Strains and culture conditions
B. subtilis Z-14 (hereafter referred to as Z-14), which significantly reduced the growth of Rhizoctonia cerealis (a wheat sheath blight pathogen), was originally isolated from soil sampled from a wheat rhizosphere [20]. Z-14 was grown on nutritive agar (NA) overnight at 37 °C. An aliquot of the overnight culture was inoculated into 50 ml of fermentation medium (20 g of sucrose; 10 g of tryptone; 2 g of KH2PO4; 0.05 g of CaCl2; 0.05 g of MgSO4·7 H2O; and 1000 ml of distilled water; pH 7.5) in an Erlenmeyer flask and cultured for 48 h at 37 °C with shaking at 220 rpm.
Antifungal protein extraction from the Z-14 supernatant
The Z-14 culture was centrifuged for 15 min at 10 000 × g and the supernatant was retained and filtered through a 0.22-μm hydrophilic filter (Jinteng, Tianjin, China). The metabolites were precipitated from the supernatant using 80% saturated (w/v) (NH4)2SO4 and stored at 4 °C overnight. The mixture was centrifuged for 15 min at 10 000 × g and the pellet was dissolved in 10 ml of 10 mmol/l Tris-HCl buffer (pH 7.5). To remove the ammonium sulfate, the solution was dialyzed in 2-kDa cut-off dialysis tubing (Sigma-Aldrich, MO, USA) for 48 h at 4 °C, with a buffer change every 4 hours (500 ml each). The dialysates were condensed using vacuum freeze-drying to yield precipitated proteins, which were further purified using column chromatography.
Antifungal activity assessment of the metabolites from Z-14
The agar diffusion technique was used to assess the antifungal activity of metabolites from Z-14 against Rhizoctonia cerealis [33]. R. cerealis BD-13 was cultured on potato dextrose agar (PDA) slants at 25 °C for 7 d. Water was then added to the slants, the surface mycelia of which were rubbed gently with a glass rod to harvest the conidia. The fungal spore suspension (10 ml; 1 × 106/ml) was mixed with 100 ml of PDA and poured into Petri dishes (n = 6). After the PDA solidified, agar disks were excised to form wells with a diameter of 7 mm, to which were added 30 μl-aliquots of culture extract. The control comprised sterile water. For each sample, three replicates were performed. The plates were incubated for 5 d at 25 °C. The antifungal activity was determined as the diameter of the growth inhibition zone around the wells compared with that of the control well.
Ion exchange chromatography purification of antifungal proteins
Ion exchange chromatography was carried out using a HiTrap DEAE-sepharose fast Flow column (Amersham Pharmacia, Sweden) equilibrated with 10 mmol/l Tris-HCl buffer (pH 7.5) on the ÄKTA explorer 100 system obtained from Amersham Biosciences (Sweden). The proteins bound to the column were eluted sequentially using 0.05, 0.1, 0.2, 0.3, 0.45, 0.6, and 1.0 mol/l NaCl. The eluate was assessed via its absorbance at 280 nm. Each fraction was dialyzed and adjusted to the same concentration using Tris-HCl buffer. The antifungal activity of each fraction was tested against R. cerealis using the agar-diffusion method.
Purification of antifungal proteins using reverse phase chromatography
The fractions with antifungal activities were collected, and then subjected to reverse phase chromatography on a SOURCETM 5RPC 4.6/150 column (Amersham Biosciences), which had been equilibrated using 0.06% trifluoroacetic acid (TFA). The material bound to the column was eluted linearly using 60% acetonitrile solution containing 0.05% TFA. Individual fractions were collected, subjected to dialysis, and then vacuum freeze-drying was used to condense the fractions before further analysis.
Purity, molecular mass, and concentration determination of the isolated proteins
SDS-PAGE was performed using 0.75-mm-thick gels comprising a 5% stacking gel and a 12% separating gel to assess the purity and molecular mass of the separated protein fractions. The Bradford method was used to determine the protein concentration, using bovine serum albumin as the standard [34].
Antifungal protein N-terminal sequence analysis
The purified antifungal protein was separated using SDS-PAGE and then electroblotted onto a polyvinylidene fluoride membrane (Bio-Rad, USA) at 60 V for 30 min. The protein on the membrane was then applied to a 491 protein sequencer (Applied Biosystems, USA) to determine its N-terminal amino acid sequence using automated Edman degradation [35].
Construction of the expression plasmid pPIC9K-f2
The amino acid sequence homology of the N-terminus of the isolated protein was analyzed using the NCBI Basic Local Alignment Search Tool (BLAST) online search service to find similar proteins and related gene sequences. According to the gene sequence and the multiple cloning sites of the expression vector pPIC9K, the primers W-QC: CCGGAATTCATGGTA CGTCGTTTGTCGATC and W-D: ATAAGAATGCGGCCGCTTAGTGGTGGTGGTGGT GGTGTAAACCGTAATAATAAGATAG were designed, which incorporated EcoR I and Not I restriction sites in the PCR amplicon and added a sequence encoding a C-terminal His-tag. The primers were used to PCR amplify the target gene encoding the antifungal protein using Z-14 genomic DNA as the template. The PCR amplicon, encoding a His-tagged protein named f2, was ligated into expression vector pPIC9K via the EcoR I and Not I sites. The ligation products were transformed into Escherichia coli DH5α cells. Positive transformants were selected and screened for presence of the recombinant plasmid. The recombinant plasmid was validated using DNA sequencing.
Recombinant protein expression in Pichia pastoris GS115
Sac I was used to linearize the expression plasmid pPIC9K-f2, which was then transformed into electrocompetent P. pastoris GS115 cells using a model 165-2100 MicroPulser Electroporator (Bio-Rad, USA) following the manufacturer’s instructions. The obtained transformant culture was spread on plates comprising yeast potato dextrose (YPD) agar medium containing 2 mg/ml G418. Single colonies that appeared after incubation at 25 °C for 2 days were picked out and detected using PCR with the W-QC and W-D primers. For recombinant protein production, a positive transformant was inoculated into buffered minimal glycerol yeast (BMGY) medium and cultured at 25 °C for 24 h, with shaking at 250 rpm. Centrifugation was used to harvest the cells, which were resuspended in 50 ml of buffered minimal methanol yeast (BMMY) medium in a 500 ml flask. Recombinant F2 (rF2) expression was induced for 96 h and methanol was added every 24 h at 1% (v/v) final concentration. The fermentation broth was centrifuged at 10 000 × g and 4 °C for 10 min, and the supernatant was collected to measure the antifungal activity and for SDS-PAGE.
Purification of the recombinant antifungal protein
A His60 Ni SuperflowTM Resin & Gravity Column (Clontech Laboratories, CA, USA) was used to purify the HIS-tagged recombinant protein following the manufacturer’s protocol. Bound proteins were eluted successively using 20, 50, 100, and 200 mmol/l imidazole. The eluate was dialyzed to remove the imidazole and condensed using vacuum freeze-drying. The precipitate was dissolved in 10 mmol/l Tris-HCl buffer (pH 7.5) and the solution was used to detect the antifungal activity and for SDS-PAGE.
The influence of proteases, temperature, and pH on the activity of recombinant protein rF2
To analyze the effect of different pHs (range 3.0–10.0) on the antifungal activity of rF2, the pH of the culture filtrate was altered using 2 mol/l NaOH or HCl and incubated for 2 h at 37 °C. Protein rF2 was exposed to a range of temperatures (40, 60, 80, 100 and 121 °C) for 30 min to study its thermal stability. To detect its stability under protease treatment, rF2 was digested using 1 mg/ml protease K, trypsin, and pepsin (Amresco) for 60 min at 37 °C, respectively. The antifungal activities of the rF2 culture filtrates treated as detailed above were determined according to the method described by Zhao et al. [36]. The formula reported by Wong et al. was used to calculate the relative activity of the treated rF2 protein [37]. Three replicates for each treatment were assessed in three repeated experiments.
Statistical analysis
Replicate data are expressed as the mean ± the standard deviation (SD). The Statistical Product and Service Solutions (SPSS) ver. 17.0 software package was used to perform all the statistical analyses. One-way analysis of variance and Duncan’s test (P ≤ 0.05) were used to assess whether the means differed significantly.