Baicalein inhibits cell proliferation and induces apoptosis in glioblastoma by downregulating LGR4-EGFR pathway

doi:10.21203/rs.3.rs-4116136/v1

Download PDF

Article

Baicalein inhibits cell proliferation and induces apoptosis in glioblastoma by downregulating LGR4-EGFR pathway

https://doi.org/10.21203/rs.3.rs-4116136/v1

This work is licensed under a CC BY 4.0 License

Journal Publication

published 28 Oct, 2024

Read the published version in Cancer Gene Therapy →

You are reading this latest preprint version

Patients with glioblastoma (GBM) have poor prognoses and limited therapeutic options. LGR4 was reported to overexpressed in GBM and involved in tumorigenesis of many cancers, Baicalein (BAI) is a kind of flavonoid that exhibited anti-tumor effects in various tumors. However, the function and association of BAI and LGR4 in GBM are still unclear. In thisi study, firstly, GEPIA and HPA databas was used to perform expression and survival analysis of LGR4 in GBM patients. Then, the significance of LGR4-EGFR in GBM cells (HS683 and KNS89) and GBM animal models was explored by RNA interference and subcutaneous transplantation. Additionally, GBM cells were treated with BAI to explore the role and mechanism of BAI involved in GBM. The results showed that LGR4 was highly expressed in GBM and related to bad prognosis. LGR4 knockdown obviously repressed the proliferation and EGFR expression but induced apoptosis in GBM cells, however, the situations were reserved by EGFR overexpression and CBL knockdown. In contrast, both in vitro and in vivo experiments revealed LGR4 overexpression facilitated GBM cellular biological activities and promoted tumor development, but the effects were rescued by BAI and EGFR inhibitor. In addition, si-LGR4 accelerated EGFR protein degradation while oe-LGR4 exhibit opposite effect. Without affecting normal cellular viability, BAI inhibited malignant behaviour, interacted with LGR4 and blocked the LGR4-EGFR pathway in both GBM cells. Taken together, our data suggested that BAI could inhibit GBM cell proliferation and induce apoptosis via downregulation of the LGR4-EGFR pathway, and the LGR4-EGFR pathway may be an underlying target for GBM therapy of BAI.

Health sciences/Diseases/Cancer/Cancer therapy/Drug development

Health sciences/Diseases/Cancer/Cancer genetics

Baicalein

glioblastoma

LGR4-EGFR pathway

cell proliferation

apoptosis

Glioblastoma (GBM) is the most common intracranial tumor with high mortality[1]. In spite of intensive efforts, the therapeutic options for GBM are still limited, and the mean survival time for patients is less than 2 years following diagnosis[2]. Similar to the majority of cancers, the high death rate of GBM results from GBM cells possessing the features of indefinite proliferation, dysregulated apoptosis, and infiltration into adjacent tissues frequently[3]. GBM remains fatal, even though GBM patients were treated with aggressive management of surgery, radio and chemotherapy[4]. Therefore, other potential methods for treating GBM are desperately needed.

LGR4, also known as GPR48, has been found to be highly expressed in many cancer tissues, including glioma tissues[5]. EGFR expression level always contributes to cancer development and worse prognosis[6]. Many functions of cancer stem cell (CSC) rely on EGFR, for example, stemness, metabolism, immunomodulatory activity, dormancy, and resistance to therapy[7]. Mechanistically, LGR4 can interact with EGFR, block the degradation and ubiquitination of EGFR, thereby leading to the persistent activating of EGFR[8]. A published study suggested that LGR4/EGFR pathway in hepatocellular carcinoma (HCC) facilitates tumor development and contributes to maintaining the features of stem cells[7]. In addition, evidence exhibited by previous research suggested that the LGR4-EGFR pathway can be used for a novel therapeutic target for breast cancer (BC), and deactivating the LGR4-EGFR pathway can inhibit the metastasis of BC cells[8]. Nevertheless, there is still no clear evidence for the role of LGR4 on GBM via regulating EGFR.

Baicalein (BAI) is the principal flavonoid isolated from S.baicalensis, which possesses numerous beneficial properties and is always utilized for treating multiple ailments[9]. Recent research has revealed that BAI exerts its anticancer activity by facilitating apoptosis, blocking cell growth, activating autophagy and regulating some molecular pathways, such as EGFR/ERK/NF-κβ pathway[10] or EGFR/ERK/Akt pathway[11]. Moreover, scholars overlapped BAI targets with oral squamous cell carcinoma-associated genes, EGFR belongs to the top 10 genes with high centrality measures[12]. However, the specific role and mechanism of BAI on GBM are still not clear.

Therefore, in this research, we conducted in vitro and in vivo experiments to explore whether BAI can exert its protective role against GBM by downregulating the LGR4-EGFR pathway, thus providing a novel strategy for treating GBM.

2.1 LGR4 expression analysis

Gene Expression Profiling Interactive Analysis (GEPIA) and Human Protein Atlas (HPA) database were applied for public data analysis (the website of GEPIA is http://gepia.cancer-pku.cn/ and the website of HPA ishttps://www.proteinatlas.org/). LGR4 expression in the tumor tissues of brain lower grade glioma was compared to that in TCGA and GTEx. In addition, GEPIA was also used to calculate the overall survival of brain lower grade glioma patients based on LGR4 expression. Furthermore, HPA exhibited the expression of LGR4 in the brain tissues of patients with or without GBM.

2.2 Cell culture and transfection

GBM cell lines (U-251 MG, A172, HS683, KNS89, U-87 MG, U-118 MG) were supplied by Sai Baikang Biotechnology (China), and human astrocytes (SVGP12) were obtained from ATCC (USA). In addition, mouse astrocytes used in the study were extracted from the mouse as described previously[13]. All cells were cultured in dulbecco's modified eagle medium medium containing 10% fetal bovine serum (FBS) at 37℃ in a CO₂- and humidity-controlled incubator.

For cell transfection, small interfering RNA (siRNA) targeting human LGR4 and CBL (si-LGR4 and si-CBL), overexpression vector of LGR4 and EGFR (oe-LGR4 and oe-EGFR) as well as respective negative controls (si-NC and vector) were synthesized by Shanghai Jima Pharmaceutical Technology Company Limited (China). All cells were transfected with Lipofectamine 3000, and harvested 48 h after transfection.

2.3 CCK-8 assay

Cellular viability was evaluated with CCK-8 Assay Kit (C0039, Biyuntian, China). In short, cells were seeded and cultured with or without BAI in 96-well plates. Upon incubation for a predetermined time, CCK-8 solution (10 µL) was added into each well and culture for another 4 h. Thereafter, absorbance at 450 nm was tested using a microplate reader (CMaxPlus, MD, USA).

2.4 Counting the number of cells

The cells were grown in medium with 0, 20, 40 and 80 µM of BAI at 37℃ in a CO₂- and humidity-controlled incubator. After 48 h, the medium was removed and photographed by a light microscope to count the number of cells.

In addition, clone formation assay were conducted to evaluated proliferation ability of the cells. In short, cells were seeded in 6-well plates containing or not containing BAI. Every 3 days, the media was replaced. Following 2 weeks of culture, cells were rinsed by phosphate buffer saline (PBS), fixed with paraformaldehyde, and stained by crystal violet. Then, the images of the wells were scanned and the number of colonies was calculated to assess the ability of cellular proliferation. Colonies containing 50 or more cells were considered a clone.

2.5 5-ethynyl-20-deoxyuridine (EdU) assay

Cell proliferation was detected by adopting EdU cell proliferation kit (C0078s, Biyuntian, China). Briefly, cells were seeded into a 12-well plate. Following treatment, EdU was applied to incubate the cells for 4 h. Then, cells were fixed by 95% ethanol and infiltrated in 0.3% TritonX-100. Subsequently, the cells reacted with 0.5 mL of Click reaction mixture and 1 mL of 4',6-diamidino-2-phenylindole (DAPI), both reactions were conducted under a light-shielding environment. Finally, the staining results were visualized with a fluorescence microscope.

2.6 Apoptosis detection

Cells were seeded in 6-well plates, and cultured with or without BAI for suitable times. Then, cells were collected, rinsed using ice-cold PBS twice and centrifuged to obtain cell suspension. Thereafter, cells were stained with 5 µL Annexin V-FITC and 10 µL PI at room temperature (RT) in darkness (556547, BD, Singapore). In the end, the apoptosis rate of the cell was determined with the help of flow cytometry (NovoCyte, Agilent, China) within 1 h.

2.7 Transwell assay

Cell invasion as well as migration were assessed by Transwell assay. For invasion assay, cells in serum-free media were added to the upper chamber pre-coated with matrigel (356234, BD, USA) after treatment. Medium containing 10% FBS was loaded into the bottom chamber. After incubation for 24 h, the cells invading to the bottom chamber were fixed by formaldehyde, dyed with crystal violet and calculated under the microscope. For the migration assay, all the steps were the same as those conducted in the invasion assay except that matrigel was not used in the upper chamber.

2.8 RNA extraction and quantitative PCR (qPCR)

After treatment, the total RNA of the cell lines was extracted using EZ-10 Total RNA Miniprep Kit (B618583-0100, Sangon Biotech, China), and transcribed to cDNA reversely by Reverse Transcription Kit (CW2569, CWBio Co., Ltd., China). To quantify the expression of target genes, quantitative PCR was carried out with a SYBR Green qPCR kit (11201ES08, Yeasen, China) and specific primers. All the primer sequences used in the research were presented in Table 1.

Table 1

quantitative PCR primers
Gene	Forward Primer	Reverse Primer
Human LGR4	ACTCAAAGTTCTAACGCTCCAG	AAAGCACTCAGCCCTCGAATG
Human AXIN2	CAACACCAGGCGGAACGAA	GCCCAATAAGGAGTGTAAGGACT
Human CD44	CTGCCGCTTTGCAGGTGTA	CATTGTGGGCAAGGTGCTATT
Human SOX2	GCCGAGTGGAAACTTTTGTCG	GGCAGCGTGTACTTATCCTTCT
Human OCT4	CTGGGTTGATCCTCGGACCT	CCATCGGAGTTGCTCTCCA
Human β-actin	CATGTACGTTGCTATCCAGGC	CTCCTTAATGTCACGCACGAT

2.9 Western blotting

The total proteins of the cells and tissues were isolated with RIPA buffer (P0013B, Biyuntian, China), loaded and run on a 10% sodium dodecyl sulfate-PolyacrylamideGel Electrophoresis, and transferred to Polyvinylidene difluoride membranes (IPVH00010, millipore, USA). After blocking with 5% non-fat milk, the membranes were probed by the primary antibodies overnight at 4℃. On the second day, the membrane reacted with secondary antibodies. Thereafter, the protein blots were developed and β-actin was served as a control. The information on the primary antibodies applied in the study were exhibited in Table 2.

Table 2

Antibody information
Antibody	Source	Cat No.	Dilutions
LGR4	BIOSS	bs-22163R	1:1000
Bax	Affinity	AF0120	1:1000
Bcl-2	Affinity	AF6139	1:1000
Caspase-3	abcam	ab13847	1:500
β-catenin	Affinity	AF6266	1:1000
E-cadherin	proteintech	20874-1-AP	1:5000
Vimentin	abcam	ab20346	1:1000
p-EGFR	Affinity	AF3044	1:1000
EGFR	abcam	bs-22163R	1:1000
β-actin	Affinity	AF7018	1:10000
Bax	CST	2774S	1:1000
Bcl-2	CST	15071S	1:1000
Caspase-3	CST	9662S	1:1000
CTNNB1	CST	9562S	1:1000
E-cadherin	CST	14472S	1:1000
Vimentin	CST	5741S	1:1000
EGFR	CST	54359S	1:1000
β-actin Antibody	Abcam	ab6276	1:5000

2.10 Ubiquitination assay

Ubiquitination assay was conducted with MG132. In short, after finishing transfection, cells were split into 4 groups according the transfected siRNA as following, MG132 groups was treated with MG132, while the other groups were treated with the same volume of dimethyl sulfoxide (DMSO). 8 h later, the cells were collected and analyzed by western blotting.

2.11 Protein turnover assay

After transfection with specific plasmids, 100 µg/m of cycloheximide (CHX) was added to the cells. After incubation for the indicated time, the cells were collected and western blotting was conducted.

2.12 Biophysical Techniques

The binding affinity between LGR4 and BAI was quantified by microscale thermophoresis (MST), which was conducted using Monolith NT.115 instrument. LGR4 was labeled by Monolith Protein Labeling Kit RED-NHS 2nd Generation Kit. Then, the affinity was measured under MST buffer. In short, the sample were immersed in NT.115 standard treated capillaries. Then, we performed the measurements at 40% IR power, a fixed concentration of labeled LGR4 as well as constantly increasing concentration of BAI. Finally, MO. Affinity Analysis software was applied for data analysis.

2.13 Cellular thermal shift assay (CETSA)

Cells were treated with BAI (80 µM) or DMSO (0.1% v/v) for 1 h. Then, the cells were harvested and distributed into 7 tubes equally. Each tube was heated for 3 min at the following temperature: 41℃, 43℃, 47℃, 50℃, 53℃, 56℃, and 61℃, then the tubes were cooled for 3 min at RT. Then, the samples underwent freeze-thaw cycles for 3 times with liquid nitrogen to lyse the cells. After the reaction, the lysates were centrifuged, and the supernatants were collected for western blotting analysis.

2.14 In vivo experiments

All animal experiments were approved by the Animal Experimentation Ethics Committee of Zhejiang Eyong Pharmaceutical Research and Development Center (Certificate No. SYXK (Zhe) 2021-0033) and followed up with the guidelines of the Institutional Animal Care and Use Committee. Male BALB/c nude mice (5–6 weeks old, 17–20 g) in SPF condition were purchased from Beijing Vital River Laboratory Animal Technology Co., Ltd. All mice were kept in controlled light (12 h light/dark period), temperature (20℃-24℃) and humidity (50%-60%) room with free access to food and water. The transfected HS683 cells in the logarithmic phase were harvested to prepare a cell suspension, and the density of the suspension was adjusted to 2.5×10⁷/mL with saline. In order to create GBM model, 200 µL cell suspension was injected into the right axilla of the mice subcutaneously[14]. When the average tumor size reached 150 mm³, mice injected with HS683 cells transfected with vector were randomized into Vector and Vector + erlotinib groups, and mice injected with HS683 cells transfected with oe-LGR4 were randomized into oe-LGR4, oe-LGR4 + BAI and oe-LGR4 + erlotinib groups (n = 6). The mice in the Vector + erlotinib and oe-LGR4 + erlotinib were intraperitoneally injected with 10 mg/kg erlotinib (ERL, EGFR inhibitor) once a day[15], and the mice in the oe-LGR4 + BAI were administrated with 40 mg/kg BAI once a day[16]. In parallel, the mice in the Vector and oe-LGR4 groups received saline in the same way, all the treatments were last for 30 days. During the experiment, the tumor volume of the mice was recorded every 5 days. After finishing the last injection, the animals were euthanized, the tumor tissues were removed and weighed immediately. After that, tumor tissues were immersed in paraformaldehyde, embedded in paraffin and cut into slices for Immunohistochemistry, Terminal-deoxynucleotidyl transferase mediated nick end labeling (TUNEL) and western blot assays.

2.15 Statistical analysis

The study was analyzed with SPSS 16.0, and the data was displayed as mean ± SD. Student’s t-test was used to compare the differences between two groups, and Multiple group comparisms were made by one-way ANOVA and Tukey tests. The Kruskal-Wallis H test was applied when variances were not homogeneous. p < 0.05 was considered statistically significant.

3.1 LGR4 was highly expressed in GBM and related to poor prognosis

Firstly, the expression of LGR4 in GBM was analyzed by the GEPIA database, and the results revealed that the expression of LGR4 in 518 GBM tissues was higher than that in 207 normal tissues, meanwhile, high LGR4 expression in GBM predicted poor outcome (Fig. 1A-B). In addition, HPA also demonstrated LGR4 was highly expressed in the brain tissues of GBM patients (Fig. 1C). Next, in order to further confirm LGR4 expression in GBM, qPCR and western blotting were conducted to measure LGR4 expression in human astrocytes (SVGP12) and GBM cells. The results showed both at the mRNA level and protein level, LGR4 expression was higher in GBM cells than in astrocytes, especially in HS683 and KNS89 cells(Fig. 1D-E). Therefore, HS683 and KNS89 cells were chosen for the following experiments.

3.2 Knockdown of LGR4 suppressed the malignant behaviour and EGFR phosphorylation of GBM cells

In order to explore the role of LGR4 in cellular behaviour, three siRNAs targeting human LGR4 were designed to knock down LGR4 expression in HS683 and KNS89 cells. LGR4 knock-down efficiency was verified by qPCR and western blotting. si-LGR4-3 was selected for subsequent experiments for its higher knockdown efficiency (Fig. 2A-B).

Based on results obtained from GEPIA and HPA databases, we conjectured that LGR4 may facilitate GBM cellular malignant behaviour. Hence, CCK-8, colony formation, EdU, apoptosis as well as Transwell assay were utilized to detect the effect of LGR4 knockdown on GBM. As expected, LGR4 knockdown significantly inhibited the viability (Fig. 2C), proliferation (Fig. 2D-E), migration and invasion (Fig. 2G) of GBM cells, but upregulated the apoptosis rate of GBM cells (Fig. 2F). Furthermore, western blotting was conducted to further demonstrated the role of LGR4 knockdown on GBM cellular apoptosis as well as migration and invasion (Fig. 3). Of note, western blot also demonstrated that LGR4 knockdown decreased the phosphorylation of EGFR in GBM cells.

3.3 BAI inhibited cellular malignant behaviour, blocked the LGR4-EGFR pathway and interacted with LGR4 in GBM cells

Then, HS683 and KNS89 cells were treated with increasing doses of BAI for 24, 48 and 72 h and applied CCK-8 assay to measure cellular viability; the results revealed that BAI effectively reduced the viability of GBM cells in a dose- and time-dependent fashion (Fig. 4A). When the concentration of BAI above or equal to 20 µM, BAI significantly affect GBM cellular viability, no matter the treatment time was 24 h, 48 h or 72 h. However, after treatment for 48 h, 0-160 µM of BAI did not affect the viability of astrocytes (Fig. 4B). Therefore, 20 µM, 40 µM, 80 µM and 48 h were selected for the following experiments.

Additionally, we also observed that relative to the controls, BAI decreased the number (Fig. 4C), colony-formation ability (Fig. 4D), proliferation (Fig. 4E), migration and invasion of GBM cells (Fig. 5A), but enhanced the apoptosis of GBM cells (Fig. 4F). qPCR also found that BAI could blockade the expression of LGR4, AXIN2, CD44, SOX2 and OCT4 mRNA (Fig. 5B). All the effects were presented in a dose-dependent manner. Furthermore, western blotting results further suggested the function of BAI on GBM cellular malignant behaviour (Fig. 5C). More importantly, western blot found that LGR4/EGFR pathway were blocked in BAI treatment groups (Fig. 5D).

Upon binding to different ligands, LGR4 can activate the EGFR, thereby contributing to the development of tumor progression, invasion and metastasis[17]. Thus, we speculated the role of BAI on GBM was related to LRG4. MST data demonstrated there was a relatively high affinity between BAI and LGR4 in GBM cells, the Kd values between BAI and LGR4 in HS683 cells and KNS89 cells were about 4.56 M and 4.68 M, respectively (Fig. 5E). Apart from that, CETSA was performed to further verify the binding of BAI to LGR4 in GBM cells; the results showed that the thermal stability of LGR4 in the GBM cells was increased with the upregulated temperature, indicating there was a direct interaction between BAI and LGR4 (Fig. 5F).

3.4 LGR4-induced malignant behaviour in GBM cells was rescued by BAI and EGFR inhibitor

To explore the potential molecular mechanism of BAI on GBM, we treated the cell transfected with oe-LGR4 with 2 µM of EGFR inhibitor (ERL) or 80 µM of BAI. First, we measured the viability of GBM cells using CCK-8 assay. As illustrated in Fig. 6A, GBM cells transfected with oe-LGR4 exhibited raised cell viability, however, after treatment with BAI, the viability of GBM cells transfected with oe-LGR4 were significantly decreased, which was similar to that of the oe-LGR4 + ERL group. Furthermore, colony formation analysis (Fig. 6B) as well as apoptosis detection (Fig. 6C) were carried out to check the mechanism of BAI on GBM. As expected, oe-LGR4 induced the proliferation but inhibited the apoptosis of GBM cells, however, the situation was reversed by BAI, similar to ERL. Thus, we hypothesized that EGFR may be a key gene for the over-expression LGR4 caused GBM. To test the relationship between LGR4 and EGFR, western blot was performed. The results shown in Fig. 6D revealed that interference of LGR4 expression could also efficiently interfere with EGFR expression. Then, si-LRG4 and oe-LGR4 transfected GBM cells were treated with 20 µM of MG132 (proteasome inhibitor) for 8 h and 100 µg/mL of CHX (protein synthesis inhibitor) to measure the level of LGR4 and EGFR. The results found that si-LGR4 accelerated EGFR protein degradation and oe-LGR4 inhibited EGRE protein degradation (Fig. 6E-F).

3.5 The inhibition of GBM cell growth by LGR4 knockdown was reversed by EGFR overexpression and CBL knockdown

To reveal the underlying molecular mechanism of LGR4 knockdown regulation of cell malignant behaviour in GBM cells, si-LGR4 and oe-EGFR were co-transfected into HS683 and KNS89 cells. First, LGR4 knockdown downregulated EGFR protein expression, nevertheless, after transfection with oe-EGFR, this downregulation was reserved (Fig. 7A). Next, the function of oe-EGFR on si-LGR4 induced cell proliferation and hampered cell apoptosis were detected. The colony formation assay showed that oe-EGFR could rescue LGR4 knockdown impaired cell proliferation ability (Fig. 7B). The apoptosis detection indicated that LGR4 knockdown accelerated the apoptosis of GBM cells, but the effect was abolished by oe-EGFR (Fig. 7C).

CBL is an E3 ubiquitin-protein ligase that drives EGFR proteasomal degradation. Accumulating evidence has reported that CBL protein can serve as a tumor suppressor in numerous cancer, including GBM[18]. Accordingly, we further verified the mechanism of LGR4 knockdown on GBM. As displayed in Fig. 8A, si-LGR4 blocked LGR4 protein expression but increased CBL protein expression. In addition, Fig. 8B-D found that LGR4 knockdown effectively decreased EGFR protein expression, inhibited cell proliferation and facilitated cell apoptosis, in HS683 and KNS89 cells. However, those situations were all rescued by si-CBL.

3.6 BAI inhibited LGR4 induced GBM development by suppressing EGFR in vivo

For confirming the role and mechanism of BAI on GBM, HS683 cells were used to generate an in vivo xenograft model. According to our results, compared to the oe-LGR4 group, the tumor volume of oe-LGR4 + BAI group was significantly decreased from day 10, and the weight of the tumor was also reduced obviously after completing the treatment (Fig. 9A). Additionally, compared to the oe-LGR4 group, the expression of Ki67 was decreased while the apoptosis was increased in the tumor tissues of the oe-LGR4 + BAI group (Fig. 9B-C). Interestingly, those trends were also observed in the oe-LGR4 + ERL group. What is more, oe-LGR4 increased the protein expressions of LGR4 and EGFR, but decreased the protein expression of CBL, those changes were reversed by treating BAI as well as ERL, especially for BAI (Fig. 9D).

GBM is the deadliest brain tumor for adults, with still no cure with a short median survival (about 15 months)[19]. Despite some developments in GBM therapies, the prognosis of GBM patients is still dismal[20]. At present, there are only a few drugs have gained Food and Drug Administration approval for treating GBM in the clinic, however, since the high malignancy as well as intensive invasion of GBM cells, those drugs are not generally effective[21]. Thus, further investigating the mechanism and finding new therapeutic methods for GBM are urgent. In this study, we reported the therapeutic effect and the possible action mechanism of BAI on GBM in vitro and in vivo.

Cancer is featured by uncontrolled cell proliferation and apoptosis, thus, repressing cell proliferation and inducing cell apoptosis have been regarded as an effective approach to treat the majority of cancer, including GBM[22]. Increasing studies have revealed that various plant-derived compounds can be used for treating cancers, due to their function on the regulation of cell growth and death[23]. Flavonoids are ubiquitously spread in plants, and have been proposed as an important source of new chemotherapeutic drugs to treat cancer due to their various cellular mechanisms of action and low adverse effects[24]. BAI is a kind of flavonoid isolated from dry roots of S.baicalensis, has been reported to induce autophagy and apoptosis in BC cells by inhibiting PI3K/AKT pathway in vivo and in vitro[25]. In addition, BAI also has been found to repress the proliferation and block the cell cycle of colorectal cancer cells through decreasing Ezrin and activating P53 pathway-associated proteins[26]. However, virtually no research assessed the role of BAI on GBM. In this study, our data showed after treatment with BAI, the malignant behaviour of GBM cells was repressed, indicating that BAI may alleviate GBM by inhibiting proliferation and inducing apoptosis of GBM cells.

LGR4 is broadly expressed in many tissues, and the importance of LGR4 has been gradually acknowledged by scholars in cancer development[27]. On the one hand, LGR4 itself is a key gene for controlling oncogenesis, metastasis and CSC maintenance in BC, high LGR4 expression implied a poor prognosis in patients with BC[28]. On the other hand, LGR4 promotes cancer occurrence and development via activating multiple pathways, such as EGFR transactivation. For example, LGR4 promoted the migration and proliferation of keratinocyte cells, and the effect was related to the activation of the EGFR/ERK/STAT3 pathway[29]. Zhang et al. also have demonstrated that by targeting LGR4, miR-137 inhibits the migration and epithelial-mesenchymal transition (EMT) of prostate cancer cells via EGFR/ERK pathway[30]. In agreement with previous research, in the present study, we found LGR4 was highly expressed in GBM patients and GBM cells, patients with higher LGR4 expression have worse survival, thus, we speculated that LGR4 repression may act as an effective approach to improve GBM via inactivating EGFR.

In order to verify our hypothesis, RNA interference technology was applied to control LGR4 expression, and found that reducing LGR4 expression inhibited cellular malignant behaviour and downregulated EGFR phosphorylation in GBM cells, consistent with published research that EGFR was lowly expressed in the tissues of LGR4 knockout animals[31]. Further investigation revealed that LGR4 overexpression facilitated cell proliferation and blocked apoptosis for GBM cells, but the trends were reserved by EGFR inhibitor. These results provided compelling evidence that EGFR is essential for LGR4 to facilitate the progression of GBM. BAI has been reported to have the potential to treat HCC or BC by negatively regulating EGFR/ERK/NF-κβ pathway[10] or EGFR/ERK/Akt pathway[11]. Consistently, in vitro experiments revealed that after treatment with BAI, the expressions of LGR4 and EGFR were decreased and BAI interacted with LGR4 directly. Collectively, those data implied BAI may inhibit proliferation and induce apoptosis of GBM cells by downregulating the LGR4-EGFR pathway. However, what is the specific mechanism of LGR4 on EGFR?

CBL is a member of the CBL family, closely associated to tumor occurrence and progression[32]. As a ubiquitin ligase, CBL is able to directly or indirectly bind to activated EGFR and promote its ubiquitination, thereby regulating the targeted degradation of the receptor in the lysosome[33]. More simply put, EGFR signaling is negatively regulated by CBL ubiquitylation[34]. In triple-negative breast cancer (TNBC), CBL phosphorylation and inactivation mediated by UBASH3B leads to the upregulation of EGFR, which in turn promotes proliferation, invasion and metastasis of TNBC cells[35]. In addition, miR-675 and its precursor H19 enhance the stability and activity of EGFR and c-Met through direct binding of CBL mRNA, thereby promoting the growth and metastasis of BC[36]. In the study, we examined how LGR4 loss affects EGFR-CBL interaction, and found that LGR4 loss elevated CBL expression but decreased EGFR expression, in addition, si-LGR4 repressed cell growth and induced apoptosis was reserved by CBL knockdown, which indicated LGR4 loss augmented CBL binding to EGFR, and confirms the mechanism of BAI on GBM.

In conclusion, our data demonstrated that BAI exerted anti-cancerous functions in GBM by inhibiting cell proliferation and inducing apoptosis via downregulation of the LGR4-EGFR pathway. These findings strengthened our experimental results and the clinical application of BAI in GBM, and suggested that the LGR4-EGFR pathway is a novel therapeutic target in GBM treatment.

Data Availability Statement: The datasets generated during and/or analysed during the current study are available from the corresponding author on reasonable request.

Acknowledgements: Not applicable.

Author Contributions: XZ conceived and designed the work, acquired data; XS conceived and designed the work, played an important role in interpreting the results; QB conceived and designed the work, acquired data; LH drafted or revised the manuscript; XQ, drafted or revised the manuscript and approved the final version.

Funding: This work was supported by the Shaoxing Municipal Science and Technology Plan Project of China [grant number 2022A14022]; and the Shaoxing Health Science and Technology Project of China [grant number 2022KY003].

Ethical Approval: All animal experiments were approved by the Animal Experimentation Ethics Committee of Zhejiang Eyong Pharmaceutical Research and Development Center (Certificate No. SYXK (Zhe) 2021-0033).

Competing Interests: The authors declare no competing interests

Wang, H., et al., Additional Diagnostic Value of Unenhanced Computed Tomography plus Diffusion-Weighted Imaging Combined with Routine Magnetic Resonance Imaging Findings of Early-Stage Gliblastoma. Biomed Res Int, 2020. 2020: p. 1672736.
Hong, J., et al., PulsatillaSB365, Saponin D Induces Caspase-Independent Cell Death and Augments the Anticancer Effect of Temozolomide in Glioblastoma Multiforme Cells. Molecules, 2019. 24(18): p. 3230.
Zhang, Y., et al., β-Arrestin 1 has an essential role in neurokinin-1 receptor-mediated glioblastoma cell proliferation and G/M phase transition. J Biol Chem, 2017. 292(21): p. 8933–8947.
Frisch, A., et al., Apelin Controls Angiogenesis-Dependent Glioblastoma Growth. Int J Mol Sci 2020. 21(11): p. 4179.
Yu, C., et al., Lgr4 promotes glioma cell proliferation through activation of Wnt signaling. Asian Pac J Cancer Prev, 2013. 14(8): p. 4907–4911.
Kashyap, M. and O. Abdel-Rahman, Expression, regulation and targeting of receptor tyrosine kinases in esophageal squamous cell carcinoma. Mol Cancer, 2018. 17(1): p. 54.
Liu, Y., et al., Effect of LGR4/EGFR signaling on cell growth and cancer stem cell-like characteristics in liver cancer. Cytokine, 2023. 165: p. 156185.
Yue, F., et al., A Wnt-Independent LGR4-EGFR Signaling Axis in Cancer Metastasis. Cancer Res, 2021. 81(17): p. 4441–4454.
Cai, P., et al., Baicalein ameliorates osteoporosis via AKT/FOXO1 signaling. 34198266, 2021. 13(13): p. 17370–17379.
Tian, J., et al., MiR-3663-3p participates in the anti-hepatocellular carcinoma proliferation activity of baicalein by targeting SH3GL1 and negatively regulating EGFR/ERK/NF-κB signaling. Toxicol Appl Pharmacol, 2021. 420: p. 115522.
Shang, D., et al., Baicalein suppresses 17-β-estradiol-induced migration, adhesion and invasion of breast cancer cells via the G protein-coupled receptor 30 signaling pathway. Oncol Rep, 2015. 33(4): p. 2077–2085.
Tang, B. and Y. Dong, Network pharmacology and bioinformatics analysis on the underlying mechanisms of baicalein against oral squamous cell carcinoma. J Gene Med, 2023: p. e3490.
Yu, H., et al., Targeting connexin 43 provides anti-inflammatory effects after intracerebral hemorrhage injury by regulating YAP signaling. J Neuroinflammation, 2020. 17(1): p. 322.
Le Mercier, M., et al., Evidence of galectin-1 involvement in glioma chemoresistance. Toxicol Appl Pharmacol 2008. 229(2): p. 172–183.
Yang, K., et al., Ursolic acid promotes apoptosis and mediates transcriptional suppression of CT45A2 gene expression in non-small-cell lung carcinoma harbouring EGFR T790M mutations. Br J Pharmacol 2019. 176(24): p. 4609–4624.
Liu, C., et al., Baicalein Restores the Balance of Th17/Treg Cells via Aryl Hydrocarbon Receptor to Attenuate Colitis. Mediators Inflamm, 2020. 2020: p. 5918587.
Ordaz-Ramos, A., et al., The Role of LGR4 (GPR48) in Normal and Cancer Processes. Int J Mol Sci, 2021. 22(9): p. 4690.
Rojas-Ríos, P., et al., CblAubergine and piRNAs promote germline stem cell self-renewal by repressing the proto-oncogene. EMBO J, 2017. 36(21): p. 3194–3211.
Nadeem Abbas, M., et al., Advances in Targeting the Epidermal Growth Factor Receptor Pathway by Synthetic Products and Its Regulation by Epigenetic Modulators As a Therapy for Glioblastoma. Cells, 2019. 8(4): p. 350.
Wang, K., et al., Molecular and clinical characterization of TMEM71 expression at the transcriptional level in glioma. CNS Neurosci Ther, 2019. 25(9): p. 965–975.
Huang, R., et al., RGS16 promotes glioma progression and serves as a prognostic factor. CNS Neurosci Ther, 2020. 26(8): p. 791–803.
Faghfoori, Z., et al., Anticancer effects of bifidobacteria on colon cancer cell lines. Cancer Cell Int, 2021. 21(1): p. 258.
Nagesh, P., et al., Tannic acid inhibits lipid metabolism and induce ROS in prostate cancer cells. Sci Rep, 2020. 10(1): p. 980.
Garcia-Oliveira, P., et al., Status and Challenges of Plant-Anticancer Compounds in Cancer Treatment. Pharmaceuticals (Basel), 2021. 14(2): p. 157.
Yan, W., et al., Baicalein induces apoptosis and autophagy of breast cancer cells via inhibiting PI3K/AKT pathway in vivo and vitro. Drug Des Devel Ther, 2018. 12: p. 3961–3972.
Chen, Z., et al., Baicalein Inhibits Proliferation Activity of Human Colorectal Cancer Cells HCT116 Through Downregulation of Ezrin. Cell Physiol Biochem, 2018. 49(5): p. 2035–2046.
Luo, W., et al., Leucine-rich repeat-containing G protein-coupled receptor 4 (Lgr4) is necessary for prostate cancer metastasis via epithelial-mesenchymal transition. J Biol Chem, 2017. 292(37): p. 15525–15537.
Yue, Z., et al., LGR4 modulates breast cancer initiation, metastasis, and cancer stem cells. FASEB J, 2018. 32(5): p. 2422–2437.
Wang, Z., et al., GPR48-Induced keratinocyte proliferation occurs through HB-EGF mediated EGFR transactivation. FEBS Lett, 2010. 584(18): p. 4057–4062.
Zhang, H., et al., MicroRNA–137 regulates hypoxia–mediated migration and epithelial–mesenchymal transition in prostate cancer by targeting LGR4 via the EGFR/ERK signaling pathway. Int J Oncol, 2020. 57(2): p. 540–549.
Stevens, P. and B. Williams, LGR4: Not Just for Wnt Anymore? Cancer Res, 2021. 81(17): p. 4397–4398.
Daniels, S., et al., Loss of function Cbl-c mutations in solid tumors. 2019. 14(7): p. e0219143.
Wee, P. and Z. Wang, Regulation of EGFR Endocytosis by CBL During Mitosis. Cells, 2018. 7(12): p. 257.
Oliveira-Cunha, M., W. Newman, and A. Siriwardena, Epidermal growth factor receptor in pancreatic cancer. Cancers (Basel), 2011. 3(2): p. 1513–1526.
Lee, S., et al., Protein tyrosine phosphatase UBASH3B is overexpressed in triple-negative breast cancer and promotes invasion and metastasis. Proc Natl Acad Sci USA, 2013. 110(27): p. 11121–11126.
Vennin, C., et al., H19 non coding RNA-derived miR-675 enhances tumorigenesis and metastasis of breast cancer cells by downregulating c-Cbl and Cbl-b. Oncotarget, 2015. 6(30): p. 29209–29223.

There is NO conflict of interest to disclose.

Download PDF

Journal Publication

published 28 Oct, 2024

Read the published version in Cancer Gene Therapy →

Editorial decision: revise
05 Jun, 2024
Review #2 received at journal
04 Jun, 2024
Review #1 received at journal
29 May, 2024
Reviewer #2 agreed at journal
14 May, 2024
Reviewer #1 agreed at journal
13 May, 2024
Reviewers invited by journal
28 Mar, 2024
Submission checks completed at journal
28 Mar, 2024
First submitted to journal
27 Mar, 2024
Unknown event
19 Mar, 2024
Editor assigned by journal
17 Mar, 2024

You are reading this latest preprint version

Baicalein inhibits cell proliferation and induces apoptosis in glioblastoma by downregulating LGR4-EGFR pathway

Status:

Journal Publication

Version 1

Abstract

Figures

1. Introduction

2. Materials and methods

2.1 LGR4 expression analysis

2.2 Cell culture and transfection

2.3 CCK-8 assay

2.4 Counting the number of cells

2.5 5-ethynyl-20-deoxyuridine (EdU) assay

2.6 Apoptosis detection

2.7 Transwell assay

2.8 RNA extraction and quantitative PCR (qPCR)

2.9 Western blotting

2.10 Ubiquitination assay

2.11 Protein turnover assay

2.12 Biophysical Techniques

2.13 Cellular thermal shift assay (CETSA)

2.14 In vivo experiments

2.15 Statistical analysis

3. Results

3.1 LGR4 was highly expressed in GBM and related to poor prognosis

3.2 Knockdown of LGR4 suppressed the malignant behaviour and EGFR phosphorylation of GBM cells

3.4 LGR4-induced malignant behaviour in GBM cells was rescued by BAI and EGFR inhibitor

3.6 BAI inhibited LGR4 induced GBM development by suppressing EGFR in vivo

4. Discussion

Declarations

References

Additional Declarations

Status:

Journal Publication

Version 1