Transcriptional profiles and clinical tissues of breast cancer patients
The results of mRNA expression determined by RNAseq (polyA þ Illumina HiSeq) analysis deposited in the TCGA breast cancer database were also downloaded from the UCSC Xena website (UCSC Xena. Available online: http://xena.ucsc.edu/welcome-to-ucsc-xena/, accessed on 1 January 2022). Kaplan-Meier Plotter was employed to estimate the prognostic significance of GRK6 in breast cancer subtypes. The patients were stratified into low and high GRK expression groups under a maximal risk condition (minimized p value) in Kaplan-Meier analyses. The Hallmark gene sets used in this study were downloaded from Molecular Signature Database (https://www.gsea-msigdb.org/gsea/msigdb, accessed on 1 January 2022). Breast cancer tissues were obtained from Cardinal Tien Hospital and collected in accordance with institutional review board approval (CTH-101-3-5-054) and the Declaration of Helsinki.
Cell culture conditions
TNBC cell lines were obtained from American Type Culture Collection (ATCC) and cultivated in Leibovitz’s (L-15) medium (for MDA-MB231) and RPMI-1640 medium (for HCC38, HCC1806, and HCC1937) supplemented with 10% fetal bovine serum (FBS). Except MDA-MB231 cells incubated at 37°C in a free gas exchange with atmospheric air, other cell lines were cultured at 37°C with 5% CO2. All cell lines are obtained from American Type Culture Collection (ATCC). All media and supplements were purchased from Gibco Life Technologies (Thermo Fisher Scientific Inc., Waltham, MA, USA).
Migration assay
Cellular migration assay was performed in the trans-well culture using Boyden chamber system (Neuro Probe, Inc., Gaithersburg, MD, USA). Briefly, the lower chamber was fulfilled the conditioned media prior to covering with a polycarbonate membrane (8 μm pore size, Neuro Probe, Inc.) pre-coated with 10 μg of human fibronectin on the immersed site (Sigma, St. Louis, MO, USA). Cells (1.5 x 104) were seeded into the top chamber containing 50 mL of serum-free medium. After 4 h, the remaining stationary cells on the top side of the membrane were removed prior to fixing the migrated cells on the bottom side of the membrane with 100% methanol followed by performing the staining with 10% Giemsa’s solution (Merck, Levelingstr, Munchen, Germany) for 1 h. Migrated cells were counted under the light microscope from three independent experiments.
Cloning and lentiviral preparation/infection
Human cDNA clones for GRK6A (NM_001004106.3) and GRK6B (NM_002082) were obtained from the National RNAi Core Facility Platform in Taiwan and Sino Biological Inc. (Beijing, China), respectively, and subcloned into lentivirus shuttle vector pLAS/3w with puromycin-resistant gene. Lentiviral particles with vector only or vector-containing GRK6 gene variants were produced through the collaboration with the National RNAi Core Facility. Lentiviral particles containing a puromycin-resistant gene and non-silencing control or GRK6 shRNAs [sh1 (TRCN0000001367): CCGGCCTCGACAGCATCTACTTCAACTCGAGTTGAAGTAGATGCTGTCGAGGTTTTT; sh2 (TRCN0000010618): CCGGGTGTTAGGGTAGCATGGGATTCTCGAGAATCCCATGCTACCCTA ACACTTTTT] were purchased from the National RNAi Core Facility. Cells with a density at 50% confluence grown in 6-well plates were replenished with the fresh conditioned media containing 5 μg/ml of polybrene (Santa Cruz, Dallas, TX, USA) prior to performing the infection with the produced lentiviral viral particles at 2-10 multiplicity of infection (MOI) overnight. The vector control/GRK6-overexpressing HCC1937 cells and the non-silenced control/GRK6-silenced MDA-MB231 cells were obtained after the cultivation in the presence of puromycin (10 μg/ml) for 24 hours and then subjected to RT-PCR and Western blot analyses for confirming the efficiency of gene overexpression and knockdown.
Reverse transcription PCR (RT-PCR)
Total RNA of primary tumors and normal adjacent tissues from clinical breast cancer patients and detected TNBC cells was extracted by using TRIzol extraction kit (Invitrogen). The aliquots of total RNA (5 μg) were incubated with M-MLV reverse transcriptase (Invitrogen) to yield cDNA products which were subsequently amplified by PCR protocol with a Taq-polymerase (Protech, Taipei, Taiwan) using paired primers (for GRK6, forward-CAGAGGAAGAAGAAGATCAAGCGG and reverse-GACATTCAGCTCTTGGAAGCACTC for GAPDH, forward-AGGTCGGAGTCAAC GGATTTG and reverse-GTGATGGCATGGACTGTGGTC).
Western blot analysis
Whole cell lysates (30–100 mg) and membrane (300 mg)/cytosolic (100 mg) fractions that were extracted by a commercial kit (Thermo Fisher Scientific Inc.) resuspended in the loading buffer [62.5 mM Tris (pH 6.7), 1.25% SDS, 12.5% glycerol, and 2.5% b-mercaptoethanol] were boiled for 5 min prior to performing SDS-PAGE experiment. After transferred to PVDF membrane, the membranes were incubated with blocking buffer (5% bovine serum albumin for detecting phosphorylated proteins or 5% skim milk for detecting other protein in TBS containing 0.1% Tween-20) for 1 h at room temperature. Subsequently, the proteins on the membrane were incubated with antibodies against GRK6 from CUSABIO (Houston, TX, USA), phosphorylated b-Arrestin (p-b-Arrestin), b-Arrestin, p-p38, p38, p-Erk1/2, Erk1/2, p-NF-κB (Ser536, NF-κB, E-cadherin, N-Cadherin, Vimentin and Slug from Cell Signaling (Danvers, MA, USA), Fibronectin from Abcam (Cambridge. UK), and GAPDH from AbFrontier (Seoul, Korea) overnight at 4 °C. After several washes, the membranes were further incubated with a peroxidase-labeled secondary antibody for another 1 h at room temperature. Immunoreactive bands were visualized using an enhanced chemiluminescence system (Amersham Bioscience, Tokyo, Japan). The membranes for detecting phosphorylated proteins were re-probed with antibodies against the respective total protein.
Luciferase-based reporter assay
Luciferase reporter vectors containing NF-κB response element were purchased from Promega (Madison, WI, USA.) Cells with a density at 70% confluence grown on in 6-well plates were co-transfected with luciferase reporter and Renilla luciferase expression vectors. Post-transfection for 24 h, Dual-Glo® Luciferase Assay System purchase from Promega was used to detect the cellular luciferase activities according to the manufactural guideline. The level of firefly luminescence was finally normalized to that of Renilla luminescence.
Gene Set Enrichment Analysis
The fold change of mRNA levels derived from the comparison of RNA-sequencing results between the GRK6-knockdown and non-silencing control ATII cells in GSE164921 was generated by using GEO2R program. The ranked somatic genes by fold change were subjected to the in silico experiment using Gene Set Enrichment Score (GSEA) program against BIOCARTA gene sets. The Spearman’s correlation test was used to analyze the GRK6 co-expression with other somatic genes in the TNBC samples from The Cancer Genome Atlas database. The ranked somatic genes by Spearman’s rho value were then analyzed by GSEA program against HALLMARK gene sets.
Animal studies
Metastatic lung colony-forming assays were established by transplanting HCC1937 and MDA-MB231 cell variants (1 x 106 cells resuspended in 100 μL PBS) into Advanced-Severe-ImmunoDeficiency (ASID) B6.129S4-Il2rgtm1Wjl/J mice obtained from the National Laboratory Animal Center in Taiwan through the tail-vein injection. All procedures of animal experiment were reviewed and approved (LAC-2019-0060) by the Institutional Animal Care and Use Committee at Taipei Medical University. Post-transplantation for 4 weeks, mice were humanely killed and lungs were obtained for histological analysis.
Statistical analysis
SPSS 17.0 software (Informer Technologies, Roseau, Dominica) was used to analyze statistical significance. Paired t-test was utilized to compare GRK6 gene expression in the cancer tissues and corresponding normal tissues. Evaluation of survival probabilities were determined by Kaplan-Meier analysis and log-rank test. One-way ANOVA using Tukey’s post hoc test was used to analyze the statistical significance of the detected gene expression in clinical samples. The Non-parametric Mann-Whitney U test was used to analyze the data from cell-based and animal experiments. In all statistical analyses, p values<0.05 was considered statistically significant.