Animals
Male inbred C57BL/6 mice aging 6–8 weeks were used for the experiment. The transgenic calpastatin-overexpression mouse strain (Tg-CAST) was provided by the laboratory of Tianqing PENG (Lawson Health Research Institute, Canada)[24] and was bred in the Department of Laboratory Animal Science, Fudan University in an SPF environment. All animal experiments were approved by the Ethics Review Board for Animal Studies of Shanghai Jiao Tong University School of Medicine (approval no. SYKX-2008-0050; Shanghai, China) and were conducted in strict accordance with the Guide for the Care and Use of Laboratory Animals published by the US National Institutes of Health (NIH Publication, 8th Edition, 2011).
Induction of Diabetes and Experimental Protocol
Diabetes was induced in overnight fasted mice by administering a single intraperitoneal (i.p.) injection of 50 mg/kg streptozotocin (STZ) freshly dissolved in 0.1 mol/L sodium citrate buffer (pH 4.5). The mice in the control group were injected with a similar volume (100 μl) of sodium citrate buffer alone. The mice whose fasting blood glucose level was more than 16.7 mmol/L after five days of injection were diabetic (Supplementary material Table 1). All mice were fed for one month. Furthermore, Diabetic cardiomyopathy mice were excluded by cardiac ultrasound, and diabetic mice with normal heart function (the indexes of myocardial function have no obvious difference with the sham group) were randomized to different groups.
Identification of transgenic mice
All Tg-CAST littermates were genotyped by DNA electrophoresis following the protocol of PENG's lab as previously described[19].
Ischemia/reperfusion model establishment
Animals were randomly divided into sham operation groups and I/R operation groups for the following interventions. Mice were anesthetized with 2% isoflurane inhalation with an isoflurane delivery system (Viking Medical, Medford, NJ) without ventilation. Then we made a 1 cm incision in the left fourth intercostal space. The left coronary artery (LCA) was ligated (no ligation for sham operation groups) for 30 min followed by 12h of reperfusion as previously described[19]. At the indicated time points, the mice were sacrificed by cervical dislocation, and the hearts were immediately extracted for further analysis.
Myocardial infarct size measurement
Myocardial infarct size was measured using Evans blue (Sigma,USA, 17779,E2129) and 2, 3, 5-triphenyl tetrazolium chloride (TTC) staining as previously described[19].
Echocardiography
Echocardiography was conducted by M-mode echocardiography using a Philips IE33 instrument (Philips Medical Systems Corporation, Andover, MA, USA) with a 1-5 MHz transducer (S5-1), under the instruction of the guideline. Two-dimensional guided M-mode measurements of the LV internal diameter were obtained from the short-axis view at the level of the papillary muscles over at least three beats and were averaged. Computer algorithms were used to count left ventricular ejection fraction (LVEF), LV end-systolic dimension (LVESD), left ventricular fraction shortening (LVFS), and LV end-diastolic dimension (LVEDD) (Supplementary material table 2).
Serum cTnI detection
Serum cTnI level was detected by an Elisa kit (ab188877, Abcam) following the manufacturer's instructions to evaluate myocardial I/R injury.
Cardiomyocyte culture and induction of Hypoxia/reoxygenation (H/R) based on high- glucose (HG).
Neonatal mouse (1 days old, Department of Laboratory Animal Science, Fudan University) ventricular cardiomyocytes were isolated as previously described with a few modifications[19]. In brief, the hearts of neonatal mice were isolated surgically, and the ventricles were enzymatically digested in 0.08% collagenase II for 8 min in an automatic heat regulator at 37 °C. After centrifugation and resuspension, cells were preplaced for 2 h in Dulbecco’s-modified Eagle’s medium (DMEM) supplemented with 10% fetal bovine serum (Gibco) to reduce fibroblasts, then plated in culture dishes and incubated at 37 °C in a 5% CO2 incubator. DMEM with glucose concentration of 5.5mmol/L was taken as the control group (NG) and 33mmol/L as the HG group, and the cells were treated for 48h. Then, to mimic the I/R injury, myocytes were treated with hypoxia/reoxygenation(H/R). Briefly, the isolated myocardial cells, adhered to the well with normal pulsation, were moved to a hypoxia incubator (1% O2, 94% N2 and 5% CO2) for 12 h, followed by reoxygenation in normoxic conditions for 3h at 37 ºC.
Cardiomyocyte viability assay
Cultured cardiomyocyte viability was assessed by Cell Counting Kit-8 (C0038, Beyotime Biotechnology, China) as previously described[19].
Cell death measurement
Cardiomyocyte death was measured by annexin V-FITC. The Annexin V-FITC Apoptosis Detection Kit microscopy (C1062, Beyotime Biotechnology, China) was applied under the manufacturer’s instructions for apoptosis detection. In the early stages of apoptosis, cells were Annexin V-positive, while cells that were both PI- and Annexin V-positive were at the later stages whereas cells that were only PI-positive were necrotic.
To localize and evaluate quantitatively cells undergoing apoptosis in the cardiomyocytes, in situ terminal deoxynucleotidyl transferase-mediated dUTP nick-end labelling (TUNEL) was performed using an in-situ apoptosis detection kit (C1098, Beyotime Biotechnology, China). We carried out our experiment in accordance with the instructions.
Western blot analysis
The area of I/R injury in the heart was collected in an EP tube with RIPA protein lysis buffer containing protease inhibitors. Protein concentrations were measured with a BCA assay kit (P0010, Beyotime Biotechnology, China). The protein obtained above was separated by 10-15% SDS-PAGE and then transferred onto a polyvinylidene difluoride (PVDF, Millipore, USA) membrane, placed in 5% BSA containing TBST at room temperature for 1h and then incubated overnight at 4°C with primary antibody diluted in TBST with 5% BSA. Primary antibodies include: LC3 (1:1000, 4108, CST), SQSTM1/P62 (1:1000, 23214, CST), calpain1(1:1000, 2556, CST), calpain2(1:1000, 2539, CST), Beclin-1 (1:1000, 3495, CST), ATG5(1:1000, 2630, CST), LAMP2(1:1000, ab13524, Abcam). The PVDF membranes were washed and then incubated with HRP-conjugated secondary antibodies at room temperature for 1h. GAPDH (1:10,000, 5174, CST) were used as the internal control. An ECL-HRP chemiluminescence kit (34577, Thermo Fisher, USA) was used to visualize the bands which were quantified by Image Lab Software (Bio-Rad, USA). All samples were analyzed in triplicate with a multilabel reader (excitation, 360 nm; emission, 460 nm, Thermo, America).
IHC staining
Heart tissues were embedded in paraffin and cut into 10μm slices. Each slice was deparaffinized using xylene and an ethanol gradient. Antigen retrieval was performed by boiling in 10 mM citrate buffer for 10 min and cooling for 30 min. Endogenous peroxidase activity was quenched with 3% H2O2 for 10 min, and the slices then were washed three times in PBS for 2 min. 1% goat serum was used to block nonspecific binding. The slices were incubated at 4 °C overnight with a 1 : 50 dilution of anti-LC3II or SQSTM1/P62 antibody, and then were washed two times in PBS for 5 min. The samples were incubated with a biotinylated goat anti-rabbit secondary antibody (1:200, ab150077, Abcam) for 45 min. The samples were added tri-antibody (SAB complex) for 40min. The samples were observed by DAB chromogenic method, and certain brown strength was taken as positive.
Measurement of LDH level
The cell culture medium was collected after various treatments to measure the LDH levels using an LDH kit (C0016, Beyotime Biotechnology, China;) according to the manufacturer’s instructions.
Calpain activity detection
A fluorometric calpain activity assay kit ((ab65308, Abcam) was used to quantify calpain activity. In simple terms, the lysates of myocardial cells or heart tissue were centrifuged, and the supernatant was used to detect calpain activity using the fluorescent substrate N-succinyl-LLVY-AMC. All samples were analyzed in triplicate with a multilabel reader (excitation, 360 nm; emission, 460 nm, Thermo, America) and expressed as relative fluorescent units (RFU).
Quantitative real-time reverse transcription PCR (qRT-PCR)
Total RNAs were extracted from primary cardiomyocytes using Trizol Reagent (Invitrogen, USA; 15596018). 500 ng RNA per sample was used for reverse transcription and qRT-PCR assay. The qRT-PCRs were performed using SYBR Premix Ex Taq (TaKaRa, Japan; Cat. No. RR420A) according to the manufacturer’s instructions on an ABI Prism 7500 Real-Time PCR System (Applied Biosystems, Foster City, CA, USA). β-actin was used as internal control. The data were analyzed by using comparative CT method. The primers used in this study for qRT-PCR were as follows:
β-actin
Forward: 5’-AGAGCCTCGCCTTTGCCGAT-3’
Reverse: 5’- TGCCAGATTTTCTCCATGTCGT -3’
ATG5
Forward: 5’-GGACCTTCTACACTGTCCATCC-3’
Reverse: 5’-TGTCATTCTGCAGTCCCATC-3’
LAMP2
Forward: 5′-CTAGGAGCCGTTCAGTCCAA-3′
Reverse: 5′-CTTGCAGGTGAATACCCCAA-3′
Adenoviral infection
In order to overexpress ATG5 and LAMP2, Ad-vector, Ad-ATG5 and Ad-LAMP2 were synthesized by HanBio, China. Cardiomyocytes were infected with each of the three adenoviruses. An empty adenovirus (Ad-vector) served as a control at a multiplicity of infection of 100 PFU/cell. The specific methods are as follows: cells were plated in DMEM with 10% fetal bovine serum at a density of 5*105/ml. 48 hours after plating, serum was removed and the cells were infected with recombinant adenovirus. 6 hours later, the culture medium containing 10% serum was added and incubated another 48-72 hours cells. Successful transfection was verified by WB-analysis (Supplementary1 A, B). For in vivo studies, adenoviruses are expressed in the heart by myocardial in situ injection at a titer of 4×1010 PFU/ mice. Exposing the mouse heart (the method is same as the establishment of I/R model), 10 μl viral suspension were injected into the myocardium at four points around the heart's coronary arteries by using a microsyringe. After 3 days, mice were subjected to I/R (Supplementary1 D, E).
Statistical analysis
All statistical tests were analyzed with GraphPad Prism 6.02. All data were expressed as means ± SD. Statistical comparisons were conducted using Student’s t-test (for comparisons between two groups) or a one-way analysis of variance (ANOVA, for comparisons of three or more groups) followed by the Bonferroni post-hoc test. P < 0.05 was considered statistically significant.