Animals
20 healthy adult Sprague-Dawley (SD) rats weighting 200 to 250 g were used in this study. The animals were purchased from Beijing Charles River Laboratory Animal Co., Ltd. The rats were housed in individual cages under a constant temperature (23 ± 2 °C) and had access to food and water ad libitum throughout the study. All procedures, care, and handling of the rats were approved by the Ethics Committee of Nanchang Hongdu hospital of traditional Chinese medicine.
Antibodies and Reagents
The SuperSignal™ West Pico PLUS chemiluminescent substrate (34580) was purchased from Thermo Fisher Scientific Inc. (Waltham, MA, USA). PVDF membrane with 0.45 µm pore size (IPVH00010) was purchased from Merck Millipore (Darmstadt, Germany). BCA protein assay kit (CW0014S), HiFiScript first strand cDNA synthesis kit (CW2569M), UltraSYBR mixture (CW0957M), Ultrapure RNA extraction kit (CW0581M) and TRIzon reagent (CW0580S) were purchased from Cwbio Inc (Beijing, China). Mouse anti-GAPDH monoclonal antibody (TA-08), HRP-conjugated goat anti-mouse IgG (H + L) secondary antibody (ZB-2305) and HRP-conjugated goat anti-rabbit IgG (H + L) secondary antibody (ZB-2301) were purchased from ZSGB-Bio Technologies Inc (Beijing, China). Rabbit anti-HIF-1α polyclonal antibody (ab2185), rabbit anti-Bcl-2 polyclonal antibody (ab59348), rabbit anti- Apaf-1 monoclonal antibody (ab32372), rabbit anti-cleaved caspase 3 polyclonal antibody (ab2302) and rabbit anti- Beclin-1 polyclonal antibody (ab62557) were purchased from Abcam (Cambridge, UK). The rabbit anti-LC3 polyclonal antibody (bs-8878R) was purchased from Biosynthesis Inc (Beijing, China). Cell autophagy staining test kit (G0170) and Acridine orange staining solution (CA1143) were purchased from Solarbio Life Sciences (Beijing, China). All other reagents were purchased from Sigma-Aldrich (St. Louis, MO, USA).
Isolation and culture of rat intervertebral disc cells
Twenty SD rats were used to isolate the intervertebral disc cells. In brief, the rats were anesthetized and killed by intraperitoneal injection of 10% chloral hydrate, then isolate the spine under aseptic conditions, following removal of ligaments and nucleus pulposus around the spine. The isolated spine was cut into small block with the size of 1 mm3, after digestion with 0.25% trypsin for 20 min and 0.2% type II collagenase digestion for 2 h, the digested cells were collected by cell sieve and cultured in the DMEM/F12 medium containing 10% fetal bovine serum, 100 U/ml penicillin and 100 µg/ml streptomycin under an atmosphere of 5% CO2 at 37 °C, the cultured medium was changed every 2–3 days. When the degree of cell fusion reached more than 80%, digested the cells at a ratio of 1:2 for passage. At the same time, the second generation cells were taken for the detection of toluidine blue staining.
Toluidine blue staining
The above cultured rat intervertebral disc cells grown to the second generation, then inoculated them on 6-well plate, removed the medium and washed with phosphate buffer solution (PBS) for 5 min, then the cells fixed with 4% paraformaldehyde at room temperature for 10 min. Subsequently, the fixation solution was removed and the cells were stained with toluidine blue dye for 2 min, the staining solution was removed and the cells were washed with ultrapure water for 3 min. The stained and washed cells then air dried and imaged under optical microscope.
Overexpression and RNA interference assay
To study the role of BNIP3 in the autophagy and apoptosis of rat intervertebral disc cells, the overexpression and RNA interference assay were performed as described previously (18). Briefly, the rat intervertebral disc cells were placed in 6-well tissue culture plates and growth to 60% confluence prior to transfection. Then the cells were transfected with 4 µg of plasmids (built recombinant BNIP3-pcDNA 3.1 vector and pcDNA 3.1 empty vector) for 48 h. The Lipofectamine 3000 transfection reagent was used. For RNA interference (RNAi) experiments, the cells were growth to 40–50% confluence prior to transfection. The recombinant BNIP3 silenced plasmid sh-BNIP3-pLVshRNA (siBNIP3) and control vector (siCtrl) were transfected into cells by using the Lipofectamine 3000 transfection reagent for 48 h. After BNIP3 overexpression and RNAi, the expressions of BNIP3 mRNA in rat intervertebral disc cells were detected by real-time quantitative PCR.
Cell viability determination by CCK8 method
To determine the viability of rat intervertebral disc cells after tranfected with BNIP3 overexpression vector or interference vector, the CCK8 method was employed. Briefly, the transfected cells were placed in 96-well plates and added 150 µL freshly prepared toxicity test solution containing 10 µL CCK8 to each well and cultured for 4 h, the absorbance at 450 nm wavelength in 0、12、24 and 72 h were measured by microplate reader. The cell viability assay was repeated in three times and the data was presented as Means ± SD. The cell growth inhibition rate (%) = (OD450Control – OD450Experiment)/ OD450Control × 100%. The cell growth inhibition rate curve was drawed, the groups as abscissa and cell growth inhibition rate (%) as ordinate.
Cell autophagy determination by acridine orange staining
The above transfected cells were collected and prepared to cell suspension at the concentration of 1 × 106 cells/ml. Every 100 µL cell suspension mixed with acridine orange staining solution with a final concentration of 15 µg/mL, stained at room temperature in the dark for 20 min, then drop it on a glass slide and observed under fluorescent microscope. The normal cells were presented to uniform yellow-green fluorescence, while autophagic cells’ chromatins were concentrated and the nuclei were fragmented into dots, and they were stained into uneven, dense and deep stained green particles.
Cell autophagy determination by MDC method
The transfected cells collected by trypsin digestion and washed with PBS, then suspended in 1 × wash buffer with the concentration of 1 × 106 cells/ml. 90 µL cell suspension was taken out and transferred to new eppendorf tube. Whereafter, 10 µL MDC dye was added into the cell suspension, mixed and stained at room temperature in the dark for 45 min, the stained cells were collected by centrifuged. The cells were washed two times with 1 × wash buffer and resuspended in 100 µL collection buffer. The cell suspension was loaded on the slide and observed under fluorescent microscope. The normal cells were presented to uniform yellow-green fluorescence, while autophagic cells’ chromatins were concentrated and the nuclei were fragmented into dots, and they were stained into uneven, dense and deep stained green particles.
Cell membrane potential was detected by flow cytometry
The membrane potential detection of transfected cells by using flow cytometry method. Briefly, the transfected cells collected by trypsin digestion and washed two times with PBS, then suspended in JC-1 working buffer with the concentration of 1 × 106 cells/ml. The cell suspensions incubated at 37 °C for 20 min, centrifuged, collected the cells and resuspended in 1 × Incubation buffer. Finally, the cells were analyzed by using a flow cytometer.
Real-time fluorescent quantitative PCR (RT-PCR)
Real-time fluorescent quantitative PCR was used to detect the expression of HIF-1α, Bcl-2, Apaf-1, cleaved caspase 3, LC-3 and Beclin-1 mRNA of transfected rat intervertebral disc cells. In brief, the total RNA of transfected cells was extracted by commercial RNA extraction kit and the RNA purity were determined by the ratio of A260/A280 and agarose gel electrophoresis. Total RNA was synthesized the first strand cDNA by first strand cDNA synthesis kit. Using the synthesized first-strand cDNA as template, the specific primers for HIF-1α, Bcl-2, Apaf-1, cleaved caspase 3, LC-3 and Beclin-1 were designed as the previous method (19) and listed on Table 1 and applied to RT-PCR reaction. The RT-PCR reaction condition as follows: 95 °C for 10min,95 °C for 5 and 60 °C for 1min༌40 cycles. The RT-PCR reaction system was 20 µL, which contained 2 µL cDNA template, 0.8µL the primer F and primer R, 10 µL SYBR Green solution and 7.2 µL ddH2O. The data of RT-PCR was calculated and analyzed by the method of 2 -ΔΔCT.
Table 1
Sequences of primers used for detection of BNIP3, Beclin-1, LC-3, Bcl-2, HIF-1α, caspase 3, Apaf-1 and GAPDH in rat.
Primer name | Primer sequence (F: Forward, R: Reverse) | Primer length(bp) | Product length(bp) |
BNIP3 | F: TCTCACTGTGACAGCCCACC | 20 | 183 |
R: CCGACTTGACCAATCCCATA | 20 |
Beclin-1 | F: GGAGAAAGGCAAGATTGAAGA | 21 | 140 |
R: AGGACACCCAAGCAAGACC | 19 |
LC-3 | F: ATGGCGGCGTCTTTGTG | 17 | 310 |
R: TGGATTTCTTCAGTTGCTTGG | 21 |
Bcl-2 | F: CCCTGGCATCTTCTCCTTC | 19 | 269 |
R: AGAGTTCCTCCACCACCGT | 19 |
HIF-1α | F: GCCCTGGATGGCTTTGT | 17 | 200 |
R: TGTTCTTTCCCCTTTCTCACT | 21 |
Caspase 3 | F: AAAGCCGAAACTCTTCATCA | 20 | 63 |
R: GTCTCAATACCGCAGTCCAG | 20 |
Apaf-1 | F: TCCATCGGAAAACAAGACAA | 20 | 144 |
R: TCGCAGCATCAGAACACG | 18 |
GAPDH | F: GCAAGTTCAACGGCACAG | 18 | 141 |
R: CGCCAGTAGACTCCACGAC | 19 |
Western blotting
Western blotting was used to detect the expression level of HIF-1α, Bcl-2, Apaf-1, cleaved caspase 3, LC-3 and Beclin-1 proteins of transfected rat intervertebral disc cells. Briefly, the cells were collected and washed, then lysed by adding RIPA lysate contained protease inhibitor cocktail in ice-bath for 20 min. The above cell lysate was centrifuged at 10000 rpm for 15 min, the supernatant after centrifugation is the total proteins. The concentrations of proteins were determined by BCA method. The total proteins were loaded and separated by 12% SDS − PAGE, then electrotransferred onto PVDF membranes. The PVDF membranes were subsequently blocked with 3% BSA and subsequently incubated with rabbit anti-HIF-1α (1:1000 dilution), anti-Bcl-2 (1:1000 dilution), anti-Apaf-1 (1:1000 dilution), anti-cleaved caspase 3 (1:1000 dilution), anti-LC-3 (1:500 dilution), anti-Beclin-1 (1:1000 dilution) polyclonal antibody and mouse anti-GAPDH monoclonal antibody (1:10000 dilution), respectively. The incubation of PVDF and primary antibodies was overnight at 4 °C. After incubated with primary antibodies, the PVDF membrane washed with TBS buffer contained 1‰ Tween-20 three times, then incubated with HRP-conjugated goat anti-rabbit or goat anti-mouse secondary antibody (1:5000 dilution). Finally, the protein bands were visualized with the SuperSignal™ West Pico PLUS chemiluminescent substrate.
Statistical analysis
All experimental values were presented as the Mean ± SD. Each experiment was repeated at least 3 times independently. Statistical analysis of data was performed using SPSS 17.0 software. One-way ANOVA was used to analyse the differences between more than two groups, and non-paired student’s t test was used to analyse the difference between two groups. P < 0.05 was considered statistically significant.