Animals. Approval for all experimental animals was provided by the Ethics Committee of Anhui Medical University. Ethical approval for this study (No. LLSC20190763) was provided by the Institutional Animal Care Unit Committee of Anhui Medical University on October 10, 2019. The C57BL/6 background mice were purchased from Henan Skobes Biotechnology Co., Ltd. and raised in polypropylene cages. They were subjected to a 12 h light–dark cycle (with the lights on at 8:00 a.m. and off at 8:00 p.m.), and the indoor temperature was maintained at around 26°C. Adequate food and water were provided with free access.
Western blotting. Radioimmunoprecipitation assay lysis buffer (RIPA) and protease phosphatase inhibitor were added to an organized EP tube and ground. The supernatant was centrifuged, 5× loading buffer was added, and the sample was boiled. Following this, polyacrylamide gel electrophoresis (SDS-PAGE) was prepared, the sample was added, and the protein was transferred onto the PVDF membrane for electrophoresis. After the membrane transfer is completed, seal with 5% skim milk for 2 h. Dilute 5% skim milk with TBST for preparation. After sealing, rinse with phosphate buffered saline (PBS) once. Prepare the primary antibody incubation solution using the dilution solution according to the recommended ratio in the instruction manual. Incubate overnight on a shaking table at 4 ℃ for approximately 15 h. Wash the first antibody with TBST for 15 min each time, three times. (Due to the high cost of primary antibodies, they can be recycled and reused approximately three times). Dilute the secondary antibody corresponding to the primary antibody with 5% skim milk prepared with TBST. Prepare the secondary antibody incubation solution according to the recommended ratio in the instruction manual. Incubate at room temperature on a shaker for 2 h. Wash the secondary antibody with TBST for 15 min each time, three times. Exposure images were obtained by combining enhanced chemiluminescence (ECL).
RT-qPCR. The required mouse was euthanized by cervical dislocation method, with the left hand pressing on the mouse's head and the right hand gripping the end of the tail 1/3. The right hand was pulled back until a sense of emptiness was felt. After cervical dislocation in mice, the head is cut off, the head skin is cut open, the skull is T-shaped, the brain tissue is exposed, and the cerebellum is carefully peeled off. The detached cerebellum is rinsed in pre cooled PBS to remove blood stains and hair. It is then placed on filter paper to absorb surface moisture and placed in a labeled centrifuge tube for immediate use in the experiment. We used the traditional Trizol method to extract RNA from mouse cerebellum tissues. Detection of RNA concentration using NanoDrop-2000c ultra micro spectrophotometer. Single-stranded RNA was used to synthesize cDNA. According to the manufacturer’s instructions, two-step quantitative PCR was performed using the 2x SYBR green reagent and primers corresponding to the target gene to obtain its Ct value. The primers were synthesized from the official website of biotechnology (https://www.ncbi.nlm.nih.gov/ NCBI).
Target genes
|
Primer sequence(5'-3')
|
GAPDH
|
F:CATCACTGCCACCCAGAAGACTG
R:ATGCCAGTGAGCTTCCCGTTCAG
|
KLF15
|
F:ACACCAAGAGCAGCCACCTCAA
R:GCCTTGACAACTCATCTGAGCG
|
Construction of plasmids. We linearized the PGMAAV-10261 RNAi vector using restriction endonucleases, connected the target RNAi sequence, and constructed a vector with the target RNAi sequence. Target RNAi sequence:
Target
|
Target RNAi sequence
|
NC
|
TTCTCCGAACGTGTCACGT
|
shRNA205
|
GACCTTCTCGTCACCGAAATG
|
shRNA511
|
GCCTGTGAAGGAGGAACATTT
|
shRNA988
|
GAACCTGCCCTCAAAGTTTGT
|
shRNA273
|
CAGTGGAGGTATTGGAGATAG
|
shRNA850
|
CCCATTGCCGCCAAACCTATT
|
Stereotactic injection. For young mice, anesthetized with isoflurane, place the mice on a stereotaxic stand, insert an ear stick into the external ear canal of the mice, and fix the front teeth to keep the posterior fontanelle level. Due to the small size of the mice and the fact that their hair has not yet grown, we only disinfected the outer surface of the skull skin with 75% ethanol, cut open the scalp, and exposed it. After exposure, we used a dental drill to drill a small hole above the cerebellum at coordinates x (M/L): 0 mm y (A/P): -3.7 mm z (D/V): -1.2 mm. Using 10 µl micro injection needle inject 350 nl of virus into each site at a rate of 60 nl/min, and leave for 5 min after injection. After injection, the mice were placed on a heating pad to slowly awaken. Put it back into the mouse cage after 30 min. Follow up experiments will be conducted around 3 weeks after virus infection.
High-performance liquid chromatography–mass spectrometry. After sampling, weigh it and add physiological saline in a ratio of 2 ml/g. Place two grinding beads in each EP tube and grind 5 times at a frequency of 60 Hz in a homogenizer, with a 60 s interval between each time. Put the ground homogenate into a 4 ℃ centrifuge at 12000 ×g and centrifuge for 10 min. Take the upper clear 500 µl. Add an equal amount of acetonitrile, shake thoroughly and mix for 30 s. Centrifuge at 12000 ×g at 4 ℃ for 10 min, and take 0.22 of the supernatant µm organic filter membrane. Take 450 µl. Join 50 µl GABA-D6 1 × 10− 7 mg/ml internal standard, shake and mix well for later use. The experimental instrument is the Shimadzu UPLC system, and the chromatographic separation column is Shim pack GIST C18 column (2.0 µm. 2.1 mm × 100 mm). The mobile phase A is 0.15% methanol water, and the B phase is methanol. The temperature of the column temperature box is 40 ℃. The total flow rate is 0.2000 ml/min. After stabilizing the pump pressure, pump A has a pressure of 21.5 MPa and pump B has a pressure of 21.3 MPa. Injection volume of 10 µl. The gradient elution program is 0–6 min, 90% A; 6–9 min, 90% -10% A; 9–15 min, 10% A; 15–18 min, 10% -90% A; 18–23 min, 90%A.
Immunohistochemistry. Anesthetized mice were intraperitoneally injected with pentobarbital (50 mg/kg), and 50 ml of physiological saline NaCl and 25 ml of paraformaldehyde PFA were perfused into the heart. The mouse brains were removed through craniotomy and incubated in polyformaldehyde (PFA) at 4°C for 24 h. Then, sugar was gradually precipitated, sucrose solution was prepared with 20% phosphate buffered saline (PBS) for 24 h, and then with 30% PBS for 24 h for tissue dehydration. Using a frozen slicer, 30 µm brain slices were cut and then washed with a PBS embedding agent three times every 5 min. Prepare 6% donkey serum, 1% BSA, and 0.6% tramadol PBST using PBS and drop them onto brain slices, with approximately 50 µl drops per slice. Closed for 2 h. Dilute the secondary antibody with prepared PBST according to the instructions and incubate it on brain slices for 2 h. Wash the secondary antibody, shake off the secondary antibody, and wash with PBS three times for 5 min each time. Dry the glass slide at room temperature. Slowly cover the cover glass and apply nail polish on the four corners.
Immunofluorescence. After obtaining the mice, anesthesia was administered with isopentane. After the mice became unconscious, they were placed on foam plates to fix their limbs, and the chest was cut open with scissors, exposing the heart. Insert a venous needle from the left apex of the heart and inject physiological saline. At this time, the heart will swell and the right atrial appendage will be cut open. Slowly inject 40 ml of physiological saline and 20 ml of polyformaldehyde PFA. Injecting paraformaldehyde found that the tail of the mouse was stiff, the limbs twitched, and the liver turned white, indicating a successful perfusion. The preprocessed brain slices were sealed with a PBST locking solution prepared with PBS, 6% donkey serum, 1% BSA, and 0.6% Triton X-100. The first antibody was diluted in proportion to PBST and added dropwise onto the brain slices for overnight incubation at 4°C. The fluorescent secondary antibody was combined with its corresponding species for 2 h. The nuclei were stained with 4,6-diamidino-2-phenylindole (DAPI) staining solution for 5 min. Following this, an anti-fluorescence quenching agent was added dropwise, and the film was sealed. The panoramic tissue cell quantitative analysis system TissueFAXSPlusS was used to obtain staining images.
Golgi stain. Intraperitoneal injections of pentobarbital (50 mg/kg) were used to anesthetize the mice. 50 ml of physiological saline and 25 ml of paraformaldehyde PFA were perfused into the heart to obtain brain tissue samples, which were then soaked in Golgi fixative. After 48 h of fixation, the tissues were cut into blocks of 2–3 mm thickness based on the desired observation site. Golgi staining solution was added until the tissue blocks were completely immersed, which were then placed in a cool, ventilated place, avoiding light and reacting for 14 d. After washing with distilled water, the tissue blocks were immersed in 80% acetic acid and left to sit overnight. These were then transferred into 30% sucrose solution. A slicer was used to cut out 100 µm slices. These were air dried and treated with concentrated ammonia water for 15 min, washed with water for 1 min, treated with an acidic film fixing solution for 15 min, and sealed with glycerol gelatin. Panoramic images of the brain tissues were obtained using a digital slice scanner.
Rotarod testing. The rotating rod experiment is used to measure the balance and coordination ability of mice. Three days before the official experiment, the mice were first subjected to adaptive training, gradually accelerating from 4 r/min to 40 r/min to adapt to the state of being on a rotating stick. The training lasted for three consecutive days. During the formal experiment, first maintain the rotating rod at 4 r/min, place the mouse on the rotating rod to adapt for 1 min, and then accelerate from 4 r/min to 40 r/min. Record the time of the mouse's fall and the rate of rotation of the stick during the fall.
Gait analysis. We use a flat track with a length of 50 cm and a width of 9 cm, with white paper laid on the bottom, and let the mice walk along the track. To visualize the footprints of mice, we applied blue ink to the front paws and red ink to the back paws. Carefully place the mouse at the beginning of the white paper and let it walk forward, leaving its footprints on the paper. After the ink dries, measure its step length and width with a ruler and record the data.
Sholl analysis. We drew concentric circles with the cell body at the center, increasing the radius by 10 µm each time, and counted the number of intersection points between the cell dendrites and the concentric circles.
Statistical analysis. The data for at least three independent experiments were expressed as mean ± SD values. A t-test or a two-way ANOVA followed by Tukey’s test was used to compare and analyze the statistical differences between two groups of data. GraphPadPrism8 was used for statistical analysis and chart production. * p < 0.05; ** p < 0.01; *** p < 0.001.