Preparation of AFC
Clove is derived from the dried flower buds of the plants Eugenia caryophyllata Thunb. or Syzygium aromaticum (L.) Merr. & L.M.Perry in the Myrtaceae family. AFC containing mainly eugenol (32.32%) and oleanolic acid (23.60%) was obtained from dried clove powder by the method described in our previous research[29]. Analyses of all components of AFC have been reconfirmed in previous studies[37].
Reagents and antibodies
DMEM and RPMI-1640 were purchased from Gibco (Thermo Fisher Scientific, Waltham, MA, USA); the heat-inactivated fetal bovine serum was purchased from EVERY GREEN (Zhejiang, China); Penicillin-Streptomycin Solution was purchased from Beyotime (Shanghai, China); the cell counting kit-8 (CCK-8), from AbMole (Shanghai, China); assay kits for glucose and lactic acid, from Nanjing Jiancheng Bioengineering Institute (Nanjing, Jiangsu, China); assay kits for pyruvate and pyruvate kinase, from Beijing Solarbio Science & Technology (Beijing, China). A kit for reverse transcription and the FastFire Premix (SYBR Green) kit for quantitative PCR were purchased from Tiangen (Beijing, China). Primary antibodies against PKM2 (cat.no.60268-1-Ig), cyclin D1 (cat.no.60186-1-Ig), c-myc (cat.no.67447-1-Ig), or β-actin (cat.no.66009-1-Ig) as well as horseradish peroxidase-labeled goat anti-mouse IgG(H + L) antibody (cat.no.SA00001-1) were purchased from Proteintech (Hubei, China). Primary antibody against Ki67 (cat.no. GB121141) and horseradish peroxidase conjugated goat anti-mouse IgG (H + L) (cat.no. GB23301) were purchased from Servicebio (Wuhan, China).
Cell culture and treatments
The following five human colorectal cancer cell lines were purchased from the American Type Culture Collection (Manassas, VA, USA): HCT-116, SW620, Caco-2, HT29 and LoVo. Cells were cultured at 37 ˚C in an atmosphere of 5% CO2 in DMEM or RPMI-1640 medium containing 10% heat-inactivated fetal bovine serum, 100 U/ml penicillin and 100 mg/ml streptomycin. Medium was replaced every 2–3 days. In culture experiments, active fraction was dissolved to a concentration of 4 mg/ml in serum-free medium through sonication, then diluted with culture medium to concentrations of 25, 50, 100, 200 or 400 µg/ml. Cultures were exposed to these dilutions for 24, 48 or 72 h. Control cultures were treated with medium without active fraction. All cell lines were identified by short tandem repeat analysis and routinely tested negative for pathogens and mycoplasma.
Cell viability
Cells at 90% confluence were seeded into 96-well plates at the density of 5 × 103 cells/well, incubated for 24 h, then exposed for 24, 48 or 72 h to different concentrations of active fraction in medium, or they were exposed to medium without active fraction as a negative control. After each time point, a dilution of CCK8 reagent (10 ml CCK8 + 90 ml serum-free medium) was added to each well, the wells were incubated at 37°C for 1 h, and optical density at a wavelength of 450 nm was measured using the Cytation 3 microplate reader (Bio-tek, VT Laboratories, USA). In addition to the experimental and control wells, "blank" wells containing only medium and CCK8 were processed in parallel. Cell survival was calculated as [(OD experimental - OD blank) / (OD control - OD blank)] × 100%. Growth inhibition was calculated as [(OD control - OD experimental) / (OD control - OD blank)] × 100%. Data for all samples came from three independent experiments.
Colony formation
HCT116 or LoVo cells were seeded into 6-well plates (500 cells/well), cultured for 24 h, then exposed to active fraction at 25, 50, 100, or 200 mg/ml, and the group that only added an equal amount of serum-free medium was regarded as negative control group. Plates were incubated 48 h, then the culture medium was replaced and cultured for 12 days, during which the medium was changed every four days. Finally, cells were fixed with 4% paraformaldehyde (Servicebio, Wuhan, China), stained with 1% crystalline violet (Beyotime, Beijing, China) for 10min at room temperature and counted with ImageJ (version 1.8.0; US National Institutes of Health, Bethesda, MD, USA).
Glucose consumption
HCT116 or LoVo cells were inoculated in 6-well plates (4×105 cells/well), cultured for 24 h, then treated with active fraction or medium without active fraction for 48 h. The culture medium was collected and centrifuged at 1000 g for 10 min, then the supernatant was assayed for glucose level using a commercial kit. Samples were incubated at 37°C for 10 min, then optical density at 505 nm was measured. We converted the optical density readings to concentrations according to the kit instructions. Data for all samples came from three independent experiments.
Lactate production
Cells were cultured and treated with active fraction as described in section Glucose consumption, then the culture medium was collected, diluted two-fold with distilled water, and processed with a commercial kit to assay lactate. Optical density at 530 nm was measured. We converted the optical density readings to concentrations based on the instructions for the kit. Data for all samples came from three independent experiments.
Pyruvate production
Cells were cultured and treated with active fraction as described in section Glucose consumption, then the cells were harvested, lysed by ultrasonication and standing at 0 ℃ for 30 min, and centrifuged at 8000 g for 10 min at room temperature. The supernatant was processed using a commercial kit to assay pyruvate based on optical density at a wavelength of 520 nm. Pyruvate production was calculated according to the operating manual instructions. Data for all samples came from three independent experiments.
Pyruvate kinase activity
Cells were cultured at a density of 2×106 in 60-mm cell culture dishes and treated with active fraction as described in Glucose consumption, then cells were harvested, lysed by ultrasonication, and centrifuged at 8000 g at 4 ℃ for 10 min. The supernatant was processed using a commercial kit to determine optical density A1 at a wavelength of 340 nm after 20 sec of reaction at 37°C and optical density A2 after 2 min of reaction. Pyruvate kinase activity was calculated according to the operating manual instructions. Data for all samples came from three independent experiments.
Western blotting
Cells were cultured and treated with active fraction as described in section Glucose consumption, then the cells were washed twice with pre-cooled phosphate-buffered saline (PBS) at 4°C, lysed with RIPA lysis buffer (Beyotime, Shanghai, China) containing 1% phenylmethyl sulfonyl fluoride (Solarbio, Beijing, China) and 1% protease inhibitor cocktail (Epizyme, Shanghai, China) on ice, harvested, and centrifuged at 12,000 g for 20 min at 4°C. The supernatant was assayed using the BCA protein assay (KeyGEN BioTECH, Nanjing, Jiangsu, China), and equal amounts of protein in each sample (15 µg) were fractionated by 10% sodium dodecyl sulfate-polyacrylamide gel electrophoresis, then electrotransferred onto polyvinylidene difluoride membranes (0.45 mm, Millipore, NY, USA). Membranes were blocked for 15 min at room temperature with protein-free fast blocking solution (Epizyme, Shanghai, China) that had been diluted to 1X with Tris-buffered saline containing Tween-20 (TBST), then incubated overnight at 4°C with primary antibody (diluted 1:5000) against PKM2, cyclin D1, c-myc or β-actin. Membranes were washed three times with TBST, then incubated at room temperature for 1 h with horseradish peroxidase-coupled goat anti-mouse secondary antibody (diluted 1:5000). Antibody binding was visualized using ECL chemiluminescence reagent (Affinity, Jiangsu, China), imaged using a Bio-Rad imaging system (Bio-Rad, version 2.0.0.27, USA), and quantified using ImageJ (version 1.8.0, US National Institutes of Health, Bethesda, MD, USA). Protein levels were normalized to those of β-actin. Data for all samples came from three independent experiments.
RT-qPCR
Cells were cultured and treated with active fraction as described in section Glucose consumption, then cells were harvested and total cellular RNA was extracted using Trizol (Invitrogen, Thermo Fisher Scientific, Inc.), reverse-transcribed into cDNA using a commercial kit (Tiangen, Beijing, China), and subjected to quantitative PCR using the primers in Table 1., FastFire qPCR Premix (Tiangen, Beijing, China), and the CFX Connect Real-Time system (BioRad, version 1.0 (4.0.2325.0418), USA). PCR involved pre-denaturation at 95°C for 1 min followed by 40 cycles of denaturation at 95°C for 5 sec, annealing, and extension at 60°C for 15 sec. Levels of mRNAs were determined using the 2−ΔΔCt method and normalized to those of GAPDH mRNA. Data for all samples came from three independent experiments.
Table 1
Primers used for quantitative PCR.
Target gene | Primer direction | Primer sequence (5'-3') | Accession no. |
Cyclin D1 | F | GCTGCGAAGTGGAAACCATC | NM_053056.3 |
R | CCTCCTTCTGCACACATTTGAA |
c-myc | F | GGCTCCTGGCAAAAGGTCA | NM_002467.6 |
R | CTGCGTAGTTGTGCTGATGT |
PKM2 | F | ATGTCGAAGCCCCATAGTGAA | NM_002654.6 |
R | TGGGTGGTGAATCAATGTCCA |
GAPDH | F | GGAGCGAGATCCCTCCAAAAT | NM_001256799.3 |
R | GGCTGTTGTCATACTTCTCATGG |
F, forward; PKM2, M2-type pyruvate kinase; R, reverse | |
Knockdown of PKM2
Briefly, HCT116 or LoVo cells were inoculated in 96-well plates or 6-well plates at appropriate densities. When cells reached 80% confluence, they were transfected with short interfering RNAs (siRNAs) targeting PKM2 (GenePharma, GenBank Accession no. NM_002654.6, Shanghai, China) (sense 5’-GGCUGGACUACAAGAACAUTT-3’; antisense 5’-AUGUUCUUGUAGUCCAGCCTT-3’) or negative control RNA (sense 5’-UUCUCCGAACGUGUCACGUTT-3’; antisense 5’-ACGUGACACGUUCGGAGAATT-3’) using Lipofectamine 3000 (Invitrogen, Thermo Fisher Scientific, Inc.) according to the manufacturer's instructions. The siRNAs were mixed with Lipofectamine in fresh serum-free medium, incubated for 15 min at room temperature in the dark, and added 0.2 µg/well in 96-well plates or 5 µg/well 6-well plates in to cells for 6 h. Then the transfection medium was replaced with fresh medium containing active fraction or not, and cultures were incubated 48 h. Cells were analyzed for viability as described in section Cell viability and aerobic glycolysis as described from section Glucose consumption to Pyruvate kinase activity.
Antitumor activity in vivo
30 male BALB/c nude mice (Gempharmatech Co., Ltd, Sichuan, China) 4–5 weeks old weighing 18–22 g were housed (22˚C and 40‑70% humidity, with a 12‑h light/dark cycle and free availability of food and water) at the Experimental Animal Center of Southwest Medical University and subcutaneously inoculated with HCT116 cells (1.5×106 in 100 µl) in the right axilla. When the tumor volume reached about 50 mm3, the mice were randomly divided into five groups of six animals each: the control group received saline, the positive control group received 5-FU at 25 mg/kg and three other groups received active fraction at doses of 25, 50, or 100 mg/kg. All treatments were delivered intraperitoneally in a volume of 100 ml every other day. Tumor volume was measured daily using the formula [0.5 × (long diameter) × (short diameter)2]. Tumor inhibition rate was measured as [(mean tumor mass of control group - mean tumor mass of treatment group) / mean tumor mass of control group] × 100%. Mouse body weight was also measured daily. After 10 administrations, animals were induced anaesthetised in the R500IE animal anaesthesia machine (3.5% isoflurane, 3.5 l/min gases flow rate, RWD, Guangdong, China) and subsequently sacrificed by cervical dislocation, tumors were excised, weighed, fixed with 10% formaldehyde, embedded in paraffin and cut into 4-µm sections. Sections were dehydrated by xylene and ethanol at 37°C, and then peroxidase was blocked with 3% H2O2 for 10 min. Blocked with 3% bovine serum albumin (Servicebio, Wuhan, China) for 20 min at room temperature, the sections were incubated overnight at 4°C with PKM2 (diluted 1:100) or Ki67 (diluted 1:100). Then, the horseradish peroxidase conjugated goat anti-mouse IgG (H + L) (diluted 1:100) was incubated at 37°C for 30 min. DAB chromogenic kits (ZSGB-BIO, Beijing, China) were used to visualize the signals. Depending on the experiment, tissue was also stained with hematoxylin (dyeing for 15min) and eosin (dyeing for 5min) at room temperature. All sections examined histologically in the Digital Pathology Scanner (KF-PRO-002, KFBIO, Zhejiang, China).
The animal study was reviewed and approved by the Animal Ethics Committee of Southwest Medical University (approval swmu20230080).
All animal experiments complied with the ARRIVE guidelines were carried out in accordance with the U.K. Animals (Scientific Procedures) Act, 1986 and associated guidelines, EU Directive 2010/63/EU for animal experiments.
Statistical analysis
All experimental data were analyzed using GraphPrism 8.0 (San Diego, CA, USA) and expressed as mean ± standard deviation (SD). Differences between two groups were assessed for significance using one-way ANOVA and Tukey's test, while differences among at least three groups were assessed using two-way ANOVA.