Plant material
The Zhugen cultivar of ginger plants (Zingiber officinale Roscoe) used in this study are widely cultivated in the Sichuan, Chongqing, and other regions of southwest China. Mature rhizomes were harvested, stored overwinter and then be replanted in the following growing season. The experimental design followed the protocol reported in our previous study 34. Briefly the stored rhizomes were washed with clean water, air dried, and then divided into two groups. Rhizomes with epidermal surfaces without obvious symptoms of infection were considered to be the asymptomatic group, while rhizomes with epidermal surfaces that appeared watery, brown, or shrunken were considered to be the symptomatic group. Rhizomes in each group (symptomatic and asymptomatic) weighed approximately 50 g each, and each group contained 40 rhizomes amounting to about 2.0 kg. The rhizomes were again washed with clean water, soaked in 1% NaClO for 5 min, air dried, and then planted in a sterile peat substrate (Klasmann-Deilmann, Germany) and placed at 25°C and 70% relative humidity for approximately one month to allow for adventitious bud formation. Each group comprised three biological replicates. 5 Rhizomes were randomly taken out from both asymptomatic and symptomatic group every two days to detect the firmness of the rhizomes using a Digital fruit firmness tester (HD-GY-4). After that, the number of conidia was also assessed from destructive rhizomes tissues.
Isolation and identification of F. oxysporum and F. solani
Symptomatic rhizomes were surface sterilized in 2% (v/v) sodium hypochlorite for 2 min, rinsed with sterile water three times, and then air-dried. Then a 3 x 3 mm portion of symptomatic tissue was cultured on Potato Dextrose Agar (PDA) medium containing ampicillin 100 µg/ml at 25°C for 3 days. Single colonies were successively cultured on PDA plates 3 x to obtain a pure culture. Subsequently, the obtained purified strain was cultured at 25°C for 5 days, to obtain approximately 0.05 g of mycelia. Genomic DNA was isolated from these mycelia using a E.Z.N.A.® Soil DNA Extraction Kit (Omega Bio-Tek). The extracted DNA was then amplifed using the primer set ITS1: (5'TCCGTAGGTGAACCTGCGG3'), ITS4: (5'TCCTCCGCTTATTGATATGC3'). The reaction mixture contained 10 µl Taq polymerase, 1 µl upstream primer, 1 µl downstream primer, 7 µl ddH2O, and 1 µl DNA. The PCR reaction was performed after thorough mixing. The PCR protocol was as follows: pre-denaturation (94 ℃, 5 min), denaturation (94°C 30 seconds), annealing (ITS1, ITS4 annealing at 47°C), extension (72°C, 1 min) for 30 cycles. The amplified products were then sequenced by Applied Biosystems' First generation sequencer. The obtained ITS sequences were then subjected to BLAST analysis against sequence data in the National Center for Biotechnology Information (NCBI) database (http://blast.ncbi.nlm.nih.gov/Blast.cgi). Sequences with high similarity ( > = 97%) were downloaded and further compared using ClustalW35. MEGA-X36 was used to construct an evolutionary tree and iTOL37 was used to display the evolutionary tree. The morphology of mycelia and conidia were also examined with a microscope and recorded. Results indicated that the culture were F. oxysporum and F. solani.
Pathogenicity of F. oxysporum and F. solani
Pathogenicity tests were conducted as previously described11. F. oxysporum and F. solani were cultured on PDA medium at 25°C for 5 d and spores were eluted from the cultures by flooding the plates with 2 ml of sterile distilled water. The eluate was then collected and filtered through several layers of cheesecloth to remove mycelial debris. The obtained spore suspension was then adjusted to a concentration of 106 spores/ml with the aid of a hemocytometer. Asymptomatic ginger rhizomes, cultivated for approximately 200 days and harvested at middle November, were washed 3 times with clean water to remove any soil residue. The rhizomes were then cut into two pieces and their surface were abraded randomly 2–3 three times by sterile scalpel blade. The rhizome pieces were disinfected by soaking them in 1% sodium hypochlorite for 5 min, followed by rinsing with sterile water 3 times, and air drying. Each prepared rhizome pieces was then inoculated with 200 uL spore suspension. The assay utilized 15 rhizomes and was repeated three times. The inoculated rhizomes were then incubated at 25 ℃ and 70% relative humidity and investigated disease symptom every day.
Field soil previously planted with crop were used as planted matrix to assess the pathogenicity of F. oxysporum and F. solani on ginger seedlings. 6 kilogram filed soil were put into nursery tray (43cm x 45 cm). The prepared spores were inoculated into field soil at a concentration of 106 spores/kg. Sterile water inoculated field soil served as the control group. The soils were then cultivated for 7 days. After being develop for 30 days, tissue culture sterile ginger seedlings were transferred to a greenhouse and continue cultivated for 5 days. Subsequently, 16 tissue cultured seedlings were transplanted into each inoculated soil and the treatment were repeated three times. Meanwhile, the disease incidence and disease severity index (DSI) were evaluated. The disease incidence was calculated by the formula of IC = n/N × 100, where IC = incidence; n = number of diseased seedlings; and N = total number of seedlings. The disease severity of wilt caused by F. oxysporum and F. solani on seedlings were measured. Disease severity was determined according to the following equation: disease severity index (DSI)[∑ (number of decay fruit at each level × representative value of each level) / (total number of fruit surveyed ×representative value of the highest level)] × 100. Seedlings wilt is classified into three grades, where 0 indicates no disease symptoms of seedlings, 1 indicates partial leaves chlorosis, 2 indicates whole seedlings chlorosis, 3 indicates whole seedlings wilt.
Investigation of Fusarium wilt during ginger development
This portion of the study was conducted on a farm located in Panlong Town, Rongchang District, China (30.143806;107.169686), a traditional area of ginger production. The plot used in this study had been continuously used for ginger production for 12 years, and the soil was known to be contaminated with Fusarium sp33. Rhizomes are sown every year in mid-January after the soil temperature has reached 10 ℃ and the replanted rhizomes are harvested in late July. The plots remain fallow from August to December every year. A total of 750 kg of NPK fertilizer (25N-10P-20K) per hectare was applied to the soil in January 2022. The soil in the plot was subjected to rotary tillage to a depth of 45–50 cm after the fertilizer was applied. The experimental area used in the study was about 667 m2, and this amount of area was replicated three times. The overwintered ginger rhizomes were planted in the test plots on February 16, 2022. The rows of planted rhizomes were covered with polyethylene film. Adventitious buds were allowed to develop on the covered rhizomes from February 24 to April 6, 2022.
Disease incidence and disease severity of ginger wilt in plots was assessed from April through June as described in our previous study 33. Assessment of disease incidence and severity were conducted on April 14, April 29, May 15, May 30, and June 12, 2022. Disease incidence for Fusarium wilt was calculated using the following formula: IC = (n/N) × 100; where IC = incidence; n = number of diseased ginger plants; and N = total number of investigated plants. Disease severity was determined according to the following equation: disease severity index (DSI) = 100 × ∑ (number of diseased plants at all levels × representative values at all levels) / (total number of investigated plants × highest representative value). Fusarium wilt was classified into five grades, where Level 0 is no disease symptoms on ginger leaves; 1 indicates a wilting symptom on 0 to 25% of the leaves, 2 indicates wilting symptoms on 25–50% of the leaves, 3 indicates wilting symptoms on 50–75%, of the leaves, and 4 indicates wilting symptoms on 75–100% of the leaves. Wilted stems were automatically assigned the highest disease grade. Symptomatic and asymptomatic ginger plants were harvested and brought back to the laboratory on May 15, May 30, and June 12, 2022. The rhizomes, stems, and leaves of both symptomatic and asymptomatic plants representing different developmental stages were used to assess the concentration of F. oxysporum conidia in each type of organ.
Comparison of fungal community structure in symptomatic and asymptomatic tissues.
Ginger rhizome, stem and leaf tissues of ginger from symptomatic and asymptomatic plants were harvested on May 15, 2022, and sent to Shanghai Meiji Biomedical Technology Co., Ltd. For DNA extraction and ITS amplicon sequencing. The ITS primers used were ITS1F (CTTGGTCATTTAGAGGAAGTAA) and ITS2R (GCTGCGTTCTTCATCGATGC). The sequenced amplicons were analyzed on the cloud platform (https://login.majorbio.com/login) through access provided by Meiji Biomedical Technology Co., Ltd. The raw data was assembled and subjected to quality control using Qiime software38. The DADA239 algorithm was used to cluster the acquired sequence variants (ASVs) using a similarity requirement > 97%. The species assignment of an ASV was retained when the number of ASV sequences was ≥ 5 in at least 3 samples, and the total number of ASV sequences was > 20. ASVs that aligned with Chloroplast and Mitochondrial sequences were removed. ASV sequences were annotated using RDP classifier software 40. Unite v9.0 (http://unite.ut.ee/index.php) was used for the classification of fungal communities. Alpha diversity and Beta diversity analyses of the annotated species were conducted using Mthur41 and R v4.0.2 software. Co-occurrence network analysis was used to reveal the the association of different fungal taxa. The established biologically relevant networks were analyzed using the complex network analysis toolkit Networkx42, which calculates the node degree distribution, network diameter, average shortest path through the network, and attributes such as node connectivity (degree), closeness centrality, and betweenness centrality. Cystoscape43 was used to display the results of correlation and network analysis.