HuProt protein microarray and gene ontology enrichment analysis
HuProt™ Human Proteome Microarray v4.0 was purchased from Cambridge Protein Arrays (Babraham Research Campus, Cambridge, UK) and employed to screen PAK6 interactor candidates following manufacturer’s instructions. In detail, protein microarrays were incubated overnight at 4°C with blocking buffer (2% BSA in PBS + 0.05% Tween20 (PBST)). Recombinant PAK6 (ThermoFisher, #PR5307A) was diluted in blocking buffer and incubated with the arrays at room temperature (RT) for 2 hours with gentle rocking. After washes with PBST, microarrays where incubated for 2h at RT in gentle rocking with anti-PAK6 1:500 (Abcam, #ab1544752) diluted in blocking buffer, followed by incubation for 2h at RT with fluorophore conjugated antibodies goat anti-Rabbit (AlexaFluor, Invitrogen, #A11036, 1:1000) and anti-GST-Dylight 650 (Columbia Biosciences, #D10-1310, 1:2000). Subsequently, arrays were washed with PBST and 0.1x PBS and dried before being scanned at 532 nm (for detection of sample interactions) and at 633 nm excitation (for detection of GST proteins spotted on the slides) with a resolution of 10 µm.
Gene ontology (GO) and gene set enrichment analysis (GSEA)
Gene ontology biological process (GO-BP) enrichment analysis was applied to the datasets obtained from microarray analysis via g:Profiler (https://biit.cs.ut.ee/gprofiler/gost) to explore the biological pathways in which candidate interactors are implicated. Query parameters were set as follows: organism: Homo sapiens (Human); Statistical domain scope: Only annotated genes (only genes with at least one annotation); Significance threshold:. g:SCS threshold. Enriched GO terms with the adjusted p < 0.05 were considered statistically significant. Of note, a term size cutoff was set to increase specificity of the enrichment results. Significant GO terms were then grouped based on semantic similarity.
Gene set enrichment analysis (GSEA) was performed to examine the enrichment of cilia-related proteins in the PAK6 array PPI list and the PAK6 PHM PPI list. The pipeline of GSEA was designed as follows: (1) Primary cilium proteome was defined as the gene list annotated to the GO term “cilium” (GO:0005929); (2) The number of overlapping proteins between PAK6 PPI lists and cilium proteome was counted (the “test_intersection”); (3) 10000 randomly sampled gene lists were generated from the MGI gene annotation (N = 24609, all converted to HUGO gene symbols) at same size of the 2 PAK6 PPIs lists, respectively. The overlap sizes between each random gene list and the cilia proteome were counted (the “ref_intersection”); (4) A significant enrichment of cilium-related proteins was defined when the “test_intersection” > 95% of the “ref_intersection” for each PAK6 PPI list.
Animal models
C57BL/6J Lrrk2 wild-type (WT), Lrrk2 G2019S knock-in (KI), Lrrk2 R1441C KI and Pak5/6 double KO mice were employed. Lrrk2 G2019S KI mice were obtained from Prof. Michele Morari and Novartis Institutes for BioMedical Research, Novartis Pharma AG (Basel, Switzerland) (55). Lrrk2 R1441C KI (56) were obtained from Dr. Huabin Cai (NIH, Bethesda, USA). Pak5/6 knock-out (KO) mice (B6;129-Pak6tm1Amin Pak5tm1Amin/J, JAX stock #015825) (5) and WT littermates were obtained from Jackson Laboratory and housed and bred at the University of Padova. PAK6 null mice (B6;129-Pak6tm1Amin/J, JAX Lab) were housed and bred in a climate-controlled vivarium at Florida Atlantic University (FAU). Genotyping was executed using Phire Tissue Direct PCR Master Mix (Thermo Fisher Scientific) and the following primers: Pak5 WT forward, 5’-GCTTCCTCAGATCCATCCAAGGT-3’; Pak5 KO forward, 5’-CTTCCTGACTAGGGGAGGAGT-3’; Pak5 reverse, 5’-AGATGCATTGAGTGCTGGGGAA-3’; Pak6 WT forward, 5’-TCAGTTATCAGCTCCAACACCCTG − 3’; Pak6 KO forward, 5’-GCTACCGGTGGATGTGGAATGTGT-3’; Pak6 reverse, 5’-GAGGAAACCCCAGGTCATATACCT-3’. Housing and handling of mice were done in compliance with national guidelines. All animal procedures were approved by the Ethical Committee of the University of Padova and the Italian Ministry of Health (licenses 1041/2016-PR, 105/2019-PR, 200/2019-PR and 690/2020-PR- D2784.N.QHV), by the Institutional Animal Care and Use Committee (IACUC) of FAU and in compliance with the National Institutes of Health Guidelines for the Care and Use of Laboratory Animals and by the NIH guidelines for the Care and Use of Laboratory Animals, Approval number 463-LNG-2021.
Cell culture and transfection for ciliogenesis analysis
Primary striatal astrocytes were isolated from C57BL/6J Lrrk2 WT, Lrrk2 G2019S KI, Lrrk2 R1441C KI, Pak5/6 KO and relative littermate WT P0-P2 pups as previously described (45, 57) and cultured in Basal Medium Eagle (BME, Biowest), supplemented with 10% Fetal Bovine Serum (FBS) (Corning) and 100 U/mL Penicillin and 100 µg/mL Streptomycin (Life Technologies). Astrocytes plated at a density of 2 × 105 cells on 12 mm glass coverslips (VWR) coated with 0.1 mg/mL poly-L-lysine (PLL) were transfected with 1 µg/well of 3xFlag tagged PAK6 (WT or K436M) (33, 34). Cells were fixed 36 h after transfection with 4% paraformaldehyde (PFA) in PBS for 20 min at RT.
Primary cortical neurons were obtained as previously described(58) from Pak5/6 KO and relative WT littermate P0 pups. In details, neurons were plated on PLL-coated glass coverslips at a density of 2 × 105 cells/well in Neurobasal A (Life Technologies) supplemented with 2% B27 Supplements (Life Technologies), 0.5 mM L-glutamine (Life Technologies), 100 U/mL penicillin and 100 µg/mL streptomycin. After 10 days in culture, cells were fixed with 4% PFA in PBS for 20 min at RT.
Human neuroblastoma-derived SH-SY5Y cells (naïve), stable lines overexpressing PAK6 (LV-PAK6) or overexpressing PAK6 + PAK6-shRNA (LV-PAK6 + PAK6 shRNA) were cultured in Dulbecco's Modified Eagle's Medium (DMEM, ThermoFisher Scientific) and Ham’s F-12 Nutrient Mixture (F12, ThermoFisher Scientific) 1:1, supplemented with 10% FBS and 100 U/mL Penicillin and 100 µg/mL Streptomycin. SH-SY5Y were plated at a density of 0.7 × 105 cells on 12 mm glass coverslips coated with PLL and fixed 24 h later with 4% PFA in PBS for 20 min at RT. SH-SY5Y naïve cells were transfected with 1 µg/well of 2xMyc-PAK6 WT or K436M (previously generated as described in (34) and Lipofectamine 2000 (Thermo Fisher Scientific) and fixed 24 h later with 4% PFA in PBS for 20 min at RT.
HEK293T and mouse embryonic fibroblast (MEFs) WT and Pak6 null cells were maintained in DMEM supplemented with 10% FBS, 1% glutamine and 1% antibiotic-antimycotic solution. To promote cell ciliogenesis, cells were serum-starved overnight (16 h) by lowering the supplemented FBS to 1%. Lentiviral (LV) downregulation was achieved with Dharmacon GIPZ LV shRNA: non-silencing Control (#RHS4346) and PAK6 Specific (#RHS4430-99880759). Cells plated on coverslips were fixed in methanol at − 20°C for 10 min. Fixed cells were permeabilized with 0.1% Triton X-100 for 20 min at RT and then incubated with blocking buffer (5% FBS in PBS 1x) for 1 h at RT prior to incubation with antibodies. In details, primary antibodies were diluted in blocking buffer and incubated overnight at 4°C as follows: anti-Arl13b (Proteintech, #17711-1-AP, 1:2000 for astrocytes and cat# 66739-1-Ig for cell lines), anti-g-tubulin (Proteintech, cat# 66320-1-Ig, 1:200) anti-FLAG® M2 (Sigma, #F1804, 1:400), anti-pericentrin (Abcam, cat#ab28144, 1:200), anti-c-myc (Roche, #11667149001, 1:200), anti-MAP-2 (H-300) (Santa Cruz Biotechnology, #sc20172, 1:200). Anti-PAK6 polyclonal anti-serum was custom generated against glutathione-S-transferase(GST)-PAK6 (aa 292–400) as previously described (11). After 3x5 min washes with PBS, secondary antibodies goat anti-rabbit Alexa Fluor 488 (Invitrogen #A11034), goat anti-rabbit Alexa Fluor 568 (Invitrogen, #A11036), goat anti-mouse Alexa Fluor 568 (Invitrogen, #A11004) and goat anti-mouse Alexa Fluor 488 (Invitrogen, #A11029) were diluted 1:200 in blocking buffer and incubated for 1 h at RT. Subsequently, Hoechst (Invitrogen, 1:10,000) was used as a nuclear counterstain and Phalloidin-647 Reagent (Abcam, #ab176759, 1:100) was used in some experiments to visualize astrocytes. Coverslips were mounted using Mowiol. Fluorescence images were acquired with: Nikon A1R laser scanning confocal microscope, Zeiss LSM700 laser scanning confocal microscope exploiting a 63X oil immersion objective, Leica SP5 confocal microscope using an HC PL FLUOTAR 40x/0.70 oil objective. Around 20 optical sections of selected areas were acquired with a step size of 0.5 µm, and maximum intensity projections of z-stack images were used to manually count the number of ciliated cells and cilia length projections using Fiji-ImageJ software.
Stable SH-SY5Y PAK6 overexpressing cells
SH-SY5Y cells purchased from ICLC (cat.# HTL95013) were cultured in a 1:1 mixture of Dulbecco’s modified Eagle’s medium (DMEM, Life Technologies) and F12 medium, supplemented with 10% fetal bovine serum (FBS, Life Technologies). Cell lines were maintained at 37°C in a 5% CO2 controlled atmosphere. 0.25% trypsin (Life Technologies), supplemented with 0.53 mM EDTA, was employed to generate subcultures. Stable cell lines overexpressing PAK6 wild-type were generated as described in (33). Briefly, the cDNA sequence encoding PAK6 was cloned into the lentiviral plasmid pCHMWS-MCS-ires-hygro. 50 µg/ml hygromycin was utilized for selection. Downregulation of PAK6 expression was performed utilizing an shRNA against human PAK6 (sh-1944, Sigma). Western blot in SH-SY5Y cell extracts was performed with anti-PAK6 (Abcam, #ab1544752) and anti phospho-PAK4/5/6 (Cell Signalling, #3241) antibodies. Original Western blots present in Fig. 1b are shown in “Supplemental Material – Original Western blots”.
Cell culture and transfections for centrosomal cohesion analysis
A549 cells were cultured in DMEM containing high glucose without glutamine, and supplemented with 10% FBS, 2 mM L-glutamine, 100 U/ml of penicillin and 100 µg/ml of streptomycin as previously described (30).
For centrosomal cohesion determinations, cells were co-transfected with 1 µg of flag-tagged WT-LRRK2, G2019S-LRRK2 or R1441C-LRRK2, and with 100 ng of pCMV or myc-tagged PAK6-WT or K436M. For PAK6-only expression, cells were transfected with 1 µg of pCMV and 100 ng of PAK6 or PAK6-K436M. The following day, cells were treated with DMSO or 200 nM MLi2 for 2 h and then fixed with 4% paraformaldehyde (PFA) in PBS for 15 min at RT, followed by permeabilization with 0.2% Triton-X100/PBS for 10 min. Coverslips were incubated in blocking solution (0.5% BSA (w/v) in 0.2% Triton-X100/PBS) for 1 h at RT, and incubated with primary antibodies in blocking solution overnight at 4 ºC. Primary antibodies included rabbit polyclonal anti-pericentrin (Abcam, #ab4448, 1:1000) and mouse monoclonal anti-FLAG® M2 (Sigma, #F1804, 1:500), and rabbit polyclonal anti-myc (Sigma-Aldrich, #C3956, 1:1000). The following day, coverslips were washed 3 x 10 min with 0.2% Triton-X100/PBS, followed by incubation with secondary antibodies (1:1000) in wash buffer for 1 h at RT. Secondary antibodies included Alexa488-conjugated goat anti-rabbit (ThermoFisher, #A11008) and Alexa594-conjugated goat anti-mouse (ThermoFisher, #A11005). Coverslips were washed three times in wash buffer, rinsed in PBS and mounted in mounting medium with DAPI (Vector Laboratories, H-1200-10).
For determination of pRab10 colocalization with the centrosome, cells were co-transfected with 1 µg of flag-tagged G2019S-LRRK2 or R1441C-LRRK2 and with 100 ng of GFP, or with 1 µg of flag-tagged G2019S-LRRK2 or R1441C-LRRK2 and with 100 ng of mCherry-tagged PAK6 or PAK6-KM as described above. After fixation with 4% PFA, cells were additionally fixed with methanol at -20°C for 10 min required for g-tubulin staining. Permeabilization and staining with primary and secondary antibodies was as described above. Cells co-expressing flag-tagged LRRK2 and GFP were co-stained with mouse anti-g-tubulin (Abcam, #ab11316, 1:1000), and rabbit anti-pRab10 (Abcam, ab241060, 1:1000), followed by co-staining with Alexa405-coupled goat anti-mouse (ThermoFisher, #A31553, 1:1000) and Alexa649-coupled goat anti-rabbit (ThermoFisher, #A21244, 1:1000) secondary antibodies. Cells co-expressing flag-tagged LRRK2 and mCherry-tagged PAK6 were stained sequentially with chicken anti-mCherry (Sigma, #AB356481, 1:1000) followed by Alexa405-coupled goat anti-chicken (Abcam, #ab176575, 1:1000). Coverslips were then co-stained with mouse anti-g-tubulin and rabbit anti-pRab10, followed by co-staining with Alexa488-coupled goat anti-mouse (ThermoFisher, #A11001, 1:1000) and Alexa647-coupled goat anti-rabbit (ThermoFisher, #A21244, 1:1000).
Images were acquired on an Olympus FV1000 Fluoview confocal microscope using a 60x1.2 NA water objective lens. Images were collected using single excitation for each wavelength separately and dependent on secondary antibodies. Around 10–15 optical sections of selected areas were acquired with a step size of 0.5 µm, and maximum intensity projections of z-stack images analyzed using Fiji software. For each condition and experiment, distances between duplicated centrosomes were quantified from 50–60 transfected cells, with mitotic cells excluded from the analysis. As previously described for A549 cells (30), duplicated centrosomes were scored as split when the distance between their centers was > 2.5 µm. For determination of co-localization of pRab10 with the centrosomal marker g-tubulin, images were acquired as described above, and co-localization determined from 50–60 transfected cells.
Sucrose-gradient centrifugation
HEK293 cell extracts were prepared in HEPES buffer (50 mM HEPES, pH 7.4, 150 mM NaCl, 1 mM MgCl2, 1 mM EGTA, 0.5% Igepal CA-630, 1 mM dithiothreitol [DTT], and protease inhibitor cocktail) supplemented with 0.1 mM GTP and then clarified by centrifugation (20,000×g for 15 min). The extracts were loaded onto detergent-free 40–60% sucrose gradients and centrifuged at 200,000×g (TLS-55 rotor) for 3 hours. After centrifugation, the gradient fractions were collected and analyzed by western blot with anti-PAK6 and g-tubulin antibodies.
Cell culture, transfection and PAK6 purification
pcDNA3 carrying 3xFlag tagged PAK6 was transfected using jetPEI (Polyplus transfection) according to manufacturer’s protocol. Forty-eight hours post-transfection, HEK293 cells were collected, washed once with PBS and lysed in lysis buffer containing 20 mM Tris pH 7.5, 150 mM NaCl, 5 mM MgCl2, 1 mM EDTA, 1 mM β-glycerophosphate, 2.5 mM sodium pyrophosphate, 1 mM sodium orthovanadate, 0.5% Tween-20 and 1x Roche complete protease inhibitor cocktail (EDTA free) for 45 min. The lysate was cleared by centrifugation at 20,000 x g for 15 min and the supernatant was incubated with Anti-Flag M2 magnetic beads (Sigma) overnight at 4°C with rotation. Afterwards, the beads were washed 10 times in 5 steps of wash buffers containing 20 mM Tris pH 7.5, 5 mM MgCl2, 500 mM NaCl and 0.5% Tween 20 (Buffer A) or 20 mM Tris pH 7.5, 5 mM MgCl2, 150 mM NaCl and 0.02% Tween 20 (Buffer B). Purified PAK6 was then eluted with in Buffer B supplemented with 150 µg/ml 3xFlag peptides (Sigma).
MBP fused LRRK2 Roc-COR and GST-CRIB domain purification
MBP-LRRK2-Roc-COR was expressed in Escherichia coli BL21(DE3) cells and purified by Dextrin-sepharose HP using MBP buffer consisted of 20 mM HEPES (pH 8), 200 mM NaCl, 10% Glycerol, 10 mM MgCl2, 5 mM 2-mercaptoethanol and 0.5 mM GppNHp. The bound proteins were washed using the same buffer supplemented with extra 10 mM MgCl2 and 5 mM ATP before elution with MBP-MST buffer consisted of 50 mM HEPES (pH 8), 800 mM NaCl, 25 mM MgCl2, 0.25% Tergitol type NP-40, 10 mM D-maltose and 0.5 mM GppNHp.
GST, GST-CRIB(PAK6) and GST-CRIB(PAK5) were expressed in Escherichia coli BL21 (DE3) cells and purified by GSH column using a buffer consisting of 50 mM Tris (pH 7.5), 150 mM NaCl, 5% Glycerol, 5 mM MgCl2, 5 mM and 3 mM Dithiothreitol (DTT). The bound proteins were washed and eluted using the same buffer supplemented respectively with 0.5 M NaCl and 10 mM GSH.
Pulldown assay
The sequence of the CRIB PAK6 and PAK6 domains were obtained by synthesis. Four oligonucleotides (SIGMA-Genosis) complementary 2 by 2 and partially overlapping were designed:
PAK6_GST-CRIB-A-For: AATTCAAATGGAGATCTCAGCGCCACAGAACTTCCAGCACCGTGTCCACACCTCCTTC
PAK6_GST-CRIB-A-Rev:
GGGTCGAAGGAGGTGTGGACACGGTGCTGGAAGTTCTGTGGCGCTGAGATCTCCATTTG
PAK6_GST-CRIB-B-For: GACCCCAAAGAAGGCAAGTTTGTGGGCCTCCCCCCACAATGGCAGAACATCCTGGACTGAC
PAK6_GST-CRIB-B-Rev: TCGAGTCAGTCCAGGATGTTCTGCCATTGTGGGGGGAGGCCCACAAACTTGCCTTCTTTG
PAK5_GST-CRIB-A_For: AATTCAAATGGAAATATCTGGCCCGTCCAACTTTGAACACAGGGTTCATACTGGGTT
PAK5_GST-CRIB-A_Rev: GTGGATCAAACCCAGTATGAACCCTGTGTTCAAAGTTGGACGGGCCAGATATTTCCATTTG
PAK5_GST-CRIB-B_For:
TGATCCACAAGAGCAGAAGTTTACCGGCCTTCCCCAGCAGTGGCACAGCCTGTTAGCATGAC
PAK5_GST-CRIB-B_Rev: TCGAGTCATGCTAACAGGCTGTGCCACTGCTGGGGAAGGCCGGTAAACTTCTGCTCTT
The oligonucleotides were phosphorylated and then annealed to obtain the double strand. Finally, they were ligated with the pGEX-4T-2 plasmid (GE Healthcare Life Sciences) previously digested with the restriction enzymes EcoRI and XhoI. The final product was checked by sequencing.
Twenty-five µg of purified MBP-fused (or MBP alone) proteins were incubated with 50 µl of Amylose resin for 1 h at 4°C in rotation. The resin was then washed 3x with a Washing buffer containing 50 mM Tris (pH 7.5), 150 mM NaCl, 5 mM MgCl2, 3 mM DDT and 5% Glycerol. Twenty-five µg of purified GST-fused (or GST alone) proteins were added to the resin and the mix was incubated overnight at 4°C in rotation. The next day the resin was washed 3x with Washing buffer and the proteins were denatured using Laemmli buffer. The samples were boiled for 10 min at 95°C degrees and 15 µl were loaded into a 12% polyacrylamide gel. Blue Coomassie was used for staining.
MicroScale Thermophoresis (MST)
Human PAK6 or MBP-LRRK2-Roc-COR proteins were purified as previously described and labelled with red fluorescent dye NT-647-NHS in the Monolith NT protein labelling kit according to the manufacturer’s protocol. The unreacted dye was removed from labelled proteins by the gravity flow desalting column provided in the kit with the MST buffer. For labelling MBP-LRRK2-Roc-COR, 5 mM MgCl2 and 0.5 mM guanine nucleotide were always supplemented during the labelling process. MST were measured by Monolith NT.115 (NanoTemper). Serial dilution of unlabeled ligand proteins were prepared in MST buffer and mixed with NT-647-NHS labelled proteins at a final concentration of 100 nM, with guanine nucleotides at 0.5 mM. The mixtures were incubated on ice for 30 min, centrifuged at 10,000 x g at R.T. for 1 min and loaded into Monolith premium capillaries (NanoTemper). LED laser power was set to reach around 1200 fluorescence counts for fluorescent detection and IR laser power was set at 80% for MST measurements. Data was analyzed by PALMIST (59) and the graphs were created by GUSSI (60).
Alpha-fold modelling
DeepMind's advanced machine learning model, AlphaFold2, was used to predict the structures of complexes between human LRRK2 (Uniprot ref ID Q5S007) and PAK6 (Uniprot ref ID Q9NQU5). The code for AlphaFold2 was downloaded from DeepMind's official GitHub repository (https://github.com/deepmind/alphafold). The computations were performed on workstation with NVIDIA RTX A5000 (24 Gbytes). Each system was equipped with Linux (Ubuntu 20.04), CUDA11, Python 3.8, and TensorFlow 2.3.1.
Sequence alignments were performed with the standard UniRef90 databases. Calculations with AlphaFold2 were conducted using the recommended configurations provided by DeepMind, with structural templates disabled to obtain de novo models. The 25 complexes predicted were benchmarked with the experimental results.
Statistical analysis
Statistical analyses were performed with GraphPad Prism 10. Data were analyzed by t-test, one-way or two-way ANOVA test followed by Tukey’s post-hoc test. Significance was set at P < 0.05. Significance values are indicated in the figure legends.