Isolation of primary CAFs and cell culture
Tumour tissues were obtained from PCa patients treated by radical prostatectomy at the Department of Urology, Shanghai General Hospital, Shanghai Jiao Tong University, School of Medicine. As previously described [21], primary CAFs were isolated from PCa tissues. In this study, we obtained three sets of primary CAFs from three patients, they did not receive any therapy before radical prostatectomy and their characteristics are shown in Additional file 3: Figure S3. All primary CAFs between passages 2 and 10 were used for all experiments. CAF markers including Vimentin, FAP, and α-SMA were determined by immunofluorescence. Androgen deprived prostate tissues were required in radical prostatectomy from patients treated for a long-term period (3-6 months) with abiraterone and leuprolide.
hTERT PF179T CAF were acquired from American Type Culture Collection (ATCC, VA, USA, Cat# CRL-3290), and HEK 293T, LNCaP, and DU145 were acquired from Cell Bank of Shanghai Institute of Cells, Chinese Academy of Science (Shanghai, China). The prostate cell lines were authenticated (GENEWIZ, Suzhou, China). Cells were incubated in the suitable medium (RPMI-1640 for LNCaP, DU145; DMEM for CAFs and 293T) supplemented with 10% fetal bovine serum (FBS), 1% penicillin/streptomycin. All cells were cultured at 37°C with 5% CO2.
Plasmid construction, lentivirus packaging, and cell transfection
Lentiviral plasmids encoding miR-146a-5p or negative control and lentivirus were obtained from Genomeditech (Shanghai, China). To create miR-146a-5p overexpressing LNCaP and DU145 cell lines, we transfected cells with lentivirus according to the manufacturer's instructions and selected stable cell lines with puromycin.
miR-146a-5p mimic and miR-146a-5p negative-control were purified by RiboBio (Guangzhou, China). The sequences of mimics are as follows: miR-146a-5p mimics: sense: 5’UGAGAACUGAAUUCCAUGGGUU3’, antisense: 5’AACCCAUGGAAUUCAGUUCUCA3’. MiR-NC mimics: sense: 5’UUUGUACUACACAAAAGUACUG3’, antisense: 5’CAGUACUUUUGUGUAGUACAAA3’. EFGR overexpression vector and negative-control plasmids were purchased from Youbio (Changsha, China). Transfections of miRNAs or plasmids were carried out using Lipofectamine 3000 transfection reagent (Invitrogen/Thermo Fisher Scientific) following the manufacturer's protocol.
Exosomes isolation and characterization
Androgen receptor (AR) signalling in CAFs was activated by adding dihydrotestosterone (DHT, ApexBio Technology, Houston, USA) to 10% charcoal - stripped FBS (CSFBS) DMEM medium at 10 nM [10]. CAFs were pretreated with 10% CSFBS DMEM medium for 24 h in advance, then CAFs were incubated with freshly medium with 10 nM DHT (simulating the high androgen level of prostate cancer microenvironment) or ethanol (simulating the castration level of prostate cancer microenvironment after ADT) for 48 h. After exposure, CAFs were washed using PBS and cultured in complete medium containing exosome-free CSFBS with 10 nM DHT or ethanol (ETOH) for another 48 h. Exosomes were collected from supernatants of primary CAFs and isolated by ultracentrifugation as previously described [22]; however, we made some modifications. Briefly, cell culture supernatants were gathered and centrifuged at 300g for 10 min, 2000 ×g for 10 min and 10,000 ×g for 30 min. Then, we filtered the supernatants through 0.22 μm filters (Millipore, USA) and ultracentrifuged at 100,000 ×g for 70 min at 4 °C [23]. After removing the cell supernatants, we resuspended the pellets with ice-cold PBS. Next, we ultracentrifuged the suspension at 100,000 ×g for another 70 min at 4 °C. Finally, we resuspended exosomes in PBS and stored at −80 °C. We used GW4869 (Sigma Aldrich, St. Louis, USA) to inhibit exosome release at a concentration of 20 μM. We used BCA methods to measure the concentration of exosomes. Exosomes were observed using transmission electron microscopy and identified by the expression of TSG101 and CD81, which are positive exosome markers. We also detected the concentration and hydrodynamic diameter of exosomes through a NanoSight NS300 Nanoparticle Tracking Analyzer (NTA; Malvern Instruments Ltd, UK) equipped with NTA 3·0 analytical software. Nanoparticle Tracking Analyzer is designed to obtain the particle size distribution of the sample in the liquid suspension by using the characteristics of light scattering and Brownian motion. At present, NTA has been recognized as one of the means of determining exosomes characterization in the field of exosomes research [24, 25].
Immunofluorescence
Cells grown on cover slips were fixed with 4% paraformaldehyde for 15min at 25°C, treated with 0.1% Triton X-100 for 5 min at 4℃, blocked in 5% donkey serum for two hours at room temperature, and incubated with primary antibodies against α-SMA (Abcam, Cambridge, MA, USA, Cat# ab7817), Vimentin (Abcam, Cat# ab92547), FAP (Abcam, Cat# ab53066) at 4 °C overnight. After that, cells were incubated with an Alexa Fluor 488-conjugated antibodies (Abcam, Cat# ab150109) or an Alexa Fluor 647-conjugated antibodies (Abcam, Cat# ab150075) for 30 min at 25°C in the dark, and we treated the slips with 4′,6-diamidino-2-phenylindole (DAPI; Invitrogen, USA) to detect cell nuclei. Cells were observed and pictures were taken by a fluorescence microscope (Leica Microsystems, Germany).
Western blot analysis
Total proteins were prepared, and western blot analysis was performed as previously described [19]. We used the following primary antibodies: anti-CD81 (Abcam, Cat# ab79559), anti-TSG101 (Abcam, Cat# ab125011), anti-E-cadherin (Cell Signaling Technology, Danvers, MA, USA, Cat# 14472S), anti-Vimentin (Abcam, Cat# ab92547), anti-N-cadherin (Cell Signaling Technology, Cat# 13116S), anti-MMP-2 (Cell Signaling Technology, Cat# 40994S), anti-MMP-9 (Cell Signaling Technology, Cat# 13667T), anti-ZEB1 (Cell Signaling Technology, Cat# 70512S), anti-Snail (Cell Signaling Technology, Cat# 3879S), anti-Slug (Cell Signaling Technology, Cat# 9585S) anti-Twist1 (Cell Signaling Technology, Cat# 46702S), anti-EGFR (Cell Signaling Technology, Cat# 4267S), anti-ERK antibody (Cell Signaling Technology, Cat# 4696S) and anti-p-ERK antibody (Cell Signaling Technology, Cat# 4370T), anti-androgen receptor (Abcam, Cat# ab74272), anti-β-actin (Cell Signaling Technology, Cat# 3700S) and anti-GAPDH (Cell Signaling Technology, Cat# 5174S).
Transwell migration and invasion assay
Transwell chambers with 8 μM pore size (Corning, Costar 3464, Corning, NY, USA) were performed to evaluate the migration and invasion ability of LNCaP and DU145 in the presence or absence of CAFs-derived exosomes. LNCaP and DU145 were pretreated with 10% CSFBS DMEM medium for 24 h in advance, and then incubated with CAFs-derived exosomes at a concentration of 25 μg/mL in 10% CSFBS DMEM medium for 48 h. For the migration assay, 8×104 LNCaP cells or 3×104 DU145 cells were mixed in 100 μl of serum-free medium and seeded onto the upper chambers of the Transwell, DMEM medium with 10% CSFBS was placed in the lower chambers. After 48 h, LNCaP and DU145 cells that migrated through the membrane were stained with crystal violet. To assess invasion ability of LNCaP and DU145 cells, Matrigel (BD Biosciences, San Jose, CA, USA) in serum-free medium was added on top of the Transwell membrane and allowed to dry for 1 h at 37 ℃. Then 8×104 LNCaP cells or 3×104 DU145 cells were seeded, after 72 h and 24 h, invading LNCaP and DU145 cells at the Transwell membrane were labelled, respectively.
RNA extraction and quantitative real-time PCR (qRT-PCR)
Total RNA of isolated exosomes, cells and tissues were extracted using Trizol (Takara, Japan) reagent following the procedure. Reverse transcription was performed using Prime Script RT reagent Kit (Takara). The real-time PCR was conducted with TB Green TM Premix Ex Taq TM (Takara) on Quant Studio 6 Flex (Applied Biosystems). All procedures above followed standard instructions. We used Bulge-loopTM miRNA qRT-PCR Primer Sets (one RT primer and a pair of qPCR primers for each set) to determine miRNA quantification. Primers and oligos were supplied by RiboBio (Guangzhou, China) and Sangon Biotech (Shanghai, China) and sequences of some primers are listed in Additional file 5: Table S1. The relative expression of mRNA or miRNA was determined using the 2-ΔΔCt method. All results are representative of three independent experiments. And we used GAPDH as the reference of mRNA and U6 as the reference of miRNA.
miRNA sequencing
Exosomes were isolated from three sets of primary CAFs, total RNA was isolated from exosomes. Library construction, miRNA sequencing, and bioinformatics data analysis were performed by CloudSeq Biotech (Shanghai, China). In brief, the amount and purity of RNA were analysed by a NanoDrop ND-100 (Thermo Fisher Scientific). Only small RNAs of length 20-22nt were selected to prepare libraries and PCR amplification. Then the products were sequenced via Illumina HiSeq sequencer (Illumina, USA). Differentially expressed miRNAs were analysed by a twofold change and a significant p-value (0.05).
Xenograft models and bioluminescence imaging in vivo
All animal procedures were performed in accordance with the guidelines of laboratory animals and approved by the Institutional Animal Care and Use Committees of Shanghai General Hospital. 4 to 6-week-old male BALB/c nude mice (Beijing Vital River, Beijing, China) were maintained under specific pathogen-free conditions in the animal centre of Shanghai General Hospital. To evaluate the effect of DHT/ETOH-treated CAFs-derived exosomes on tumour metastasis, the nude mice were divided into 3 groups with 5 mice in each group at random and surgical castration was performed as previously described [26]. A week later, we performed injections of DU145 luciferase (DU145-Luc) cells. Before tumour cell injection, DU145-Luc cells were pre-incubated with DHT-treated CAFs-derived exosomes (25 μg/mL), ETOH-treated CAFs-derived exosomes (25 μg/mL), or PBS twice a day for 4 days. Then, we injected the indicated cell lines (106 cells in 100ul PBS per mouse) through the tail vein. Thereafter, mice were treated with CAFs-derived exosomes (150μg in 100ul PBS per mouse) or PBS via tail vein injections every other day for 2 weeks. 4 or 8 weeks after the injection of tumour cells, tumour metastasis was observed by a bioluminescence-based in vivo imaging system (IVIS, Caliper Life Science, MA, USA). The mice were anesthetized with 1.5% isoflurane/air and intraperitoneally injected with D-luciferin (200μl at 15mg/ml in PBS) before imaging. Afterward, the mice were sacrificed 8 weeks after tumour injection, we removed the lungs and captured the images. The tumour foci in lungs were collected and quantified, and some metastatic tumours were fixed in 4% paraformaldehyde and paraffin-embedded for haematoxylin and eosin (H&E) and immunohistochemistry.
Detection of transfer of miR-146a-5p via exosomes in vitro
To examine whether CAFs-derived exosomal miR-146a-5p could be transferred to PCa cells, Cy3-labeled miR-146a-5p or negative control was transfected to CAFs, then we cultured CAFs in complete medium containing exosome-free FBS for 48h, and the conditioned medium was added to DU145 for 24h. Then the DU145 cells were fixed for immunofluorescence. Moreover, the cytoskeleton of DU145 was stained with Vimentin and the nuclei were stained with 1×hoechest 33342. Finally, fluorescent microscopy was used to detect the green signals (Vimentin) and red fluorescent signals (Cy3-labeled miR-146a-5p) in DU145.
To determine uptake of exosomes, CAFs were transfected with Cy3-labelled miR-146a-5p or negative control for 24 h, followed by washing with PBS and cultured in complete medium containing exosome-free FBS for 48 h. CAFs-derived exosomes were isolated as described above. The exosomes were suspended in freshly medium and added to DU145. After 24 h, DU145 were fixed with 4% paraformaldehyde for further observation.
Dual luciferase reporter assay
Luciferase reporter constructs encoding NC 3’UTR, the wild-type EGFR 3’UTR region, or mutant EGFR 3’UTR region were synthesized by Genomeditech. In brief, 293T cells were seeded into a 24-well plate, then were co-transfected with luciferase reporter, miR-NC mimics/miR-146a-5p mimics, and Renilla luciferase vector (pRL-TK; Genomeditech) by using HG transgene reagent (Genomeditech). After 48h, luciferase activities were detected using a Dual-Luciferase Reporter Assay kit (Genomeditech) following the manufacturer’s protocol.
Immunohistochemistry (IHC)
IHC was performed as described previously [27]. Tissues were embedded in paraffin and IHC was performed using anti-E-cadherin antibody (Cell Signaling Technology, Cat# 14472S), anti-Vimentin antibody (Abcam, Cat# ab92547), anti-EGFR antibody (Cell Signaling Technology, Cat# 4267S), anti-ERK antibody (Cell Signaling Technology, Cat# 4696S) and anti-p-ERK antibody (Cell Signaling Technology, Cat# 4370T).
Proliferation assay
Cell viability was determined by Cell Counting Kit-8 (CCK-8, Dojindo, Kumamoto, Japan). Cell proliferation was measured by 5-ethynyl-29-deoxyuridine (EdU) assay (RiboBio, Guangzhou, China). For the CCK-8 assay, cells were pretreated with exosomes derived from ETOH-treated CAFs or DHT-treated CAFs for 48 h, then seeded in 96-well plate in triplicate at a concentration of 1000 cells each well, and cells were treated with indicated exosomes or PBS every other day. At different time points, 10 μl CCK-8 solution was added to each well and incubated at 37°C for 2h. The absorbance was detected at 450 nm using a microplate reader (Bio-Rad Laboratories). EdU assays were performed to determine the proliferation of LNcaP and DU145 cells after incubation with different exosomes for 48h according to the protocol.
Statistical analysis
The data were presented as mean ± standard deviation (SD). Statistical analysis was performed using GraphPad Prism 7 software. A two-tailed t-test was used to assess the differences. p<0.05 indicated a significant difference.