Using glycerol-inducible expression system to overexpressed maltooligosaccharide-forming α-amylase in Bacillus subtilis

doi:10.21203/rs.3.rs-4154544/v1

Download PDF

Research Article

Using glycerol-inducible expression system to overexpressed maltooligosaccharide-forming α-amylase in Bacillus subtilis

https://doi.org/10.21203/rs.3.rs-4154544/v1

This work is licensed under a CC BY 4.0 License

Version 1

posted

You are reading this latest preprint version

In order to meet the desire of maltopentaose (G5) in industrial application, we developed a glycerol-inducible expression system in Bacillus subtilis to overexpress maltooligosaccharide-forming α-amylase from Bacillus cereus ATCC 14579 (BcMFAse). Verifying the glycerol-inducible promoter, optimizing fermentation conditions, comparing homologous promoter and constructing double translation initiation sites were studied. Results shown that the optimal induced time for glycerol-inducible promoter is at 8 h, the optimal induced concentration of glycerol is 1% and the optimized fermentation medium was consisted of 2% tryptone, 0.6% yeast exact, 1% NaCl and 0.6% casein hydrolysate with highest BcMFAse activity (~1549.9 U/mL) promoted by P_GlpD in 500 mL triangular flask. Comparing to the homologous promoter, P_GlpDLfrom Bacillus paralicheniformis A4-3 exhibited stronger ability to promoted the expression of BcMFAse and the maximum BcMFAse activity was ~2364.6 U/mL. The BcMFAse activity achieved ~3137.5 U/mL by constructing double translation initiation sites (TISs) at 5´-untranslated region(5´-UTR) of promoter P_GlpDL. This study provided a high-efficiency way for overexpressing the BcMFAse in B. subtilis, which would economically producing G5 on industry.

Bacillus subtilis

maltooligosaccharide-forming α-amylase

promoter

translation initiation site

Maltooligosaccharide-forming amylases (MFAses) are effective tools for food industry applications because they are capable to degrade starch into functional maltooligosaccharides which were consisting of 3 to 10 α- D-glucopyranose units linked by α-1,4 glycosidic bonds [1]. MFAses are unique for producing maltooligosaccharides as the final products instead of glucose or maltose [2]. Especially, maltopentaose (G5), which contains five glucopyranoses linked by α-1,4 glycosidic linkages, shows well processing adaptability and the ability of inhibiting recrystallization of starch in food industry [3, 4]. Moreover, G5 is highly demanded as a high-value-added material in the medical field since the pure G5 can be used as a diagnostic reagent to examine the activity of α-amylase in serum [5]. However, most of the MFAses described to date are unsuitable for producing specific G5 in industrial due to their low product specificity or low productivity, which limits the industrial application of G5 [6–9]. Low product specificity and low productivity made separate and purify the G5 become difficult and expensive. The most effective strategy for overcoming these barriers is to screen the MFAse with well G5 specificity and improve the production to meet the industrial demand. In this study, the MFAse from Bacillus cereus ATCC 14579 that preferentially produces G5, accounting for 63.8% of the saccharide mixture [4], which was well satisfied with the production specificity. Now the most urgent problem was improving the production of BcMFAse to produce large amount of G5.

For obtaining more BcMFAse, we focused on the promoter. As part of expression system, the promoter plays an important role in the protein production [10]. Currently, many strategies about promoters have been developed to improve the recombinant expression level of target proteins in B. subtilis [11–18]. Screening a strong promoter would give much high expression of BcMFAse. The glycerol-inducible promoter P_GlpD had reported strong ability to express high-level production of aspartase and nattokinase in B. subtilis [19]. In addition, glycerol used as the inducer was phosphorylated to G3P by the glycerol kinase in vivo [20]. Compared to other inducer like IPTG and xylose, glycerol is safer and cheaper. B. subtilis is widely used host for expression of heterologous protein because of its well-known attractive properties. As reported by U.S. Food and Drug Administration center, B. subtilis is a food-grade strain and has no safety concerns. In addition, B. subtilis owns high ability to secret recombinant proteins and it is easy to design several genetic manipulations because of its definite genetic background [21–23]. Choosing B. subtilis as the expression host for BcMFAse extracellular production is beneficial to basic research and industrial application.

Besides, to large amounts of the recombinant protein, the composition of the fermentation medium is an important impact on the production of recombinant protein [24–28]. Likewise, the efficiency of translation was one of the main factors for the production of recombinant protein, especially the rate of translation initiation [29–32]. Multiple translation initiation sites at the 5´-UTR of promoter P₄₃ to enhance the production of protein in B. licheniformis and other industrially relevant bacteria was confirmed [33]. Therefore, optimizing the fermentation medium and the efficiency translation were the considerable aspect for heterologous protein expression.

This work aimed to develop an efficient expression system for overexpressing the BcMFAse with high activity to produce G5. Firstly, a promoter P_GlpD from B. subtilis was verified to overexpress BcMFAse and determined the optimal induced time, optimal induced concentration and the optimized fermentation medium to overexpress BcMFAse. Secondly, considering the source of GlpD promoter might influence the expression. The promoter P_GlpDL from B. paralicheniformis A4-3 with high similarity comparing to promoter P_GlpD was used to express BcMFAse as the same. Finally, constructing tandem double translation initiation sites at the 5´-UTR to further increase the production of BcMFAse. The results here provide the basis for further studies designed to increase the production of BcMFAse to effectively produce G5.

Bacterial strains, plasmids and growth conditions

The maltooligosaccharide-forming α-amylase from Bacillus cereus ATCC 14579 (BcMFAse) was used in this study. Bacillus subtilis WB600 (Academy of Science, Guangxi, China) was used to extract genomic DNA for obtaining the promoter P_GlpD and P₄₃. Bacillus paralicheniformis A4-3 (Academy of Science, Guangxi, China) was used to extract genomic DNA for obtaining the promoter P_GlpDL. Escherichia coli DH5α ((Promega, USA )was served as a host for cloning and constructing recombinant plasmids, and was cultured in Luria-Bertani (LB) medium(1% tryptone, 0.5% yeast extract and 1% NaCl)with 100 µg/mL ampicillin at 37℃, 220 rpm. B. subtilis WB600 also was used as the expression host for the recombinant plasmid, and was grown in the seed cultured medium was LB (1% tryptone, 0.5% yeast extract, 1% NaCl) with 20 µg/mL kanamycin at 37℃, 220 rpm. The E. coli/B. subtilis shuttle plasmid pB-E-s (Invitrogen, USA) was used as the cloning and expression vector. All vectors for BcMFAse expression in B. subtilis were originated from plasmid pB-E-s. Plasmids used in this study were described in Table 1.

Table 1

plasmids used in this study
Plasmids	Description	Source
pSE380-BcMFAse	Plasmid with BcMFAse	Lab stock
pB-E-s	shuttle vector for E. coli/B. subtilis, P_AprE, SP_AprE, Ap^r, Km^r	Lab stock
pBP_AprE-BcMFAse	BcMFAse inserted into plasmid pB-E-s	In this study
pBP₄₃-BcMFAse	BcMFAse promoted by P₄₃	In this study
pBP_GlpD-BcMFAse		BcMFAse promoted by P_GlpD	In this study
pBP_GlpDL-BcMFAse		BcMFAse promoted by P_GlpDL	In this study
pBP_GlpDL2TISs-BcMFAse		BcMFAse promoted by P_GlpDL2TISs, P_GlpDL2TISs with double translation initiation sites.	In this study

The 500 mL triangular flask was equipped with 80 mL LB or optimized fermentation medium for BcMFAse production. Optimizing fermentation medium was consisted of 2% tryptone, 0.6% yeast extract, 1% NaCl, 0.6% casein hydrolysate. These two fermentation mediums all were supplemented with 20 µg/mL kanamycin. The cells were grown at 37℃, 180 rpm. All the fermentation experiments were repeated three times at least.

Construction of expression vectors containing different promoters

Primers used in this study were synthesized by Shanghai Sangon Biotech Co., Ltd. and were listed in Table 2. The complete gene BcMFAse was amplified from the stocked plasmid pSE380-BcMFAse by using primer BcMFAse-F/R. The stocked plasmid pSE380-BcMFAse was constructed by our previous study [4]. Plasmid PB-E-s and gene BcMFAse were both digested by BamHⅠ and HindⅢ, respectively. The liner vector PB-E-s and gene BcMFAse were recovered, purified and circularized in vitro using T4 DNA Ligase (Takara). The circularized vector pBP_AprE-BcMFAse was then transformed into E. coli DH5α. The linearized pB-BcMFAse vector backbone was amplified from plasmid pBP_AprE-BcMFAse, with primer pair pB-BcMFAse-F/R. The polymerase chain reaction (PCR) product was digested by DpnⅠ and recovered by DNA gel extraction kit. The promoter P₄₃ and P_GlpD were cloned from the genomic DNA of B. subtilis WB600 with primer pair P₄₃ -F/R and P_GlpD -F/R. The promoter P_GlpDL were cloned from the genomic DNA of B. paralicheniformis A4-3 with primer pair P_GlpDL -F/R. The linear fragments P₄₃, P_GlpD, P_GlpDL and the linear vector PB-BcMFAse both containing 16 bp 3´-and 5´- overlapping termini to result three different circular vector pBP₄₃-BcMFAse, pBP_GlpD-BcMFAse and pBP_GlpDL-BcMFAse by In-fusion HD Enzyme (Takara). Then transformed recombinant vectors into E. coli DH5α to yield the plasmids.

Table 2

Oligonucleotide primers used in this study
Primers	Sequence (5´→3´)
BcMFAse-F	CGGGATCCACAGTTAACAATGGAACGTTAATGC
BcMFAse-F	CCCAAGCTTTTACTGCTGAACATATATGGAAACTG
P₄₃-F	AGCCGTCTGTACGTTCCTAATGATAGGTGGTATGTTTTCGCTTGAAC
P₄₃-R	ATTTTTTGCTTCTCATGTGTACATTCCTCTCTTACCTATAATGG
P_GlpD-F	GTCTGTACGTTCCTAATCCAGCATTTGTCGGACTGG
P_GlpD-R		CAATTTTTTGCTTCTCATTACGTTTCCTCCTTGTTGTCAC
P_GlpDL-F		GTCTGTACGTTCCTAACATTTGTAGGTTTAGGCACG
P_GlpDL-R		CAATTTTTTGCTTCTCATGTTCATGTCCTCCCTTGTTGTC
pB-BcMFAse-F		ATGAGAAGCAAAAAATTGTGGATCAG

(continuous) Table 2 Oligonucleotide primers used in this study

Primers	Sequence (5´→3´)
pB-BcMFAse-R	TTAGGAACGTACAGACGGCTTAAAAG
pBP_GlpDL2TISs –BcMFAse-F	GTGACAACAAGGGAGGACATGAACATGAGAAGCAAAAAATTGTGGATC
pBP_GlpDL2TISs -BcMFAse-R	GTTCATGTCCTCCCTTGTTGTCACGTTCATGTCCTCCCTTGTTGTCAC

Verification of glycerol-inducible conditions of promoter P_GlpD

The BcMFAse activity was characterized at various induced concentration of glycerol (0.5%, 1%, 1.5%, 2% and 3%) to verified the optimal concentration of glycerol. Then optimal concentration of glycerol was added into the fermentation medium when fermentation time reached 0 h, 4 h, 8 h, 12 h, and16 h to investigate the optimal induced time.

Optimization of fermentation medium for BcMFAse

Basing on LB fermentation medium, single factor at a time was used for optimization. The BcMFAse activity was analyzed after incubating for 48 h. Firstly, the basal medium (0.5% yeast extract and 1% NaCl) were supplemented with 1%-3% tryptone to determine the optimal concentration of tryptone. Secondly, the basal medium (the optimal concentration of tryptone and 1% NaCl) were supplemented with 0.3%-1.5% yeast extract to determine the optimal concentration of yeast extract. Finally, according to previous reports, casein hydrolysate helped improving the production of protein (Pedersen et al. 2000; Lee et al. 2019; El-Bendary et al. 2022; El-Bendary et al. 2023). The casein hydrolysate was considered adding to the fermentation medium. The basal medium (optimal concentration of tryptone, optimal concentration of yeast extract and 1% NaCl) were supplemented with 0.2%-1% casein hydrolysate to determine the optimal concentration of casein hydrolysate.

Construction of expression vector containing double translation initiation sites

In the process of constructing the double TISs to express BcMFAse, the expression vector pBP_GlpDL-BcMFAse was used as a template. The forward primer pBP_GlpDL2TISs –BcMFAse-F contains 24 nt of the terminal 5´-UTR and the first 24 nt of the signal peptide SP_AprE. The reverse primer pBP_GlpDL2TISs –BcMFAse-R is reverse sequence of two repeated 24 nt of the terminal 5´-UTR. The linear plasmid was obtained by PCR, with primer pair pBP_GlpDL2TISs –BcMFAse-F/R. The PCR product was digested and recovered, then transformed it into E. coli DH5α. Since the 5´-of reverse primer and the 3´-of forward primer exist an overlapping sequence of 24 nt 5´-UTR, the linear plasmid can be circularized in vivo, resulting the expression vector with two TISs to translate the BcMFAse.

SDS-PAGE analysis

The samples were harvested from the supernatant of fermentation by centrifugation and it was mixed with the 2×loading buffer. The samples were boiled for 10 minutes and then 10 µL samples were subjected to SDS–PAGE which separated the proteins by using a 4% acrylamide stacking gel and 12% acrylamide resolving gel. Proteins were visualized by Coomassie Brilliant Blue R250 solution.

BcMFAse activity assay

The BcMFAse activity was defined blow. One unit of BcMFAse activity was defined as the amount of BcMFAse that produces 1 µmol reducing sugar per minute. The BcMFAse assay was done by using 1% soluble starch as the substrate according to pan’s study [4]. The crude enzyme was prepared by using appropriate fold to dilute the supernatant of fermentation. Briefly, 10 µL diluted crude enzyme was mixed with 190 µL 1% (w/v) soluble starch dissolved in 50 mM phosphate-citrate buffer (pH 7.0). This mixture was incubated at 45℃ for 10 minutes and the reaction was stopped by 400 µL 3,5-dinitrosalicylic acid (DNS). Then the 600 µL mixture was boiled for 5 minutes and the absorbency was measured at 540 nm.

Verified the promoter P _GlpD for expressing BcMFAse.

The appropriate induced time and induced concentration were critical point for highly transcriptional efficiency of the promoter P_GlpD. Figure 1a shown the influence of the induced concentration of glycerol (0.5%, 1%, 1.5%, 2%, 3%) on BcMFAse activity. The BcMFAse activity started increased as the concentration of glycerol from 0 to 1%. The highest BcMFAse activity exhibited at 1% glycerol fused to the fermentation medium. However, the concentration of glycerol increased from 1–3% the expression reduced slightly, which indicated that the best concentration of glycerol was 1%. As shown in Fig. 1b, when the induced time at 0 h, 4 h, 8 h, 12 h, and16 h, the extracellular BcMFAse activities were accumulated to ~ 607.6, ~ 614.1, ~ 818.9, ~ 425.4 and ~ 389.3 U/mL, respectively. Obviously, when induced time was at 8 h, the recombinant strain produced a highest extracellular BcMFAse activity and after that it decreased.

Moreover, promoter P_AprE and P₄₃ were used to express BcMFAse as the same with promoter P_GlpD (Fig. 1c). The recombinant P_GlpD-BcMFAse showed the higher Extracellular BcMFAse activity (~ 803.1 U/mL), which was ~ 6 fold higher than the P₄₃-BcMFAse (~ 130.9 U/mL) and was ~ 9.5 fold higher than the P_AprE-BcMFAse (~ 84.7 U/mL), as shown in Fig. 1d. Comparing with the widely used promoter P₄₃ and P_AprE, P_GlpD exhibited the higher efficiency for expressing BcMFAse in B. subtilis.

Optimized the fermentation medium for BcMFAse production.

Nitrogen plays an important role in cell growth and metabolites production in the fermentation process. Depending on fermentation costs, a combination of tryptone and yeast extract as nitrogen sources was more favorable [34]. However, the activity of P_GlpD was specifically induced by glycerol but was inhibited by other common carbon sources such as glucose, xylose and arabinose [19]. Therefore, we did not evaluate the effect of the Carbon source.

The recombinant B. subtilis WB600 containing the plasmid pBP_GlpD-BcMFAse was used to investigate the influence of the concentration of the Nitrogen sources in fermentation mediums on BcMFAse activity. As shown in Fig. 2a, we determined the optimal concentration of tryptone was 2% comparing with the LB fermentation medium. The highest BcMFAse activity appeared when medium contained 2% tryptone, 0.6% yeast extract and 1% NaCl (Fig. 2b). The maximum BcMFAse activity was further achieved ~ 1549.9 U/mL by mixing extra 0.6% casein hydrolysate (Fig. 2c). The results shown that the optimal fermentation medium was consisted of 2% tryptone, 0.6% yeast extract, 1% NaCl, 0.6% casein hydrolysate.

Compared the activity of homologous promoter for expressing BcMFAse

The promoter P_GlpD efficiently promoted the expression of BcMFAse as the results above. The promoter from the upstream of gene GlpD in the B. paralicheniformis A4-3 (designated as P_GlpDL) was used to characterized as the same. Sequence similarity searched by BLAST (https://www.genome.jp/tools/blast/) revealed that the promoter P_GlpDL was 75% similarity with promoter P_GlpD. In order to further analysis the homology of these two promoters, the sequence alignment was performed, revealing that conservation of the certain functional region. Especially, -35 region, -10 region, RBS (Ribosome-binding site) and the inverted repeat sequence, involving with the activity of promoter closely all were conserved. (Fig. 3a). The recombinant plasmids pBP_GlpDL-BcMFAse were transformed into B. subtilis WB600. Surprisingly, the BcMFAse activity (~ 2364.6 U/mL) promoted by promoter P_GlpDL was higher than promoter P_GlpD (Fig. 3b).

Further improved the expression by constructing double translation initiation sites.

For further enhancing the production of BcMFAse, the promoter P_GlpDL was used to construct double translation initiation sites at the 5´-UTR to improve the production of BcMFAse (Fig. 4a). Recombinant P_GlpDL2TISs-BcMFAse exhibited the higher extracellular BcMFAse activity (~ 3137.5 U/mL) compared to the BcMFAse activity (~ 2364.6 U/mL) of P_GlpDL-BcMFAse (Fig. 4b). Double translation initiation sites effectively enhance the production of BcMFAse. In order to further verify the above results, the SDS-PAGE analysis was presented to compare the production of BcMFAse. As shown in Fig. 4c, the supernatant of double translation initiation sites showed a thicker band than the recombinant strain with one translation initiation site, which was closely related to the BcMFAse production.

For the inducible promoter, verifying the suitable induced time and concentration were important for recombinant protein expression. The inducer used for inducing gene expression is a critical factor because it can influence costs, biomass productivity, and protein yield [35–37]. The optimized fermentation medium with properly mixing Nitrogen sources (tryptone, yeast extract and casein hydrolysate) in fermentation medium significantly enhanced the production of BcMFAse, the results obtained here was similar with previous studies [25, 27, 38, 39].

For the homologous promoter P_GlpD and P_GlpDL, the difference between the two promoters might cause the result (Fig. 3a). The Anti-terminator protein GlpP combine with the GlpD leader mRNA at the inverted repeat caused termination of transcription [40, 41]. The Anti-terminator protein GlpP provided a pocket for Glycerol-3-Phosphate (G3P). When G3P combined with GlpP, the transcription become effective to release the termination [42]. As the result, the promoter P_GlpDL might has stronger ability to overcome the termination because of some differences of inverted repeat sequences. Or the spacer between Shine-Dalgarno (SD) sequence and start codon make the different results. The nucleotide composition among the SD sequence and start codon has important impact on the expression [43–45]. But there has few research about these two promoters, it is hard to define the exact point that cause the difference. The further studies are required.

For constructing double translation initiation sites, an RBS and a start codon together decide a translation initiation site [33]. Regarding an RBS and a start codon as a copy unit, two copy units were tandem copied in this study, and two translation initiation sites were formed, which speeded the efficiency of translation to produce more target protein.

To sum up, we provided an effective way which definitely helped producing high-level BcMFAse in the B. subtilis. Furthermore, this study was the first report to achieve such high-level producing BcMFA than any currently available described in B. subtilis. Since the BcMFAse was characterized with high specificity to produce G5 by hydrolyzing starch, the results obtained here would lead a great industrial production potential for G5.

Funding

This work was supported by National Key Research and Development Program of China (Grant No. 2022YFC2105501), National Natural Science Foundation of China (Grant No. 31972042 and 32272284), the Scientific Research and Technology Development Program of Guangxi Zhuang Autonomous Region (Grant No. 16449-01).

Author Contribution

Conceptualization: Yutuo Wei, Jianghua Yang and Xiangyi Li. Material preparation, data collection and analysis: Jianghua Yang, Xiangyi Li, Yonglu Li and Xu Yan. Writing—original draft preparation: Xiangyi Li. Writing—review and editing: Xiangyi Li, Shiyou Pan and Liqin Du. All authors read and approved the final manuscript.

Data availability

All the data supporting the conclusions of this study are included in the article.

Xie, X., X. Ban, Z. Gu, C. Li, Y. Hong, L. Cheng, Z. Li (2020) Structure-Based Engineering of a Maltooligosaccharide-Forming Amylase To Enhance Product Specificity. J Agric Food Chem 68(3):838-844. http://doi.org/10.1021/acs.jafc.9b07234
Xie, X., X. Ban, Z. Gu, C. Li, Y. Hong, L. Cheng, Z. Li (2020) Insights into the thermostability and product specificity of a maltooligosaccharide-forming amylase from Bacillus stearothermophilus STB04. Biotechnol Lett 42(2):295-303. http://doi.org/10.1007/s10529-019-02780-5
Pan, S., N. Ding, J. Ren, Z. Gu, C. Li, Y. Hong, L. Cheng, T.P. Holler, Z. Li (2017) Maltooligosaccharide-forming amylase: Characteristics, preparation, and application. Biotechnol Adv 35(5):619-632. http://doi.org/10.1016/j.biotechadv.2017.04.004
Pan, S., G. Wang, C. Sun, L. Du, X. Qi, Y. Wei (2023) A novel maltooligosaccharide-forming α-amylase from Bacillus cereus and its application in the preparation of maltopentaose product. Process Biochem 128:68-75. http://doi.org/10.1016/j.procbio.2023.02.016
Lee, J.-W., T.-O. Kwon, I.-S. Moon (2004) Adsorption of monosaccharides, disaccharides, and maltooligosaccharides on activated carbon for separation of maltopentaose. Carbon 42(2):371-380. http://doi.org/10.1016/j.carbon.2003.11.008
Ben Ali, M., S. Mhiri, M. Mezghani, S. Bejar (2001) Purification and sequence analysis of the atypical maltohexaose-forming alpha-amylase of the B. stearothermophilus US100. Enzyme Microb Technol 28(6):537-542. http://doi.org/10.1016/s0141-0229(01)00294-0
Nagarajan, D.R., G. Rajagopalan, C. Krishnan (2006) Purification and characterization of a maltooligosaccharide-forming alpha-amylase from a new Bacillus subtilis KCC103. Appl Microbiol Biotechnol 73(3):591-7. http://doi.org/10.1007/s00253-006-0513-4
Jana, M., C. Maity, S. Samanta, B.R. Pati, S.S. Islam, P.K.D. Mohapatra, K.C. Mondal (2013) Salt-independent thermophilic α-amylase from Bacillus megaterium VUMB109: an efficacy testing for preparation of maltooligosaccharides. Ind Crops Prod 41:386-391. http://doi.org/10.1016/j.indcrop.2012.04.048
Takasaki, Y. (1983) An amylase producing maltotetraose and maltopentaose from Bacillus circulans. Agric Biol Chem 47(10):2193-2199. http://doi.org/10.1080/00021369.1983.10865953
Li, H., D. Yao, Y. Pan, X. Chen, Z. Fang, Y. Xiao (2022) Enhanced extracellular raw starch-degrading alpha-amylase production in Bacillus subtilis by promoter engineering and translation initiation efficiency optimization. Microb Cell Fact 21(1):127. http://doi.org/10.1186/s12934-022-01855-9
Zhou, C., B. Ye, S. Cheng, L. Zhao, Y. Liu, J. Jiang, X. Yan (2019) Promoter engineering enables overproduction of foreign proteins from a single copy expression cassette in Bacillus subtilis. Microb Cell Fact 18(1):111. http://doi.org/10.1186/s12934-019-1159-0
Zhang, D.,Q. Kang (2019) Development and prospect of protein expression and secretion systems in Bacillus subtilis. J Microbiol 39(1):1-10. http://doi.org/10.3969/j.issn.1005-7021.2019.01.001
Liu, Z., W. Zheng, C. Ge, W. Cui, L. Zhou, Z. Zhou (2019) High-level extracellular production of recombinant nattokinase in Bacillus subtilis WB800 by multiple tandem promoters. BMC Microbiol 19(1):89. http://doi.org/10.1186/s12866-019-1461-3
Kang, X.M., X. Cai, Z.H. Huang, Z.Q. Liu, Y.G. Zheng (2020) Construction of a highly active secretory expression system in Bacillus subtilis of a recombinant amidase by promoter and signal peptide engineering. Int J Biol Macromol 143:833-841. http://doi.org/10.1016/j.ijbiomac.2019.09.144
Miao, C.C., L.L. Han, Y.B. Lu, H. Feng (2020) Construction of a High-Expression System in Bacillus through Transcriptomic Profiling and Promoter Engineering. Microorganisms 8(7). http://doi.org/10.3390/microorganisms8071030
Rao, Y., D. Cai, H. Wang, Y. Xu, S. Xiong, L. Gao, M. Xiong, Z. Wang, S. Chen, X. Ma (2020) Construction and application of a dual promoter system for efficient protein production and metabolic pathway enhancement in Bacillus licheniformis. J Biotechnol 312:1-10. http://doi.org/10.1016/j.jbiotec.2020.02.015
Han, L., F. Suo, C. Jiang, J. Gu, N. Li, N. Zhang, W. Cui, Z. Zhou (2017) Fabrication and characterization of a robust and strong bacterial promoter from a semi-rationally engineered promoter library in Bacillus subtilis. Process Biochem 61:56-62. http://doi.org/10.1016/j.procbio.2017.06.024
Guan, C., W. Cui, J. Cheng, L. Zhou, Z. Liu, Z. Zhou (2016) Development of an efficient autoinducible expression system by promoter engineering in Bacillus subtilis. Microb Cell Fact 15(1):66. http://doi.org/10.1186/s12934-016-0464-0
Han, L., Q. Chen, J. Luo, W. Cui, Z. Zhou (2022) Development of a glycerol-inducible expression system for high-yield heterologous protein production in Bacillus subtilis. Microbiol Spectr 10(5):e01322-22.
Weissenborn, D.L., N. Wittekindt, T.J. Larson (1992) Structure and regulation of the glpFK operon encoding glycerol diffusion facilitator and glycerol kinase of Escherichia coli K-12. J Biol Chem 267(9):6122-31. http://doi.org/10.1016/S0021-9258(18)42670-1
Zweers, J.C., I. Barák, D. Becher, A.J. Driessen, M. Hecker, V.P. Kontinen, M.J. Saller, L.u. Vavrová, J.M. van Dijl (2008) Towards the development of Bacillus subtilis as a cell factory for membrane proteins and protein complexes. Microb Cell Fact 7:1-20. http://doi.org/10.1186/1475-2859-7-10
Leuschner, R.G., T.P. Robinson, M. Hugas, P.S. Cocconcelli, F. Richard-Forget, G. Klein, T.R. Licht, C. Nguyen-The, A. Querol, M. Richardson (2010) Qualified presumption of safety (QPS): a generic risk assessment approach for biological agents notified to the European Food Safety Authority (EFSA). Trends Food Sci Technol 21(9):425-435. http://doi.org/10.1016/j.tifs.2010.07.003
Pohl, S.,C.R. Harwood (2010) Heterologous protein secretion by bacillus species from the cradle to the grave. Adv Appl Microbiol 73:1-25. http://doi.org/10.1016/S0065-2164(10)73001-X
Pedersen, H.,J. Nielsen (2000) The influence of nitrogen sources on the alpha-amylase productivity of Aspergillus oryzae in continuous cultures. Appl Microbiol Biot 53(3):278-81. http://doi.org/10.1007/s002530050021
Williams, B. (2012) Purification and characterization of neutral protease enzyme from Bacillus subtilis. J Microbiol Biotechn Res 2:612-618.
Guo, F., X. Li, J. Zhao, G. Li, P. Gao, X. Han (2019) Optimizing Culture Conditions by Statistical Approach to Enhance Production of Pectinase from Bacillus sp. Y1. Biomed Res Int 2019:8146948. http://doi.org/10.1155/2019/8146948
Lee, S.K., J.H. Lee, H.R. Kim, Y. Chun, J.H. Lee, H.Y. Yoo, C. Park, S.W. Kim (2019) Improved Cordycepin Production by Cordyceps militaris KYL05 Using Casein Hydrolysate in Submerged Conditions. Biomolecules 9(9):461. http://doi.org/10.3390/biom9090461
Khatoon, N., N. Ullah, A. Sarwar, S. Ur Rahman, A. Khan, T. Aziz, M. Alharbi, A. Alshammari (2023) ISOLATION AND IDENTIFICATION OF PROTEASE-PRODUCING BACILLUS STRAIN FROM COLD CLIMATE SOIL AND OPTIMIZATION OF ITS PRODUCTION BY APPLYING DIFFERENT FERMENTATION CONDITIONS. Appl Ecol Env Res 21(4). http://doi.org/10.15666/aeer/2104_33913401
Kozak, M. (1999) Initiation of translation in prokaryotes and eukaryotes. Gene 234(2):187-208. http://doi.org/10.1016/s0378-1119(99)00210-3
Kozak, M. (2005) Regulation of translation via mRNA structure in prokaryotes and eukaryotes. Gene 361:13-37. http://doi.org/10.1016/j.gene.2005.06.037
Ma, J., A. Campbell, S. Karlin (2002) Correlations between Shine-Dalgarno sequences and gene features such as predicted expression levels and operon structures. J Bacteriol 184(20):5733-5745. http://doi.org/10.1128/JB.184.20.5733-5745.2002
Gingold, H.,Y. Pilpel (2011) Determinants of translation efficiency and accuracy. Mol Syst Biol 7(1):481. http://doi.org/10.1038/msb.2011.14
Zhang, M., J. Song, J. Xiao, J. Jin, C.T. Nomura, S. Chen, Q. Wang (2022) Engineered multiple translation initiation sites: a novel tool to enhance protein production in Bacillus licheniformis and other industrially relevant bacteria. Nucleic Acids Res 50(20):11979-11990. http://doi.org/10.1093/nar/gkac1039
Shao, Y., Y. Bai, Z. Cai, N. Pu, H. Zhang (2024) Optimization of Stationary Liquid Fermentation Conditions for N-Methylsansalvamide Production by the Endophytic Strain Fusarium sp. R1. Fermentation 10(3):140. http://doi.org/10.3390/fermentation10030140
Malakar, P.,K. Venkatesh (2012) Effect of substrate and IPTG concentrations on the burden to growth of Escherichia coli on glycerol due to the expression of Lac proteins. Appl Microbiol Biotechnol 93:2543-2549. http://doi.org/10.1007/s00253-011-3642-3
Moradian, C., M.R. Fazeli, D. Abedi (2013) Over expression of the Interferon β-1b by optimizing induction conditions using response surface methodology. Journal of Biology and today's world 2(4):217-226.
Silaban, S., S. Gaffar, M. Simorangkir, I. Maksum, T. Subroto. Effect of IPTG concentration on recombinant human prethrombin-2 expression in Escherichia coli BL21 (DE3) ArcticExpress. in IOP Conf Ser: Earth Environ Sci. 2018. IOP Publishing.
El-Bendary, M.A., S.S. Afifi, M.E. Moharam, M.M. Abo Elsoud, N.A. Gawdat (2023) Optimization of Bacillus subtilis growth parameters for biosynthesis of silver nanoparticles by using response surface methodology. Prep Biochem Biotech 53(2):183-194. http://doi.org/10.1080/10826068.2022.2056899
El-Bendary, M.A., S.S. Afifi, M.E. Moharam, M.M.A. Elsoud, N.A. Gawdat (2022) Optimization of Bacillus subtilis NRC1 growth conditions using response surface methodology for sustainable biosynthesis of gold nanoparticles. Sci Rep 12(1):20882. http://doi.org/10.1038/s41598-022-25324-w
Glatz, E., R.P. Nilsson, L. Rutberg, B. Rutberg (1996) A dual role for the Bacillus subtilis glpD leader and the GlpP protein in the regulated expression of glpD: antitermination and control of mRNA stability. Mol Microbiol 19(2):319-28. http://doi.org/10.1046/j.1365-2958.1996.376903.x
Glatz, E., M. Persson, B. Rutberg (1998) Antiterminator protein GlpP of Bacillus subtilis binds to glpD leader mRNA. Microbiology 144 ( Pt 2)(2):449-456. http://doi.org/10.1099/00221287-144-2-449
Chen, Q., W. Cui, Z. Zhou, L. Han (2021) Exploration of key residues and conformational change of anti-terminator protein GlpP for ligand and RNA binding. Proteins 89(6):623-631. http://doi.org/10.1002/prot.26045
Liebeton, K., J. Lengefeld, J. Eck (2014) The nucleotide composition of the spacer sequence influences the expression yield of heterologously expressed genes in Bacillus subtilis. J Biotechnol 191:214-220. http://doi.org/10.1016/j.jbiotec.2014.06.027
Volkenborn, K., L. Kuschmierz, N. Benz, P. Lenz, A. Knapp, K.-E. Jaeger (2020) The length of ribosomal binding site spacer sequence controls the production yield for intracellular and secreted proteins by Bacillus subtilis. Microb Cell Fact 19:1-12. http://doi.org/10.1186/s12934-020-01404-2
Liu, S., P. Wang, Y. Dong, H. Xu, S. Li, L. Zhang (2021) The Sequence of the Ribosomal Binding Site Controls the Gene Expression in Brucella. http://doi.org/10.21203/rs.3.rs-944639/v1

No competing interests reported.

supplementaryfile.rar

Download PDF

Version 1

posted

You are reading this latest preprint version

Using glycerol-inducible expression system to overexpressed maltooligosaccharide-forming α-amylase in Bacillus subtilis

Status:

Version 1

Abstract

Figures

Introduction

Materials and Methods

Bacterial strains, plasmids and growth conditions

Construction of expression vectors containing different promoters

Verification of glycerol-inducible conditions of promoter P_GlpD

Optimization of fermentation medium for BcMFAse

Construction of expression vector containing double translation initiation sites

SDS-PAGE analysis

BcMFAse activity assay

Results

Compared the activity of homologous promoter for expressing BcMFAse

Discussion

Conclusion

Declarations

Funding

Author Contribution

Data availability

References

Additional Declarations

Supplementary Files

Status:

Version 1

Using glycerol-inducible expression system to overexpressed maltooligosaccharide-forming α-amylase in Bacillus subtilis

Status:

Version 1

Abstract

Figures

Introduction

Materials and Methods

Bacterial strains, plasmids and growth conditions

Construction of expression vectors containing different promoters

Verification of glycerol-inducible conditions of promoter PGlpD

Optimization of fermentation medium for BcMFAse

Construction of expression vector containing double translation initiation sites

SDS-PAGE analysis

BcMFAse activity assay

Results

Compared the activity of homologous promoter for expressing BcMFAse

Discussion

Conclusion

Declarations

Funding

Author Contribution

Data availability

References

Additional Declarations

Supplementary Files

Status:

Version 1

Verification of glycerol-inducible conditions of promoter P_GlpD