Highly sensitive detection of Staphylococcus aureus α-Hemolysin protein (Hla or α-toxin) by Apta-qPCR

doi:10.21203/rs.3.rs-4204970/v1

Download PDF

Research Article

Highly sensitive detection of Staphylococcus aureus α-Hemolysin protein (Hla or α-toxin) by Apta-qPCR

https://doi.org/10.21203/rs.3.rs-4204970/v1

This work is licensed under a CC BY 4.0 License

Version 1

posted

You are reading this latest preprint version

α-toxin of Staphylococcus aureus is belonging to pore-forming toxins (PFTs) which can lyse red and white blood cells except neutrophils. In addition to existence of the hla gene in the majority of S. aureus strains (about 95%), higher expression exert enhanced pathogenicity to the bacteria. Various methods such as aptamer-based ones could serve for detection of the toxin. In the current study, an apta-qPCR assay is developed based on the murine polyclonal antibodies and a specific aptamer to detect wide range of α-toxin amounts. A recombinant α-toxin was administered to mice in denature form to trigger specific antibodies. The specific antibodies were purified from immune sera. These antibodies served as capture where an aptamer employed as detector in the designed apta-qPCR assay. The results showed that spiked α-toxin in the sera samples was detected alpha toxin between 300 to 0.5 ng/mL with no cross reactivity. The coefficient of variation (CV) percent of intra- and inter assays were 0.84 and 1.06 respectively. Since in apta-qPCR assay, combination of specific polyclonal antibodies as capture, and specific aptamer along with real-time PCR (qPCR) sensitivity is employed, this robust method could be used in diagnostic laboratories to detect various levels of the toxin in human sera samples.

α-Hemolysin protein

Aptamer

Real Time PCR

apta-qPCR

Staphylococcus aureus (S. aureus), the most common cause of hospital-acquired infections is a gram-positive facultative anaerobic bacterium which could develop mild or severe diseases such as skin infection, abscesses, sinusitis, pneumonia, bacteremia, endocarditis, meningitis and sepsis (1, 2).

One of the major virulence factors in S. aureus is α-Hemolysin (Hla or α-toxin) belonging to pore-forming toxins (PFTs). Pore-forming toxins can damage biological membranes through pore formation resulted in cell death (3, 4). α-toxin can lyse red blood cells and white blood cells except neutrophils. α-toxin monomers with a molecular weight of 33 kDa, and length of 293 amino acids, encodes by the hla gene located on the chromosome This monomer binds to the metalloproteinase ADAM10, forms the pre-pore on the plasma membrane by oligomerization to a heptamer which stabilized by interaction with Caveolin-1 within the membrane bilayer, and finally, the transmembrane barrel is formed via insertion of the stem domain into the membrane (5). This toxin at low and higher concentrations can induce DNA fragmentation and necrosis respectively (6).

The majority of S. aureus strains (about 95%) harbor the hla gene and it had been revealed that its higher expression enhances the bacterial pathogenicity (7). Several approaches had been developed for detection of α-toxin. Antibody-based detection assays such as Enzyme-linked immunosorbent assay (ELISA) has been used. However, some drawbacks such as the time-consuming of antibody preparation, solvent effects, and batch-to-batch variations should be announced. To overcome the limitations and drawbacks of antibody-based assays, aptamers had been considered and used (8, 9).

Aptamers are short molecules of RNA or single stranded DNA that have complex three-dimensional structures which could bind to a wide range of targets (aptatopes of target molecules), including protein, mycotoxin, thrombin, K, ATP, virus, and bacteria, with high specificity, affinity and selectivity. Aptamers can also be modified, and conjugated to solid matrices for detection and quantification. Process of aptamer production for specific targets with high binding affinities can carry out in vitro by systematic evolution of ligands by exponential enrichment (SELEX)(10–13).

Nucleic acid aptamers in compare with antibodies have advantages such as short generation time (3–7 weeks), convenience in modification, high stability, low cost, low immunogenicity, and ability to be synthesized in the laboratory (14). Today, aptamers have found wide applications, especially in combination with other techniques. These applications including biosensor development, flowcytometry, medical applications (such as diagnostics and drugs), SPR and etc (15).

Recently we have developed an electrochemical aptasensor based on gold nanoparticle/multi-walled carbon nanotubes for detection of α-toxin (16). Although the developed sensor was highly sensitive and selective, it is not suitable for diagnostic laboratories.

The apta-qPCR assay is combination of the aptamer specificity with real-time PCR (qPCR) sensitivity for the ultrasensitive detection of molecules. Actually using this method, aptamers have been employed as template for qPCR and the appropriate ligand for the target molecules, and thus the aptamer amplified and quantified easily by qPCR technique (8, 13).

In the current study, an apta-qPCR assay is developed to detect wide range of α-toxin amounts.

2-1- Bacterial strains and Materials

Escherichia coli DH5α and BL21 (DE3) strains were procured from Iranian Research Organization for Science and Technology (IROST). M9 minimal medium, ampicillin, complete and incomplete Freund’s adjuvant were purchased from Sigma-Aldrich, USA. Isopropyl β-D-1-thiogalactopyranoside (IPTG) was obtained from Thermo Fisher Science. Agarose, 100 bp DNA ladder and prestained protein marker were acquired from SinaClon, Iran. Bacterial Plasmid DNA Purification Kit was purchased from Intron Company, Korea. Single-stranded DNA aptamer against Alpha toxin and non-biotinylated primers were commercially synthesized from Metabion Company, Germany (Table 1 illustrates all synthesized aptamer and primer sequences). The S. aureus alpha toxin gene including L-asparaginase II signal peptide (ASP) at the N-terminus was synthesized by Biomatik®, Canada into pET21a expression vector. SYBR® Green master mix and Taq PCR master Mix were purchased from Ampliqon, Denmark. BALB/c mice (6–8 week old) were obtained from BMSU, Iran. All other reagents were of analytical grade.

Samples	Sequences	Ref
Aptamer	TGTACCGTCTGAGCGATTCGTACGATTACTATAATTTCCTATCGTCCGACCGCCGTCAGCCAGTCAGTGTTAAGGAGTGC	(9)
Forward primer	TGTACCGTCTGAGCGATTCG
Forward Biotin primer	5ˊ-biotin- TGTACCGTCTGAGCGATTCG
Reverse Primer	GCACTCCTTAACACTGAC

2-2- Design of secretory recombinant alpha toxin

To secret the recombinant alpha toxin into extracellular medium the signal peptide of alpha toxin was replaced by L-asparaginase II signal peptide (ASP). The sequences of S. aureus alpha toxin and ASP were obtained from the National Centre for Biotechnology Information. The codon optimization was performed based on codon usage of E. coli. The recombinant alpha toxin cloned into pET21a expression vector by restriction sites enzymes NdeI and BamHI at the 5' and the 3' sites respectively.

2-3- Expression and purification of recombinant alpha toxins

The pET21a plasmid harboring the synthetic gene was transformed into competent E coli BL21 (DE3) with calcium chloride heat-shock protocol (17).

A single colony of bacterium containing pET21-ASP-alpha toxin was scratched and grown in M9 minimal medium broth supplemented with 100 µg/mL ampicillin. Expression of the recombinant protein was induced at OD₆₀₀ of 0.5 by addition of 1 mM IPTG. The bacterial cells were pelleted after O/N (16 h) and the culture medium was concentrated, followed by sodium dodecyl sulfate polyacrylamide gel electrophoresis (SDS-PAGE) analysis.

The secreted toxin has no tag (e. g. poly 6X His) to be employed for purification as well as western blotting confirmation. Hence, the gene without ASP was also cloned into the pET28a plasmid. The plasmid was transformed into competent E coli BL21 (DE3); then, the transformed host was grown in LB broth supplemented with 50 µg/mL kanamycin. The recombinant protein expression was induced at OD₆₀₀ of 0.5 by 1 mM IPTG. The bacterial cells were harvested after 16 h by centrifugation. The cells suspended in denaturing buffer (7 M urea; 0.1 M NaH2PO4; 0.01 M Tris·Cl; pH 8.0) and then were sonicated (70% amplitude, 60% cycle duty (30 s pulse rate) for 10 times with a 10 s cooling period between each burst. The cellular debris was then precipitated by centrifuging the lysate at full speed for 20 minutes at 4°C. Ni–NTA affinity chromatography (Qiagen) was used to purify the recombinant protein. The 1 ml of separated supernatant was loaded onto a 1 ml Ni–NTA agarose column, pre equilibrated with 5ml denaturing buffer. A step-by-step protocol was employed to elute the protein, employing buffers containing 5 times x 1 ml x 20 mM imidazole and 3 times x 0.5 ml x 250 mM imidazole, followed by 1 times x 1 ml of 20 mM MES (2-N-morpholinoethanesulfonic acid) buffer. The purified protein was monitored on 12% SDS-PAGE.

2–4 Mice immunization

The animals were housed and treated in compliance with regulations of the International Council on Animal Care. The purified poly His (6X) tagged-alpha toxin (20 µg) was subcutaneously injected to 6–8 week-old BALB/c mice. In the first injection, complete Freund’s adjuvant was used while in the 3 boosters (with 2 weeks intervals) incomplete Freund’s adjuvant served. The control group was received PBS and adjuvant.

2-5- IgG antibody assay

Two week after the final injection, the blood samples were taken from the retro-orbital of the mice. The antigen-specific antibody responses were determined by an indirect enzyme linked immune sorbent assay (ELISA). Each well of the polystyrene ELISA plate was coated with the 2 µg of the alpha toxin protein diluted in the coating buffer (64mM Na₂CO₃, 136 mM NaHCO₃, pH 9.8). The wells were washed trice with PBS containing 0.1% Tween 20 (PBST). The nonspecific binding site was blocked with 5% skim milk in PBST incubated 2 h at 37°C. The washing procedure was repeated. Then the sera samples with dilution 1:500 to 512000 were added to the plate followed by incubation at 37°C for 1 h. The washing procedure was repeated. Afterward, HRP-conjugated goat anti-mouse IgG with 1:4000 dilution was added to all wells (incubation at 37°C for 1 h was performed). The washing procedure was repeated. The 3,3′,5,5′-Tetramethylbenzidine (TMB) substrate was added to each well to develop color. The reaction was stopped with 2 M H₂SO₄ and the color assay was measured at 450 nm using an ELISA microplate reader (Bio-Rad, Hercules, CA, USA).

2-6- purification of IgG antibody

The purification of the IgG mouse antibody was carried out by Protein G sepharose bead affinity chromatography.

The Protein G sepharose beads were washed 3 times by 3 fold of volume the beads with 100 mM Tris-HCl and 10 mM Tris-Hcl pH = 8, respectively. Then, the mouse sera were added to Protein G sepharose beads. The unbound proteins were washed three times with 1 mL of 10 mM Tris-Hcl pH = 8. The IgG protein was eluted by Glycine buffer (100 mM, pH = 3). The purified IgG was evaluated by SDS-PAGE. The purified IgG antibody could serve for the western blotting assay as well as the toxin capturing in the apta-qPCR method.

2-7- Western blot analysis

The validation of the secreted protein that expressed as native form was carried out by western blot analysis. Forasmuch as the pET21 expression vector has not His tag, western blot was carried out with the using of the primary antibody obtained from immunized sera. In this regard, 100 ng of the ASN–alpha toxin was migrated from the SDS-PAGE 12% gel to nitrocellulose membrane with running buffer for 2 h at 10 V. After blocking with 5% skim milk for 1 h at room temperature, the membrane was washed trice after which incubated with appropriate dilution of antibodies which achieved from BALB/c mouse as primary antibodies (1/500). Then the desired protein was visualized using secondary HRP-conjugated antibodies (1/1000 for 1 h at room temperature) and detection reagent (DAB).

2-8- Preparation of antibody-conjugated protein G protein in ELISA plates and detection of alpha toxin by using real-time PCR

For capturing of alpha toxin from spiked serum samples a plate of ELISA was designed. Briefly, Protein G (1 µg/µl) prepared in coating buffer (pH 9.6) was added to each well of a polystyrene plates (100 µL/well) and incubated for 2 h at 37°C or O/N at 4°C. Then the wells were washed with 200 µL of PBST for 5 Times. Following the washing the purified antibody (2 µg/µl) was added to each wells and incubated for 1 h at 37°C. Afterward the wells were washed with 200 µL of PBST for 5 Times. After that alpha protein were spiked to serum in various concentrations (300. 250, 150, 100, 50, 5 and 0.5 ng/µl) and they was added to wells. Also for determination of aptamer specificity, 100 ng/µl of staphylococcal enterotoxin A (SEA), staphylococcal enterotoxin B, Pseudomonas exotoxin A (PE) and BSA was added to another wells and incubated for 2 h at 37°C. Such as pervious steps each well was washed for 5 times with PBST. Then 100 µl of 100 nM aptamer (optimum concentration) was added to each wells and incubated at 37°C under shaking (120 rpm) for 1 h, the mixture was removed by centrifugation at 13,000 rpm for 1 min and Protein G- AB- alpha toxin -Aptamer complex was washed three times with 500 µl of 10 mM Tris-HCl pH8. The bound aptamer was then heat-eluted in 50 µl of ultrapure water for 20 minutes at 95°C. Finally, 3 µl of the eluted aptamer was amplified with Taq DNA polymerase in the presence of a SYBR® Green master mix by using real-time PCR. The amplification was carried out in a Rotor-Gene 6000 instrument (Corbett Life Science, USA), and programmed according to the following protocol: 3 minute at 95°C, then 45 repetitions of 30 seconds at 95°C, 30 seconds at 54°C, and 30 seconds at 72°C. Finally, high-resolution melting (HRM) was evaluated.

2-9- Statistical analysis

SPSS 21.0 statistical software was used for all statistical analyses. The Student t-test was used to compare antibody responses between immunized and non-immunized groups. A statistically significant p-value of 0.05 was used.

3-1- Design of secretory recombinant alpha toxin

Figure 1. A scheme of conceptual project to set up apta-qPCR for detection of alpha toxin. 1) Production of recombinant alpha toxin. 2) Mice immunization and purification of anti-body 3) Preparation of antibody-conjugated protein G protein in ELISA plates and 4) detection of alpha toxin by using real-time PCR. The figure was generated by BioRender.com

The amino acid (AA) sequences of ASP and S. aureus alpha toxin were retrieved from online gene banks with number M34277.1 and X01645.1, respectively. For the secretion of the gene into extracellular media, the ASP sequences were substituted at the 5' site of the alpha toxin signal peptide (Fig. 2). The codon optimization and subcloning into pET-21a expression vector were performed by Biomatik®, Canada.

3-2- Expression and western blot analysis

The alpha toxin was successfully expressed in extracellular media after transformation of recombinant plasmid (pET21a-alpha toxin-ASP) into E coli Bl21 (DE3). SDS-PAGE revealed that the apparent molecular mass of the expressed toxin was approximately 33 kDa (Fig. 3A). Western blotting was used to confirm the expression of alpha toxin. Briefly, the SDS page gel was transferred onto the PVDF membrane after electrophoresis of culture media on 12% gel, and it was affected by the specific primary and secondary antibodies. After the staining process, results are displayed in Fig. 3B.

3-3- Quantification and purification of IgG antibody

Immunized mice with alpha toxin protein showed significant Hla-specific IgG antibodies (Fig. 4A). Compared to control antisera, the anti-Hla IgG antibody titer was shown to be significantly high (p < 0.05), diluted 1/5120000. The Fc region of IgG antibody is the high affinity to protein G (derived from groups C and G Streptococci). In this study Protein G Sepharose CL-4B has been used as a powerful tool to isolate and purify of IgG from the mouse serum. The antibody adsorption was carried out on protein G-Sepharose at pH 8.0 and it was eluted at pH 5.8. Figure 4B show that the purified antibody on the SDS page with and without 2ME in the sample buffer.

3-4- Detection of alpha toxin by using apta-qPCR

After preparation of antibody-conjugated protein G protein in ELISA plates for capturing of alpha toxin from spiked serum samples the apta-qPCR was done. Then, the complex of Protein G-Ab-Hla was incubated with alpha toxin specific aptamers for a sandwich binding of aptamers onto captured toxin. The aptamers bound to toxin were released from the Protein G-Ab–Hla complex by heating, and the released aptamers were quantified by real-time PCR. In this experiment, the fluorescent signal of 0.01 was obtained after the threshold cycle (C_T), which is a measure of alpha toxin concentration. Figure 5A and B show that, this method can be detected alpha toxin between 300 to 0.5 ng/mL of without any cross reactivity with other toxins. Finally, High Resolution Melting (HRM) analysis was not different in PCR melting (dissociation) curves which shows that the all curves are the same (Fig. 5C).

3-5- Reproducibility and Repeatability precision

Reproducibility and Repeatability Precision data (on quantitation basis and CT value basis) were obtained by the analysis of the lowest quantitation of negative serum sample that spiked with 0.5 ng/ml of the alpha toxin. All test was performed in at least 3 replicated on multiple days. The resulting data contain the standard deviation, variance and coefficient of variation (CV %) show in Table 1.

Table 1

Intra and Inter assay of apta-qPCR test
Alpha toxin (0.5 ng/ml)	Standard deviation	Variance	CV %
Intra assay	0.27	0.08	0.84
Inter assay	0.35	0.10	1.06

Alpha toxin is an important virulence factor produced by most strains of S. aureus and is conserved among diverse clinical isolates (7). Hence, detection of this toxin via various methods had been considered by several researchers (9, 16, 18, 19). Several methods and approaches had been investigated to introduce an appropriate diagnostic tool for alpha toxin (9, 16, 18, 19). A sandwich ELISA had been developed for alpha toxin detection in which specific IgYs served as capture antibody with no staphylococcal protein A interference (18). Although high sensitivity (< 1 ng/mL) and specificity was achieved by this immunoassay (18), the batch-to-batch variation of antibodies including IgYs could hinder its standardization. This shortcoming could be intensified when commercial laying hens are employed. Reactivity of IgYs obtained from commercial eggs or control group of hens (non-immunized) with specific antigens has been reported (20–23). In addition, obtaining of purified specific IgYs is cost- and time-consuming process in comparison to specific aptamers. DNA aptamers could address the limitations of polyclonal antibodies in detection of alpha toxin. Longer half-life, fast development, animal/cell free production, ease of scale-up and purification, affordability and high specificity comparable to monoclonal antibodies are among advantages of aptamers (24, 25).

A single strand DNA aptamer had been introduced with average Kd (equilibrium dissociation constant) of 93.7 ± 7.0 nM. This aptamer served as a capture molecule in a modified sandwich ELISA to detect alpha toxin in human serum samples (9). The designed sandwich ELISA was evaluated and validated for detection of 200 nM alpha toxin (9). However, the developed ELISA had not been assessed to detect toxic concentration of alpha-toxin in the blood (3-7.5 nM, 100–250 ng/mL). Moreover, owing to the presence of exonucleases, average half-life of ssDNA is about one hour in serum. The ssDNA is exposed to serum if it serves as a capture molecule. In our current study, the alpha toxin was detected in concentration of 0.5 to 300 ng/mL in which limit of detection (LOD) is < 0.5 ng/mL. In addition to decreasing LOD, the developed method could detect toxic concentration of alpha-toxin in the blood. Moreover, the ssDNA served as a detector molecule which added after serum sample addition and washing step. So, it is not exposed to exonucleases of serum.

Recently, a surface plasmon resonance (SPR) biosensor has been developed based on molecular imprinting method to detect alpha toxin in human sera. In this biosensor, non-conjugated polyclonal rabbit anti-alpha toxin antibodies was used. The K_D and LOD values of the developed biosensor were 2.75 × 10^− 7 M and 0.022 µM respectively (19).

More recently, an electrochemical sensor was developed by our team to detect alpha toxin in which the current aptamer has been used as a detector molecule. The LOD and linear range of the sensor were 1.0 nM and 3.0–250.0 nM, respectively (16).

Although the developed biosensors could detect toxic concentration of alpha-toxin in the blood (3-7.5 nM, 100–250 ng/mL), these are not considered as a routine and golden test in a diagnostic laboratory.

Although the introduced ssDNA developed for a standard alpha toxin, in the current study, a recombinant mature one was also detected by this aptamer which is implying the recombinant mature toxin is similar to the native one. High level expression of recombinant proteins in E. coli could form insoluble aggregates as inclusion bodies. Concerns about correct folding of the recombinant proteins encourage researchers to try secret the expressed proteins to the medium (26). This strategy possesses several advantages in comparison to overexpression as inclusion bodies. Since, no cell disruption is needed for purification, host protein contaminations could be avoided. Moreover, using minimal medium (M9) which only contains mineral salt and glucose, medium-associated protein/peptide contamination is omitted (27). In addition, native structure of the protein would be obtained with no refolding process (28). These issues could reduce downstream costs and subsequently final product. However, the E. coli bacterium does not routinely secrete proteins to the culture medium and for this purpose, the signal peptides should be added to the recombinant protein. One of the appropriate signal peptides for the secretion of recombinant protein to the medium is E coli L-asparaginase II Sec-type signal peptide (ASP) (29).

In conclusion, the sensitivity of the specific ssDNA aptamer was improved by the current developed apta-qPCR. It could detect toxic concentration of alpha-toxin in the blood with LOD of < 0.5 ng/mL. In addition, the developed apta-qPCR is highly specific for alpha-toxin since none of the staphylococcal enterotoxins were detected by this method.

Author Contribution

A.J, S.D, MM and H.S wrote the main manuscript text. E.M and R.H analysis the test and A.J and H.S revised the manuscript

Suaifan GA, Alhogail S, Zourob M (2017) Rapid and low-cost biosensor for the detection of Staphylococcus aureus. Biosens Bioelectron 90:230–237
Reich P, Stoltenburg R, Strehlitz B, Frense D, Beckmann D (2017) Development of an Impedimetric Aptasensor for the Detection of Staphylococcus aureus. Int J Mol Sci 18(11):2484
Otto M (2014) Staphylococcus aureus toxins. Curr Opin Microbiol 17:32–37
Oliveira D, Borges A, Simões M (2018) Staphylococcus aureus toxins and their molecular activity in infectious diseases. Toxins 10(6):252
Seilie ES, Bubeck Wardenburg J (2017) Staphylococcus aureus pore-forming toxins: The interface of pathogen and host complexity. Seminars Cell Dev Biology 72:101–116
Menzies BE, Kourteva I (2000) Staphylococcus aureus α-toxin induces apoptosis in endothelial cells. FEMS Immunol Med Microbiol 29(1):39–45
Ahmad-Mansour N, Loubet P, Pouget C, Dunyach-Remy C, Sotto A, Lavigne J-P et al (2021) Staphylococcus aureus toxins: an update on their pathogenic properties and potential treatments. Toxins 13(10):677
Modh H, Scheper T, Walter JG (2017) Detection of ochratoxin A by aptamer-assisted real‐time PCR‐based assay (Apta‐qPCR). Eng Life Sci 17(8):923–930
Hong KL, Battistella L, Salva AD, Williams RM, Sooter LJ (2015) In vitro selection of single-stranded DNA molecular recognition elements against S. aureus alpha toxin and sensitive detection in human serum. Int J Mol Sci 16(2):2794–2809
Jing M, Bowser MT (2011) Methods for measuring aptamer-protein equilibria: a review. Anal Chim Acta 686(1–2):9–18
Deng B, Lin Y, Wang C, Li F, Wang Z, Zhang H et al (2014) Aptamer binding assays for proteins: the thrombin example—a review. Anal Chim Acta 837:1–15
Wang L, Wang R, Wang H, Slavik M, Wei H, Li Y (2017) An aptamer-based PCR method coupled with magnetic immunoseparation for sensitive detection of Salmonella Typhimurium in ground turkey. Anal Biochem 533:34–40
Modh H, Witt M, Urmann K, Lavrentieva A, Segal E, Scheper T et al (2017) Aptamer-based detection of adenosine triphosphate via qPCR. Talanta 172:199–205
Zhuo Z, Yu Y, Wang M, Li J, Zhang Z, Liu J et al (2017) Recent advances in SELEX technology and aptamer applications in biomedicine. Int J Mol Sci 18(10):2142
Sedighian H, Halabian R, Amani J, Heiat M, Amin M, Fooladi AAI (2018) Staggered Target SELEX, a novel approach to isolate non-cross-reactive aptamer for detection of SEA by apta-qPCR. J Biotechnol 286:45–55
Vakyly S, Sedighian H, Jahromi Z, Jahangiri A, Halabian R, Rezaei A et al (2022) A sensitive and selective electrochemical sensor based on gold nanoparticle/multi-walled carbon nanotubes for detection of Staphylococcus aureus Alpha-toxin. Appl Phys A 128(8):680
Rad HS, Mousavi SL, Rasooli I, Amani J, Nadooshan MRJ (2013) EspA-Intimin chimeric protein, a candidate vaccine against Escherichia coli O157: H7. Iran J Microbiol 5(3):244
Reddy PK, Shekar A, Kingston JJ, Sripathy MH, Batra H (2013) Evaluation of IgY capture ELISA for sensitive detection of Alpha hemolysin of Staphylococcus aureus without staphylococcal protein A interference. J Immunol Methods 391(1–2):31–38
Andersson T, Bläckberg A, Lood R, Ertürk Bergdahl G (2020) Development of a molecular imprinting-based surface plasmon resonance biosensor for rapid and sensitive detection of Staphylococcus aureus alpha hemolysin from human serum. Front Cell Infect Microbiol 10:571578
Shaygankho N, Jahangiri A, Rasooli I (2023) Passive immunization with anti-FimA egg yolk antibodies (IgYs) mitigate Acinetobacter baumannii pneumonia in mice. Biomed Pharmacother 167:115583
Ranjbar A, Rasooli I, Jahangiri A, Ramezanalizadeh F (2022) Specific egg yolk antibody raised to biofilm associated protein (Bap) is protective against murine pneumonia caused by Acinetobacter baumannii. Sci Rep 12(1):12576
Moghaddam MM, Rasooli I, Ghaini MH, Jahangiri A, Ramezanalizadeh F, Tootkleh RG (2022) Immunoprotective characterization of egg yolk immunoglobulin raised to loop 3 of outer membrane protein 34 (Omp34) in a murine model against Acinetobacter baumannii. Mol Immunol 149:87–93
Jahangiri A, Owlia P, Rasooli I, Salimian J, Derakhshanifar E, Aghajani Z et al (2021) Specific egg yolk immunoglobulin as a promising non-antibiotic biotherapeutic product against Acinetobacter baumannii pneumonia infection. Sci Rep 11(1):1–11
Shaban SM, Kim D-H (2021) Recent advances in aptamer sensors. Sensors 21(3):979
Yoo H, Jo H, Oh SS (2020) Detection and beyond: Challenges and advances in aptamer-based biosensors. Mater Adv 1(8):2663–2687
Mergulhão F, Summers DK, Monteiro GA (2005) Recombinant protein secretion in Escherichia coli. Biotechnol Adv 23(3):177–202
Ojima Y, Sawabe T, Konami K, Azuma M (2020) Construction of hypervesiculation Escherichia coli strains and application for secretory protein production. Biotechnol Bioeng 117(3):701–709
Ismail NF, Hamdan S, Mahadi NM, Murad AMA, Rabu A, Bakar FDA et al (2011) A mutant L-asparaginase II signal peptide improves the secretion of recombinant cyclodextrin glucanotransferase and the viability of Escherichia coli. Biotechnol Lett 33:999–1005
Mahboobi M, Salmanian A-H, Sedighian H, Bambai B (2023) Molecular Modeling and Optimization of Type II E. coli l-Asparginase Activity by in silico Design and in vitro Site-directed Mutagenesis. Protein J 42(6):664–674

No competing interests reported.

Download PDF

Version 1

posted

You are reading this latest preprint version

Highly sensitive detection of Staphylococcus aureus α-Hemolysin protein (Hla or α-toxin) by Apta-qPCR

Status:

Version 1

Abstract

Figures

Introduction

Material and methods

2-1- Bacterial strains and Materials

2-2- Design of secretory recombinant alpha toxin

2-3- Expression and purification of recombinant alpha toxins

2–4 Mice immunization

2-5- IgG antibody assay

2-6- purification of IgG antibody

2-7- Western blot analysis

2-9- Statistical analysis

Results

3-1- Design of secretory recombinant alpha toxin

3-2- Expression and western blot analysis

3-3- Quantification and purification of IgG antibody

3-4- Detection of alpha toxin by using apta-qPCR

3-5- Reproducibility and Repeatability precision

Discussion

Declarations

Author Contribution

References

Additional Declarations

Status:

Version 1