Comparative transcriptome analysis of differentially expressed genes in the ovary and testis and identification of transformer-2 gene of Athetis dissimilis

doi:10.21203/rs.3.rs-4133905/v1

Download PDF

Research Article

Comparative transcriptome analysis of differentially expressed genes in the ovary and testis and identification of transformer-2 gene of Athetis dissimilis

https://doi.org/10.21203/rs.3.rs-4133905/v1

This work is licensed under a CC BY 4.0 License

Version 1

posted

You are reading this latest preprint version

Background

Insects have developed a variety of sex-determining regulatory mechanisms throughout their evolution. Not only do different insects use different genes and regulatory mechanisms for sex differentiation, but different subspecies populations of the same insect species can have different sex determination mechanisms. We analyzed differentially expressed genes (DEGs) from the ovary and testis transcriptomes of A. dissimilis. The function of DEGs was analyzed from various databases. The results of this research will aid in the understanding of the sex-determination mechanisms of this species.

Results

A total of 11,065 DEGs between the ovary and testis were identified, of which 6,685 genes were up-regulated and 4,380 genes were down-regulated in testis. 6,656 DEGs were annotated in NR (6,616, 99.40%), GO (1,484, 22.30%), COG (1,696, 25.48%), KEGG (2,483, 37.30%), Swiss-Prot (3,077, 46.23%), Pfam (3,967, 59.60%), and eggNOG (5,808, 87.26%). A Adistra-2 (525 bp) gene was obtained from the transcriptome of A. dissimilis, and sequence alignment with other related species revealed a highly conserved RRM domain. Phylogenetic analysis showed that the Adistra-2 protein is a close relative of the lepidopterous tra-2 protein. The temporal and spatial expression pattern of the Adistra-2 showed that it is more abundant during embryonic development than other stages, and its expression was higher in ovaries than in testes.

Conclusions

We analyzed DEGs from the ovary and testis transcriptomes of Athetis dissimilis. The characteristics of Adistra-2 gene were identified and analyzed. This work provides a theoretical reference for the sex differentiation and genetic manipulation of this insect.

Athetis dissimilis

Testis

Ovary

Differentialy expressed genes

Transformer-2

Insects have evolved a bewildering diversity of regulatory mechanisms to determine the sexes. Sex differentiation is determined by different genes and regulatory mechanisms in different insects, and even the same species with different strains show variability in the mechanisms of sex determination [1–3]. In the evolutionary process of the insect sex determination mechanism, the underlying genes of the sex determination cascade are highly conserved, while the original signals of sex determination are variable [4, 5]. Gender-specific expression of the transformer (tra) gene, a key gene regulating the original signal of sex determination, its tra product, and the transformer-2 (tra-2) gene, can achieve the specific expression of the underlying bisexual gene doublesex (dsx) through a sex-specific selective splicing mechanism. This, in turn, regulates the expression of genes related to male and female development in both sexes to achieve gender differentiation [6]. From the perspective of pest control, gaining an understanding of the genes involved in gonadal differentiation and reproduction could make a considerable contribution toward the development of novel control strategies.

Athetis dissimilis (Lepidoptera: Noctuidae) has gradually become a major pest in wheat and maize fields in recent years. Similar in appearance to A. lepigone, a voracious moth, it poses a serious threat to wheat and corn production [7]. Additionally, the frequent use of chemical pesticides has led to higher pest resistance, and developing new pest control measures is imminent. In the present study, we carried out transcriptomic sequencing of the ovary and testis of A. dissimilis to identify differentially expressed genes to better understand the regulatory mechanisms associated with the reproductive processes in this species.

Insect rearing and sample preparation

The A. dissimilis samples were collected from corn fields in Luoyang, Henan in 2014. Colonies were fed with an artificial diet in an artificial climate chamber at 25 ± 1°C on a 16 h: 8 h light: dark cycle with 80 ± 5% relative humidity.

Eggs laid by mated females at 1 (300), 2 (300) and 3 (300) days after sampling was collected. Larvae at the 1th (100), 2th (80), 3th (50), 4th (20), 5th (10), and 6th (10) instars were selected. Male (10) and female (10) pupae were collected 3 days after pupation. Male and female adults were collected 3 days after emergence and the head (30), midgut (30), malpighian tubule (50), testis (20), and ovaries (10) of male and female adults, and carcass (residual body) (10) were dissected for RNA extraction. All samples were stored in liquid nitrogen at -80°C.

Differential expression analysis

The transcriptome data of A. dissimilis ovaries and testis were obtained from previous work (SRA: PRJNA970546). Pearson's Correlation Coefficient r was used as an evaluation index of correlation among samples [8]. The closer r² is to 1, the stronger the correlation between the two samples.

DESeq2 software was used for differential expression analysis between sample groups [9]. The Benjamini-Hochberg [10] method was adopted to correct the P-value obtained from the original hypothesis test, where the corrected P-value was adopted as the key index of differentially expressed genes (DEGs) screening. During the screening process, the screening criteria were set to: a False Discovery Rate (FDR) of less than 0.01 and a Fold change (FC) greater than or equal to 4. Here the FC represented the expression ratio between two samples.

Functional annotation and enrichment analysis of DEGs

Multiple public databases were used for homology annotation, including non-redundant protein databases (NR), Protein family (Pfam), eukaryotic Ortholog Groups (KOG), SwissProt, eggnog, the Kyoto Encyclopedia of Genes and Genomes (KEGG) and Gene Ontology (GO).

Gene Ontology terms were assigned to each sequence annotated by BLASTX against the Nr database using the Blast2GO v2.5 program with an E-value threshold of 1E − 6 for further functional categorization. WEGO software [11] was used to plot the distribution of the GO functional classification of unigenes. The unigene sequences were also aligned to the COG database to predict and classify possible functions. The unigenes were assigned to KEGG pathway annotations to analyze inner-cell metabolic pathways and related gene functions using BLASTX.

Identification and bioinformatics analysis of Adistra-2

The Adistra-2 of A. dissimilis was derived from the previous transcriptome library annotation. The NCBI blast showed that the Adistra-2 was more than 95% consistent with other insects. We also verified the accuracy of Adistra-2 sequences by PCR.

The sequence similarity between Adistra-2 and homologous species was analyzed using the NCBI-Blast network server (http://blast.ncbi.nlm.nih.gov/). The TMHMM Server v2.0 program (http://www.cbs.dtu.dk/services/TMHMM-2.0/) predicted the transmembrane structure of the Adistra-2 protein. SignalP 4.1 (http://www.cbs.dtu.dk/services/SignalP/) predicted the presence and the location of signal peptides in the prediction protein. The DNAMAN software was used to compare the multi-sequence alignment of the Adistra-2 protein with the tra-2 proteins from other insects [Aedes albopictus (AWW13909.1), Cotesia congregata (CAG5074056.1), Bradysia coprophila (CBX45938.1), Drosophila melanogaster (NP_476764.1), Bombyx mori (NP_001119705.1), A. mellifera (NP_001252514.1), Tribolium castaneum (NP_001280513.1), Bemisia tabaci (QAB02877.1), Helicoverpa armigera (XP_021199210.1), Spodoptera litura (XP_022838015.1), Trichoplusia ni (XP_026724995.1), Ostrinia furnacalis (XP_028159452.1), Ostrinia furnacalis (XP_028159452.1), Ostrinia furnacalis (XP_028159452.1), Leguminivora glycinivorella (XP_047991853.1)]. A phylogenetic tree was constructed using the Neighbor-joining (NJ) method in Mega 6.0, and the confidence values among species were calculated with 1,000 Bootstrap repeats [12].

Temporal and spatial expression analysis of Adistra-2

Total RNA was extracted and transcribed to first-strand cDNA using RNAiso Plus kits and PrimeScript RT reagent with gDNA Eraser (TaKaRa, Dalian, China). Real-time quantitative PCR (RT-qPCR) was performed with SYBR® Premix Ex Taq II (TaKaRa). A GAPDH gene was used as the internal reference [13]. Adistra-F: GATGCTAAGACCGGTCGTTCTC and Adistra-R: CGGTAGTAGTCGTCTCTATC were used as primers. The total RT-qPCR reactions contained: 10 µL of SYBR Premix Ex Taq II, 2 µL of cDNA template, 0.8 µL of each primer, and 6.4 µL ddH₂O. The RT-qPCR cycling conditions were as follows: pre-denaturation at 95°C for 5 min, followed by 40 cycles of 95°C for 5 s and 58°C for 30 s. Melt curve conditions were 95°C for 10 s and 65°C for 30 s. No-template controls (NTC) were included to detect possible contamination. The target gene relative expression level was calculated using the 2^−∆∆CT method with three biological replicates. Significance was calculated with a T-test, where p < 0.05 was considered statistically significant.

Differential expression gene analysis

The r² values of the three replicates of the ovary and testis were 0.958, 0.946, 0.967, and 0.942, 0.949, 0.95, which were close to 1, indicating that the biological replicate data was reliable. The r² values between different samples of ovary and testis were 0.004, 0.009, 0.011, and 0.004, 0.009, 0.011, which were less than 0.05, indicating that there was a significant difference between the ovary and testis (Fig. 1). In total, we obtained 5,600 female-specific transcripts and 5,730 male-specific transcripts (Fig. 2). There were 11,065 DEGs between the ovary and testis of A. dissimilis, including 6,685 up-regulated genes and 4,380 down-regulated genes in the testis (Fig. 3).

Annotation and function analyses of DEGs

At the same time, 6,656 DEGs were annotated in NR (6,616), GO (1,484), COG (1,696), KEGG (2,483), Swiss-Prot (3,077), Pfam (3,967), and eggnog (5,808). Seven large databases were used to describe and classify their common functions (Table 1). According to our analysis, 2,689 DEGs of the all 7,797 unigenes were annotated in three GO term, which were biological process, molecular function, and cellular component categories, respectively. the largest functional categories were binding (49.90%) and catalytic activity (53.70%) (Fig. 4A). The GO enrichment analysis showed 15 GO terms were significantly enriched in molecular function (Table 2). For example, the GO term related to the organic cyclic compound binding (GO:0097159) was significantly enriched in the ovary-biased genes. Followed by heterocyclic compound binding (GO:1901363), DNA binding (GO:0003677), and structural constituent of ribosome (GO:0003735). The GO enrichment of the testis-biased genes displayed significant chitinase activity (GO:0004568), odorant binding (GO:0005549), and structural constituent of cuticle (GO:0042302).

Table 1

Statistics of annotation results
Database	GO	KEGG	eggNOG	COG	NR	Pfam	Swiss-Prot
Unigenes	1484	2483	5808	1696	6616	3967	3077
Ratio (%)	22.30	37.30	87.26	25.48	99.40	59.60	46.23

Table 2

GO classification in sex differential expressed genes of *Athetis dissimilis*
Term ID	Term name	Genes	FDR	P value
Ovary-biased
GO:0003735	structural constituent of ribosome	97	6.85E-37	7.60E-17
GO:0051082	unfolded protein binding	25	2.49E-11	1.20E-07
GO:0004812	aminoacyl-tRNA ligase activity	26	4.81E-26	1.80E-07
GO:1901363	heterocyclic compound binding	723	1.08E-09	1.20E-06
GO:0005213	structural constituent of chorion	11	6.41E-08	1.60E-06
GO:0097159	organic cyclic compound binding	724	1.99E-05	3.20E-06
GO:0007304	chorion-containing eggshell formation	13	5.10E-06	5.20E-06
GO:0003678	DNA helicase activity	20	6.06E-09	4.30E-06
GO:0003677	DNA binding	122	5.81E-13	5.10E-06
GO:0003743	translation initiation factor activity	30	8.79E-14	5.40E-06
GO:0003746	translation elongation factor activity	20	2.18E-29	6.20E-05
Testis-biased
GO:0004568	chitinase activity	13	1.59E-131	2.70E-07
GO:0003735	structural constituent of ribosome	1	5.68E-119	6.00E-07
GO:0005549	odorant binding	11	5.96E-31	3.10E-06
GO:0042302	structural constituent of cuticle	11	3.61E-11	5.40E-05

In the COG databases, 1,696 DEGs were annotated and classified into 25 subcategories. Among these annotated functional classes, the largest subcategory was carbohydrate transport and metabolism (229 DEGs); this was followed by the General function prediction only (200 DEGs) (Fig. 4B). 5,808 DEGs were annotated in the eggNOG databases. Three (Cell motility, extracellular structures, and general function prediction) categories were no distributed genes in the 25 categories of eggNOG (Fig. 4C).

As shown in Fig. 5A and 5B, 2,483 DEGs were annotated using the KEGG pathways database. DEGs were divided into five big pathways including cellular processes, environmental information processing, genetic information processing, metabolism, and organismal systems. among which 158 (6.99%) DEGs were annotated into “purine metabolism” and 137 (6.06%) DEGs were annotated to “RNA transport”.

Molecular identification of Adistra-2 and sequence analysis

The cDNA sequence of Adistra-2 (GenBank no. OQ799648) was obtained from our previous transcriptome database and validated by sequenced specific primers PCR. The open reading frame (ORF) of Adistra-2 was 525 bp and encoded 174 amino acids with a predicted molecular weight of 20.75 kDa and a theoretical isoelectric point of 9.75. The protein has no signal peptide or transmembrane structure.

Multiple alignment and phylogenetic analysis

The multi-sequence alignment of the Adistra-2 protein with the tra-2 proteins from other insects showed a high degree of sequence conservation within the RRM and Linker domain, which was located in the same position in all samples. Similar to other species, the RNP-1, and RNP2 were found in Adistra-2, which is very conserved in the RRM protein (Fig. 6). For phylogenetic analysis, the Adistra-2 protein was aligned with homologous sequences from other species. The phylogenetic tree was divided into different branches according to insect orders. The orthologs between different orders were distant (Fig. 7).

Spatial and temporal expression patterns of the Adistra-2 gene

The expression patterns of the temporal and spatial Adistra-2 gene were examined with RT-qPCR analyses. The results showed that the Adistra-2 gene had the highest relative transcription levels throughout embryonic development, compared to other stages (Fig. 8A). The spatial expression pattern of tra2 in A. dissimilis showed that Adistra-2 was expressed in most tissues of females and males. Adistra-2 showed especially enriched expression in the ovaries of A. dissimilis (Fig. 8B).

Understanding the molecular regulation mechanisms of insect sex determination is not only beneficial to reveal the generation and evolution of sex, but also provide theoretical and practical foundation for the genetic operation of insects. In this study, we analyzed the differentially expressed genes of ovaries and sperms of A. dissimilis through the preliminary transcriptome data, and studied the expression of transformer 2, a key gene for sex determination, in order to provide supports in sterile insect technique by targeting the insect sex determination. It provides a new idea for pest control.

Comparisons of testis and ovary transcriptomes have previously been conducted for Onychostoma macrolepis [14], Strongylocentrotus intermedius [15], Onychostoma macrolepis [16], Henosepilachna vigintioctopunctata [17], Apis mellifera [18]. Similarly, in the present study, we specifically sought to analyze the differentially expressed genes in A. dissimilis. The 5,600 (20.63%) and 5,730 (21.11%) genes identified as being specifically expressed in the ovary and testis of A. dissimilis will thus provide important genetic information for the study of reproductive regulatory mechanisms in this species.

A total of 11,065 DEGs between the ovary and testis in A. dissimilis were identified. This number is quite a lot more compared to 4,380 DEGs of Apis mellifera [18] and less compared to 14,398 DEGs of H. vigintioctopunctata [17]. Compared with the ovary, 6,685 and 4,380 DEGs were upregulated and downregulated, respectively, in the testis of A. dissimilis. They are different from 9,168 up-regulated genes and 5,230 down-regulated genes in the testis of H. vigintioctopunctata [17], and 2125 up-regulated genes and 2255 down-regulated genes in the testis of A. mellifera [18]. This may be due to differences between species.

Gene ontology distributions are known to differ substantially, both among the transcriptomes of various body parts within the same insect and between the transcriptomes of different insects. For example, the GO distribution determined in the present study was found to show a pattern similar to the gonad transcriptomes of other insects, such as the ovary and testis transcriptomes from H. vigintioctopunctata [17] or the testis transcriptomes from the silkworm, Bombyx morithe [19], the cockroach Periplaneta americana [20] and the oriental fruit fly Bactrocera dorsalis [21]. However, it differs significantly from the transcriptomes of many other insects, such as the salivary glands transcriptome of the cowpea aphid Aphis craccivora [22] and the central nervous system transcriptome of Antheraea pernyi [23]. We believe that the genes that are highly or specifically expressed in gonads show marked difference from those in other tissues because sex-biased expression tends to be high in the gonads but lower in other tissues [24–27].

The tra-2 homologous gene has been identified in Drosophila melanogaster [28, 29], Bombyx mori [30], Cochliomyia hominivorax [31], Tribolium castaneum [32], and Apis mellifera [33]. The amino acid sequence length of the tra-2 protein varies, but the RRM domain is relatively conserved, consisting of two ribonucleoprotein domains (RNP) or RNA-binding domains (RBD) [34]. Through an online BLAST search, an Adistra-2 gene was identified in A. dissimilis. Adistra-2 protein has a very conserved RRM domain (containing the RNP-1 and RNP2) and linker region, which are common features of tra-2 proteins. The RNP-1 and RRM domains are generally considered to be involved in the recognition of single-stranded RNA and can affect pre-mRNA selective splicing. Amino acid sequence alignment found that the homology and conservation of the RRM domain and linker domain in bivalves are similar, suggesting the functional similarity of tra-2 in these species [35]. According to the evolutionary tree analysis, the evolution of tra-2 in different orders of insects or other invertebrates differs, whereas the homology relation of tra-2 is more closely related to the same order of insects. This is consistent with results from Aedes albopictus and Hyriopsis cumingii [35, 36].

The RT-qPCR results showed that the Adistra-2 gene had the highest relative transcript levels throughout embryonic development compared to other stages. The results of a previous study found that knockdown of tra-2 in embryos of B. mori [33] and A. mellifera [37] can cause abnormal testis formation in some larvae, even leading to embryonic lethality, implying that tra-2 is vital during the early embryonic stages. The spatial expression pattern of tra-2 in A. dissimilis showed that Adistra-2 was expressed in most male and female tissues. The Adistra-2 expression level in the ovary was significantly higher than that in the testis. This expression pattern is consistent with that of Aedes albopictus [36]. This suggests that Adistra-2 may play a potential regulatory role in the gonadal development of A. dissimilis.

To our knowledge, this is the first transcriptome analysis of differentially expressed genes of the ovary and testis of A. dissimilis. As a consequence of sequencing, we obtained 11,065 DEGs including 6,685 up-regulated genes and 4,380 down-regulated genes. We believed that the sequenced transcriptomes will provide useful information for elucidating the molecular mechanisms governing reproduction in A. dissimilis, as well as contributing a source of reference information for other phytophagous insects.

Author’ contributions

YS conceived and designed the experiments, and wrote the paper; SH carried out the data collection and analyses; HH and HS provided insightful advice about the design of the experiments, as well as edited the manuscript; SH and TZ performed experiment and data processing; all authors read and approved the final manuscript.

Funding

This research was supported by the National Natural Science Foundation of China (31701788) and Science and Technology Project in Henan Province (202102110069).

Availability of data and materials

Sequence data that support the findings of this study have been deposited in NCBI databases with the primary accession code PRJNA970546.

Ethics approval and consent to participate

Not applicable.

Consent for publication

Not applicable.

Competing interests

The authors declared no competing interests.

Author details

¹College of Horticulture and Plant Protection, Henan University of Science and Technology, Luoyang 471000, China. ²Zhumadian Tobacco Company, Zhumadian 463000, China.

Marın I, Baker BS. The evolutionary dynamics of sex determination. Science. 1998;281:1990–4.
Matson C, Zarkower D. Sex and the singular DM domain: insights into sexual regulation, evolution and plasticity. Nat Rev Genet. 2012;13(3):163–74.
Peng W, Yu SN, Alfred MH, Tu ZJ, Giuseppe S, Xi ZY, Zhang HY, et al. miRNA-1-3p is an early embryonic male sex determining factor in the Oriental fruit fly Bactrocera dorsalis. Nat Commun. 2020;11(1):1–11.
Sánchez L. Sex–determining mechanisms in insects. Inter J Dev Biol. 2008;52(7),837–56.
Bopp D, Saccone G, Beye M, et al. Sex determination in insects: variations on a common theme. Sex Dev. 2014;8(1–3):20–8.
Ying JJ, Wang HQ, Wang BY, Mao ZP, Chen YY, Li JM, Zhang CX, Zhuo JC, et al. The roles of transformer-2 (tra-2) in the sex determination and fertility of Riptortus pedestris, a hemimetabolous agricultural pest. Insects. 2023;14(11):834.
Wang ZY, Shi J, Dong JG, et al. Reason analysis on Proxenus lepigone outbreak of summer corn region in the Yellow River, Huai and Hai Rivers plain and the countermeasures suggested. Maize Science. 2012;20(1):132–4.
Anders S, Huber W. Differential expression analysis for sequence count data. Genome Biology. 2010;11(10):R106.
Leng N, Dawson JA, Thomson JA, Ruotti V, Rissman AI, Smits BMG, Kendziorski C, et al. EBSeq: An empirical Bayes hierarchical model for inference in RNA-seq experiments. Bioinformatics. 2013;29(8):1035–43.
Benjamini Y, Hochberg Y. Controlling the false discovery rate: a practical and powerful approach to multiple testing. J R Stat Soc B.1995;57:289–300.
Ye J, Fang L, Zheng H, Zhang Y, Chen J, Zhang Z, Wang J, Li S, Li R, Bolund L, et al. WEGO: a web tool for plotting GO annotations. Nucleic Acids Res. 2006;34:293–7.
Zhang W, Sun Z. Random local neighbor joining: a new method for reconstructing phylogenetic trees. Mol Phylogenet Evol. 2008;47(1):117–28.
Song YQ, Song ZY, Dong JF, Lv QH, Chen QX, Sun HZ, et al. Identifcation and comparative expression analysis of odorant‑binding proteins in the reproductive system and antennae of Athetis dissimilis. Sci Rep. 2021;11(1):13941.
Cao HR, Li L, Li ZP, Gao HH, Peng GF, Zhu C, Chen Y, Yang F, Dong W, et al. Denovo RNA-Seq analysis of ovary and testis reveals potential differentially expressed transcripts associated with gonadal unsynchronization development in Onychostoma macrolepis. Gene Expr Patterns. 2023;47:119303.
Gou PP, Wang ZC, Yang J, Wang XL, Qiu XM, et al. Comparative transcriptome analysis of differentially expressed genes in the testis and ovary of sea urchin (Strongylocentrotus intermedius). Fishes-Basel. 2022;7(4):152.
Cao HR, Gao HH, Li ZP, Peng GF, Chen YM, Jin TQ, Zhu C, Ji H, Dong W, et al. Comparative transcriptome provides insights into differentially expressed genes between testis and ovary of Onychostoma macrolepis in reproduction period. Gen Comp Endocr. 2022;326:114066.
Guo W, Lü J, Guo MJ, Chen SM, Qiu BL, Sang W, Yang CX, Zhang YJ, Pan HP, et al. De Novo Transcriptome Analysis Reveals Abundant Gonad-specific Genes in the Ovary and Testis of Henosepilachna vigintioctopunctata. Int J Mol Sci. 2019;20(7):4084.
Pan LX, Hu WW, Cheng FP, Hu XF, Wang ZL, et al. Transcriptome analysis reveals differentially expressed genes between the ovary and testis of the honey bee Apis mellifera. Apidologie. 2022;53(8):1–12.
Kakino K, Mon H, Ebihara T, Hino M, Masuda A, Lee JM, Kusakabe T, et al. Comprehensive transcriptome analysis in the testis of the silkworm, Bombyx mori. Insects. 2023;14(8):684.
Chen W, Liu YX, Jiang GF, et al. Corrigendum: De novo assembly and characterization of the testis transcriptome and development of EST-SSR markers in the cockroach Periplaneta americana. Sci Rep. 2015;5:16547.
Wei D, Li HM, Yang WJ, Wei DD, Dou W, Huang Y, Wang JJ, et al. Transcriptome profiling of the testis reveals genes involved in spermatogenesis and marker discovery in the oriental fruit fly, Bactrocera dorsalis. Insect Mol Biol. 2015;24(1):41–57.
Pavithran S, Murugan M, Mannu J, Yogendra K, Balasubramani V, Sanivarapu H, Harish S, Natesan S, et al. Identification of salivary proteins of the cowpea aphid Aphis craccivora by transcriptome and LC-MS/MS analyses. Insect Biochem Molec. 2024;165:104060.
Wang GB, Wang JR, Nie L, et al. Transcriptome sequencing of the central nervous system to identify the neuropeptides and neuropeptide receptors of Antheraea pernyi. Int J Biol Macromol. 2023;244:125411.
Parisi M, Nuttall R, Naiman D, Bouffard G, Malley J, Andrews J, Eastman S, Oliver B, et al. Paucity of genes on the Drosophila X chromosome showing male-biased expression. Science. 2003;299(5607):697–700.
Goldman TD, Arbeitman MN. Genomic and functional studies of Drosophila sex hierarchy regulated gene expression in adult head and nervous system tissues. PLos Genet. 2007;3(11):e216.
Catalán A, Hutter S, Parsch J, et al. Population and sex differences in Drosophila melanogaster brain gene expression. BMC Genomics. 2012;13:654.
Harrison PW, Wright AE, Zimmer F, Dean R, Montgomery SH, Pointer MA, Mank JE, et al. Sexual selection drives evolution and rapid turnover of male gene expression. P Natl Acad Sci USA. 2015;112(14):4393–8.
Amrein H, Maniatis T, Nöthiger R, et al. Alternatively spliced transcripts of the sex-determining gene tra–2 of Drosophila encode functional proteins of different size. EMBO J. 1990;9(11):3619–29.
Martín I, Ruiz MF, Sánchez L, et al. The gene transformer–2 of Sciara (Diptera, Nematocera) and its effect on Drosophila sexual development. BMC Developmental Biology. 2011;11(1):1–19.
Niu BL, Meng ZQ, Tao YZ, Lu SL, Weng HB, He LH, Shen WF, et al. Cloning and alternative splicing analysis of Bombyx mori transformer–2 gene using silkworm EST database. Acta Bioch Bioph Sin. 2005;37(11):728–36.
Li F, Vensko SP, Belikoff EJ, Scott MJ, et al. Conservation and sex–specific splicing of the transformer gene in the Calliphorids Cochliomyia hominivorax, Cochliomyia macellaria and Lucilia sericata. PLoS ONE. 2013;8(2):e56303.
Shukla JN, Palli SR. Tribolium castaneum Transformer-2 regulates sex determination and development in both males and females. Insect Biochem Molec. 2013;43(12):1125–32.
Nissen I, Muller M, Beye M. The Am–tra2 gene is an essential regulator of female splice regulation at two levels of the sex determination hierarchy of the honeybee. Genetics. 2012; 192(3):1015–26.
Dauwalder B, Amaya-Manzanares F, Mattox W, et al. A human homologue of the Drosophila sex determination factor transformer–2 has conserved splicing regulatory functions. PNAS. 1996;93(17):9004–9.
Wang YY, Wang XQ, Ge JY, Wang GL, Li JL, et al. Identifcation and functional analysis of the sex–determiner transformer–2 homologue in the freshwater pearl mussel, Hyriopsis cumingii. Front Physiol. 2021;12:704548.
Li XC, Jin BB, Dong YQ, Chen XG, Tu ZJ, Gu JB, et al. Two of the three transformer-2 genes are required for ovarian development in Aedes albopictus. Insect Biochem Molec. 2019;109:92–105.
Suzuki MG, Suzuki K, Aoki F, Ajimura M, et al. Effect of RNAi–mediated knockdown of the Bombyx mori transformer-2 gene on the sex–specific splicing of Bmdsx pre-mRNA. Int J Dev Biol. 2012;56(9):693–9.

No competing interests reported.

Download PDF

Version 1

posted

You are reading this latest preprint version

Comparative transcriptome analysis of differentially expressed genes in the ovary and testis and identification of transformer-2 gene of Athetis dissimilis

Status:

Version 1

Abstract

Background

Results

Conclusions

Figures

Background

Materials and methods

Insect rearing and sample preparation

Differential expression analysis

Functional annotation and enrichment analysis of DEGs

Results

Differential expression gene analysis

Annotation and function analyses of DEGs

Multiple alignment and phylogenetic analysis

Discussion

Declarations

References

Additional Declarations

Status:

Version 1