Zhao L, Li M, et al (2019) Investigation of LINC00342 as a poor prognostic biomarker for human patients with non-small cell lung cancer. J Cell Biochem 120:5055–61.
Xin B, Liu G, Zhang C, et al (2023) [LncRNA LINC00342 regulates gastric cancer cell proliferation, migration and invasion by targeting miR-596]. Nan Fang Yi Ke Da Xue Xue Bao 43:1761–70.
Yao ZX, Tu JH, Liu YL, et al (2023) Long Non-coding RNA LINC00342 Promotes the Proliferation, Invasion, and Migration of Primary Hepatocellular Carcinoma Cells by Regulating the Expression of miRNA-19a-3p, miRNA-545-5p, and miRNA-203a-3p. Biochem Genet.
Miao Z, Liu S, Xiao X, et al (2020) LINC00342 regulates cell proliferation, apoptosis, migration and invasion in colon adenocarcinoma via miR-545-5p/MDM2 axis. Gene 743:144604.
Li T, Tong H, Zhu J, et al (2021) Identification of a Three-Glycolysis-Related lncRNA Signature Correlated With Prognosis and Metastasis in Clear Cell Renal Cell Carcinoma. Front Med (Lausanne) 8:777507.
Siegel RL, Miller KD, Jemal A (2018) Cancer statistics, 2018. CA Cancer J Clin 68:7–30.
Wong SL, Kattan MW, McMasters KM, et al (2005) A nomogram that predicts the presence of sentinel node metastasis in melanoma with better discrimination than the American Joint Committee on Cancer staging system. Ann Surg Oncol 12:282–8.
Liu R, Yang X (2021) LncRNA LINC00342 promotes gastric cancer progression by targeting the miR-545-5p/CNPY2 axis. BMC Cancer 21:1163.
Li Z, Zhang M, Chen S, et al (2023) BTN3A3 inhibits clear cell renal cell carcinoma progression by regulating the ROS/MAPK pathway via interacting with RPS3A. Cell Signal 112:110914.
Liu H, Li X, Duan Y, et al (2021) Mechanism of gypenosides of Gynostemma pentaphyllum inducing apoptosis of renal cell carcinoma by PI3K/AKT/mTOR pathway. J Ethnopharmacol 271:113907.
Jin J, Zhou TJ, Ren GL, et al (2022) Novel insights into NOD-like receptors in renal diseases. Acta Pharmacol Sin 43:2789–806.
Wu HH, Yan X, Chen Z, et al (2021) GNRH1 and LTB4R might be novel immune-related prognostic biomarkers in clear cell renal cell carcinoma (ccRCC). Cancer Cell Int 21:354.

No competing interests reported.

Download PDF

Version 1

posted

You are reading this latest preprint version

Over-expression of long non-coding RNA LINC00342 as diagnostic biomarker for Kidney Renal Clear Cell Carcinoma

Status:

Version 1

Abstract

Figures

1. Introduction

2. Materials and Methods

2.2 Construction of predictive nomogram model

2.3 GO function and KEGG pathway analysis

2.4 Protein-protein interaction (PPI) network and Pearson’s correlation analysis

2.5 Cell culture and transfection

2.6 Real-time quantitative polymerase chain reaction (RT-qPCR)

2.7 Colony-formation assay

2.8 Flow cytometric analysis

2.9 Wound-healing assay

2.10 Transwell assay

2.11 Statistical analyses

3. Results

3.1 Aberrant expression of linc00342 in various tumors

3.2 The prognostic role of linc00342 in KIRC

3.3 GO annotation and KEGG pathway enrichment analysis

3.4 Protein-protein interaction (PPI) network and Pearson’s correlation analysis

3.5 High expression of linc00342 in KIRC cells

3.6 shRNA with the highest knockdown efficiency was selected

3.7 Depletion of linc00342 retards proliferation in KIRC cells.

3.8 Silencing linc00342 accelerates cell apoptosis and arrests cell cycle in G0/G1

3.9 Knocking down linc00342 exhibited significantly reduced migration and invasion ability

4. Discussion

5. Conclusions

Declarations

References

Additional Declarations

Status:

Version 1