Cell culture and therapeutic agents
Isogenic pancreatic cancer cell lines, MIA PaCa-2-sgCtrl/sgRB, were cultured in Dulbecco's Modified Eagle's Media (DMEM) supplemented with 10% fetal bovine serum and 50 µg/mL of penicillin/streptomycin. The PDAC cell lines 519 and 3226 were maintained in Keratinocyte SFM medium as previously described [29]. HT1080 cells were stably infected with ISRE-mCherry lentivirus as previously described [34]. Transduced HT1080 cells were cultured in DMEM media supplemented with 10% FBS and 50 µg/mL of penicillin/streptomycin. All cell lines were maintained at 37°C with 5% CO2. Palbociclib, trametinib, pimasertibm, and GSK8612 were purchased from MedChemExpress (Monmouth Junction, NJ, USA) and dissolved in DMSO to a final stock concentration of 10 mM. Polyinosinic acid-polycytidylic acid sodium salt, double-stranded (sc-204854) was purchased from Santa Cruz. Additionally, a customized drug library comprising 311 compounds was acquired from SelleckChem (Houston, TX, USA).
Plasmids and infection procedures
Lentiviral vectors, including pL-CRISPR-sgCtrl (GACCGGAACGATCTCGCGTAG)-GFP or pL-CRISPR-sgRB (GGTTCTTTGAGCAACATGGG)-GFP, were sourced from Dr. Rod Bremner at Lunenfeld Tanenbaum Research Institute (Toronto, ON, CAN). The pLenti0.3UbCGWH2BC1-PatGFP vector was obtained from Dr. Ethan Abel (RPCCC, Buffalo, NY, USA). Lentiviral infections were carried out in exponentially growing HT1080 or MIA PaCa-2 cells in the presence of polybrene (Sigma Aldrich, St. Louis, MO, USA). Isogenic HT1080-RB-del and MIA PaCa-2-RB-del cell lines were generated through CRISPR-mediated deletion, with guide sequences designed to target exon 7 of the human RB1 gene.
Drug screen
Cytation 5 (Agilent BioTek, Santa Clara, CA, USA) and IncuCyte (Sartorius, Ann Arbor, MI, USA) live cell imaging systems were employed for drug screen analysis in the HT1080 cell line. Cells were initially seeded in 384-well plates and subjected to a 24-hour pretreatment with either DMSO or 100 nM palbociclib. Subsequently, compounds from the drug library were introduced into the plates at a dose of 100 nM. The growth of cells in each well was continuously monitored, and the growth rates were calculated over a period of 5 days. To evaluate drug efficacy, the growth rate for each compound in the drug library was normalized to the mean of the DMSO-treated wells within the same drug plate.
Immunoblot analysis
Whole-cell lysates were extracted from the indicated cell lines using RIPA lysis buffer (10 mM Tris HCl pH 8.0, 1 mM EDTA, 150 mM NaCl, 1% Triton-X-100, 0.1% sodium deoxycholate, 0.1% sodium dodecyl sulfate, SDS) supplemented with Halt™ Protease Inhibitor Cocktail (Thermo Fisher, Carlsbad, CA, USA). Subsequently, 20 µg of the resultant proteins were separated on a 10% SDS-polyacrylamide gel electrophoresis (PAGE) gel and then transferred to a nitrocellulose membrane for immunoblotting. Immunoblotting was performed by incubating the membranes with protein-specific primary antibodies overnight at 4°C, followed by incubation with HRP-tagged anti-mouse, anti-goat, or anti-rabbit secondary antibodies for 1 h at RT. Immunoreactive bands were detected using an enhanced chemiluminescent substrate (National Diagnostics, CL-300, Atlanta, GA, USA). The primary antibodies purchased from Cell Signaling Technology (Danvers, MA, USA) included pRB S807/811 (8516S), pERK (T202/Y204) (4377S), ERK (4695S), pTBK1(S172) (5483S), TBK1 (3504S), EZH2 (5246S), RB (9309L), and Cyclin B1 (4138S). Additionally, GAPDH (SC-47724) antibody was procured from Santacruz Biotech (Dallas, TX, USA) and Cyclin A2 (AF5999) was purchased from R&D systems (Minneapolis, MN, USA). Goat-anti-rabbit-HRP (31430), rabbit-anti-Goat-HRP (31402) and goat-anti-rabbit-HRP (31460) were used as secondary antibodies (Thermo Fisher, Carlsbad, CA, USA). All primary and secondary antibodies were used at a 1:1000 and 1:2000 dilution, respectively.
Immunofluorescence analysis
Cells were seeded on glass coverslips and exposed to experimental drugs for 48 h. After treatment, cells were washed twice with cold phosphate-buffered saline (PBS) and subsequently fixed and permeabilized with cold methanol at -20°C for 10 minutes. The fixed cells were then subjected to blocking using IF buffer (1X PBS, 5% BSA, 0.4% NP40) and incubated with the primary antibody RB (9309L; 1:50; Cell Signaling Technology, Danvers, MA, USA) at RT for 1 h. Following the primary antibody incubation, the coverslips were washed in PBS and then incubated with secondary antibody (1:200) in the presence of DAPI (1:1000) for nuclear staining. After the secondary antibody incubation, coverslips were washed again in PBS and mounted on glass slides. Fluorescence microscopy images were captured using an EVOS microscope (Thermo Fisher, Carlsbad, CA, USA) at 40X magnification.
Cell proliferation assay
Cell proliferation in response to various treatments was determined using a chemiluminescent BrdU ELISA kit (11669915001; Roche, Indianapolis, IN, USA) following the manufacturer's instructions. Luminescence readings were obtained using on a Biotek Synergy 2 plate reader (Agilent Technologies, Santa Clara, CA, USA).
Flow cytometry cell cycle analysis
To determine the cell cycle profile based on DNA content, cells were trypsinized, fixed in ice-cold 70% ethanol overnight at -20°C, and subsequently washed with PBS. The fixed cells were pelleted and underwent an additional PBS wash. Prior to analysis using a BD LSR FORTESSA flow cytometer (BD Biosciences, Franklin Lakes, NJ, USA), cells were stained with propidium iodide (PI) (40 µg/mL) in the presence of RNase A (200 µg/mL) [18].
qRT-PCR analysis
Total RNA was extracted from cells after 48 h of culture or tumor tissues using the RNeasy Mini Kit (Qiagen) and subjected to reverse transcription into cDNA utilizing the SuperScript™ VILO™ Master Mix (11755050; Thermo Fisher, Carlsbad, CA, USA). Primers used for qPCR are listed in Table 1. These primers were diluted in nuclease-free water with PowerUp™ SYBR™ Green Master Mix (A25779; Thermo Fisher, Carlsbad, CA, USA), and the qPCR assays were performed on the QuantStudio 6 Pro Real-Time PCR System (Thermo Fisher, Carlsbad, CA, USA) as previously described [29]. Relative RNA levels were quantified using the 2ˆ(–ΔΔCT) method and normalized to the reference gene GAPDH.
Table 1
Oligonucleotide real-time qPCR primers used.
Gene | Sequence (5' to 3') | Source |
EZH2 | F: CCCTGACCTCTGTCTTACTTGTGGA | [35] |
| R: ACGTCAGATGGTGCCAGCAATA | |
STAT2 | F: CCGGGACATTCAGCCCTTTT | [36] |
| R: GTTCCAATTGGGCCCTCTGA | |
IRF9 | F: GGGAGCAGTCCATTCAGACA | [36] |
| R: CAGCAGTGAGTAGTCTGGCT | |
HLA-A | F: ACCCTGAGATGGGAGCTGTC | [36] |
| R: CTTCCTCCTCCACATCACGG | |
HLA-C | F: GTCCTAGCTGTCCTTGGAGC | [36] |
| R: GCTGTCTCAGGCTTTACAAGTG | |
B2M | F: TGCCTGCCGTGTGAACCATG | [37] |
| R: TGCGGCATCTTCAAACCTCCA | |
CD74 | F: TTATCTCCAACAATGAGCAACT | [38] |
| R: ACAGGAAGTAGGCGGTGGT | |
CCNA2 | F: CGCTGGCGGTACTGAAGTC | [39] |
| R: GAGGAACGGTGACATGCTCAT | |
CCNB1 | F: GGGCTTGGAGAGGCAGTATC | designed for this study |
| R: AGTGTCTGAGCCAGTGCCAG | |
GAPDH | F: GCACCGTCAAGGCTGAGAAC | [35] |
| R: ATGGTGGTGAAGACGCCAGT | |
Gene expression analysis from public datasets
The RNAseq raw fragments per kilobase of transcript per million reads mapped (FPKM) data for lung cancer, PDAC, and fibrosarcoma models (accession numbers GSE110397 and GSE180265) were downloaded from Gene Expression Omnibus (GEO). The fastq files underwent processing using the nf-core/rnaseq pipline (version 3.3) [40], with GRCh38 serving as the reference genome. The computational analysis was conducted using the high-performance computing cluster hosted at the Center for Computational Research, University at Buffalo. Raw read counts were generated using the RSEM package [41]. These raw read counts were then utilized as input for differential gene expression analysis using DESeq2 [42]. A cutoff of Ilog2FoldChangeI ≥ 2 and an adjusted p-value < 0.05 were applied to define and identify differentially expressed genes.
TEtranscripts analysis:
Bam files generated for gene expression analysis were used as input for endogenous retroviral sequence/transposable element (TE) identification and differential expression analysis. The TEtranscripts python package [43] developed by the Hammell Lab (https://github.com/mhammell-laboratory/TEtranscripts) was utilized for this purpose. We used a singularity container (pulled with this command “singularity pull tetranscripts.sif docker://mhammelllab/tetranscripts:latest” on October 26, 2023) to perform data processing and analysis on the HPC hosted at the Center for Computational Research, University at Buffalo. The input bam files were aligned using STAR2 inside the nf-core/rnaseq pipeline. Two annotation gtf files were used. The gtf for gene annotation (gencode.v44.annotation.gtf) was download from the gencode website (https://www.gencodegenes.org/human). The TE specific gtf (GRCh38_GENCODE_rmsk_TE.gtf) was downloaded on October 26, 2023 from https://www.dropbox.com/sh/1ppg2e0fbc64bqw/AACUXf-TA1rnBIjvykMH2Lcia?dl=0. For each cell line treatment and control comparison, the *_sigdiff_gene-TE.txt files contained the filtered, differentially expressed TEs that had passed a predefined threshold (Ilog2FoldChangeI > 0 and adjusted p value < 0.05).
Transcriptome analysis
RNA was extracted utilizing the Qiagen RNeasyplus kit (Qiagen, Germantown, MD, USA), with subsequent quality assessment using the RNA6000 Nano assay and Agilent 2200 TapeStation (Agilent Technologies, Santa Clara, CA, USA) to ensure a minimum RNA Integrity Number (RIN) of 7.0 for inclusion in the study. cDNA synthesis employed random hexamers for full-length, strand-specific representation of non-ribosomal RNA transcripts. Targeted RNA sequencing libraries were prepared using the DriverMap Human Genome-Wide Gene Expression Profiling Sample Prep Kit hDM18Kv3 (Cellecta, Mountain View, CA, USA), utilizing pre-designed multiplex PCR primer sets for known protein-coding genes. The anchor PCR step mitigated primer dimer formation. Purification and quantification of PCR products was performed using SPRI and Qubit (Thermo Fisher, Carlsbad, CA, USA) fluorescence assays, respectively. RNAseq libraries were analyzed on an Illumina NextSeq 500 sequencer (Illumina, San Diego, CA, USA). Alignment, gene-level read counts, and transcript abundance estimates were obtained using STAR [44], Salmon [45], and EdgeR [46], respectively. Data normalization, systematic bias correction, and identification of differentially expressed genes were carried out with the Bioconductor package EdgeR. Genes with an average of less than ten read counts across all samples were excluded from further analysis. Following data integration, systematic bias was corrected using ComBat, as described previously [47]. Differentially expressed gene (DEG) analysis was performed with EdgeR and selected based on p-value < 0.05 and log2 fold change > 1.
Knockdown experiments
HT1080 and 519 cells underwent reverse transfection using Dharmacon Human ON-TARGETplus Human siRNA: TBK1 (J-003788-08/09/10/11) and nontargeting siRNA (D-001810-10-05). The transfection process was conducted with Lipofectamine RNAiMax Transfection Reagent (13778150; Invitrogen, Carlsbad, CA, USA) following the manufacturer’s protocol. Following 24 h transfection, cells were exposed to different drugs for 48 h. Parallel experiments were performed using immunoblot analysis to confirm gene silencing.
Mice and xenografts
NOD scid gamma (NSG) mice were ethically and responsibly maintained at the animal care facilities at RPCCC. All aspects of animal care, drug treatment, and sacrifice were approved by the RPCCC Institutional Animal Care and Use Committee (IACUC), in accordance with the NIH guidelines for the care and use of laboratory animals. Male NSG mice, aged 8 to 10 weeks, were subcutaneously implanted with early passage HT1080-sgCtrl/sgRB cells (1.5 × 106 cells/mouse). Once tumor volume reached 200–250 mm3, mice were subjected to treatment by gastric gavage with either vehicle or a combination of palbociclib and trametinib. Palbociclib (PD-0332991, 100 mg/kg) was diluted in 50 mM lactate buffer at pH 4.0, while trametinib (0.5 mg/kg) was diluted in 0.5% hydroxypropyl cellulose and 0.2% tween 80. Tumor size was meticulously monitored by daily measurements using digital calipers. Tumor volume was computed utilizing the formula: (greatest diameter × (shortest diameter2))/2. The study was concluded when tumors reached a volume of 2000 mm3, or mice were humanely sacrificed at the termination of the treatment period. Any mice displaying signs of illness or discovered deceased during treatment were noted and systematically excluded from the analysis.
Immunohistochemical analysis
Hematoxylin and eosin (H&E) staining and immunohistochemistry for pRB S807/811 (8516S-1:400) and Ki67 (RM-9106S1-1:200) was carried out on tumor tissues following formalin fixation using standard procedures [29]. The staining process was conducted on a Leica autostainer and subsequently imaged using Aperio (Leica Biosystems, Wetzlar, GER).
Statistical analysis
The GraphPad Prism 9 software was used for all statistical analysis. A Student’s t-test, One-way and Two-way ANOVA with multiple comparisons were used, as indicated in each figure where appropriate. Statistical significance was defined as p-value less than 0.05.