2.1 Ethics statement
Animal experiments were carried out in accordance with the rules of Aydın Adnan Menderes University animal experiments local ethics committee (HADYEK). The research protocol was approved by HADYEK (64583101/2021/032).
2.2 Plasmids, bacterial strains, and culture conditions
E. coli DH10B, BL21 (DE3) strains and pET-30a (+) vector were used for HuNoVs DNA manipulations, amplification and expression. Tryptic soy agar (TSA), Luria-Bertani (LB) agar and broth were used for cultivation of E. coli strains.
2.3 Supply and amplification of gene sequences
Gene sequences encoding VP1, VP2, and p22 proteins were retrieved from Norovirus Hu/GII.4/New Orleans1805 (GenBank accession code: GU445325.2) complete genome are included in Supplementary Informations. Codon optimizations for heterologous expression in E. coli Genescript online tool was used. After VP1, VP2 and p22 genes were analyzed using the online program http://sysbio.unl.edu/SVMTriP/result.php epitope maps of the proteins were obtained. A polypeptide sequence (EP123) was created by taking three (highest scoring) epitope regions for VP1 and VP2 and two for p22 (Supplementary Fig. S1-S3). A 690-base fragment consisting of 8 epitopes containing 20 amino acids each and 10 glycine amino acids between the two epitopes was designed (Fig. 1).
The final DNA sequences were synthesized by Triogen Biotechnology Company (Turkey). The synthetic VP1 and EP123 genes were delivered in plasmid vector pEX-A258 vector, while VP2 and p22 are provided in the pEX-A128 vector (Fig. 2).
2.4 Cloning of VP1, VP2, p22 and EP123 genes
- Plasmid Isolation and Restriction
Plasmids contained optimized Norovirus gene sequences were dissolved in Tris-EDTA (TE) (10mM) buffer according to the manufacturer's protocol and then transferred to E. coli DH10B competent by heat shock transformation method [35]. pEX-A258 and pEX-A128 plasmid DNAs were isolated with the GeneAll-ExprepTM-Plasmid SV plasmid extraction kit. Restriction process was applied to confirm the presence of gene fragments in the isolated plasmids. For restriction of VP1 and EP123; 10 µL plasmid, 6 µL sterile water, 2 µL 10X buffer, 1 µL XhoI and 1 µL XbaI enzyme (FastDigest, Thermo Fhiser Scientific, USA) were used. For restriction of VP2 and p22; 10 µL plasmid, 6 µL sterile water, 2 µL 10X buffer, 1 µL BamHI and 1 µL NotI enzyme were used. The restriction process of each gene was performed in separate tubes. The reaction was incubated at 37°C for 30 minutes. It was run on 1% w/v agarose gel.
Primers with restriction sites for use in cloning were designed based on optimized gene sequences (Table 1). Using the isolated plasmids as template DNA, the gene regions of interest were amplified by PCR.
Table 1 Primers and sequences used in the study
Primer
|
Sequence (5′-3′)
|
Reference
|
VP1F
|
ATGAATTCATGAAGATGGCGAGCAGCGA
|
This study
|
VP1R
|
ATAAAGCTTTTACAGCGCACGACGACGA
|
This study
|
VP2F
|
ATGAATTCATGGCGGGTGCGTTTTTCGC
|
This study
|
VP2R
|
ATAAAGCTTTTAAACACGGCTTTCGCCA
|
This study
|
p22F
|
ATGAATTCATGGGCCCGGCGCTGACCAC
|
This study
|
p22R
|
ATAAAGCTTTTACTCGGTCTTGATGTCA
|
This study
|
EP123F
|
ATGAATTCATGGCGGGTGACGATGTGTT
|
This study
|
EP123R
|
ATAAAGCTTTTACGCACCCGCCAGTTCG
|
This study
|
T7-F
|
TAATACGACTCACTATAGGG
|
Addgene
|
T7-R
|
GCTAGTTATTGCTCAGCGG
|
Addgene
|
Sequences in italic are restriction enzyme sequences (GAATTC: EcoRI, AAGCTT: HindIII)
Amplification was made using 1X Taq buffer, 2 mM MgCl2, 0.2 mM dNTPs, 0.4 pmol per primer, 1.5U Taq polymerase (Thermo Scientific, ABD) and also 1 µL of total DNA was added to the mixture. PCR conditions were givenin Table 2.
Table 2 PCR conditions for VP1, VP2, P22 and EP123 genes
PCR Reactions
|
Temperature (oC)
|
Time
|
Cycle
|
Initial Denaturation
|
95
|
5 min
|
1
|
Denaturation
|
95
|
30 sec
|
35
|
Annealing
|
VP1
|
VP2
|
P22
|
EP123
|
30 sec
|
60
|
57
|
53
|
60
|
Extension
|
72
|
VP1
|
VP2
|
P22
|
EP123
|
1.5 min
|
1 min
|
1 min
|
30 sec
|
Final extension
|
72
|
10 min
|
1
|
- Transfer of Genes into the Expression Vector pET-30a (+)
Amplicons of each gene and the vector pET-30a (+) purified with the plasmid extraction kit were subjected to restriction with the EcoRI/HindIII enzymes in separate tubes. Restriction products were isolated by the phenol-chloroform-isoamylalcohol (25:24:1) method and purified by ethanol precipitation. For the ligation reaction, 2 µL of 10X T4 DNA ligase buffer (Thermo Fhiser Scientific, USA) and 1 µL of T4 DNA Ligase (5 U/µL) were added to 17 µL of restriction products and incubated at 22 °C overnight. For inactivation of T4 DNA ligase, the ligand was incubated at 70 °C for 5 min.
The ligated constructs were transformed into BL21 (DE3) E. coli cells by chemical transformation and recombinant colonies selected on TSA medium supplemented with 50 mg/L kanamycin [35]. Colony PCR was performed on the selected colonies with both the T7 primers of the vector and the designed primers. Additionally, plasmids were extracted from PCR positive colonies and were screened by digestion with EcoRI and HindIII enzymes and sent to Medsantek (Istanbul) for sequence analysis.
2.5 Expression and Purification Recombinant Proteins
- Expression of VP1, VP2, P22 and EP123 in E. coli
To detect recombinant protein production, each plasmid-carrying colony (VP1, VP2, p22 and EP123) was incubated in 10 mL LB medium containing 50 µg/mL kanamycin. Transformants were cultured at 37°C and 600 nm until the optical density (OD) reached 0.5-0.6 (~3 h); then 0.5 mM isopropyl-β-D-thio-galactoside (IPTG) was added for induction. After IPTG induction, the cultures were continuously incubated at room temperature with shaking at 200 rpm for 24h. Cells were harvested by centrifugation at 5000 rpm for 10 min at 4°C and homogenized with 1 mL 1xPBS. Cells were lysed and evaluated for protein expression levels and protein solubility by SDS-PAGE (12.5% w/v polyacrylamide) [36, 37].
Large-scale protein expression was performed in 1 L aerated medium. Cultures were grown in LB medium supplemented with kanamycin (50 µg/mL) at 37 °C until OD600: 0.5–0.6. Protein expression was induced by the addition of 0.5 mM IPTG and performed for 24 h at room temperature. The cells were collected by centrifugation under the same conditions, and 50 mL of 1X PBS was added to the pellet, and the cells were washed twice and stored at -80 oC. Protein determinations were determined according to the Bradford method and using bovine serum albumin (BSA) as the standard [38].
- Purification of recombinant VP1, VP2, P22 and EP123 proteins
Since the recombinant proteins carry the His-tag located on the pET30-a (+) backbone, they were first purified with the Immobilized Metal Affinity Chromatography (IMAC) column, which can capture this tag. According to the Bio-Rad EconoFit IMAC Ni-NTA column purification protocol; recombinant protein samples at -80oC were first placed on ice and allowed to thaw in a controlled manner. ~5 g of pellet was suspended by adding 15 mL of IMAC Lysis Buffer (300 mM NaCl, 50 mM NaH2PO4, 5 mM Imidazole, pH: 8). Cells were lysed three times for 1 min with a probe-type sonicator and kept on ice for 1 min. The supernatant portion of the samples, which were centrifuged at 15000 rpm and +4 oC for 30 minutes, was filtered through a 0.45 µ filter.
The chromatography column was washed with the above-mentioned wash buffer (25 mL) and equilibration was performed. The column was first washed with wash buffer without imidazole, then with 20 mM, and finally with 40 mM imidazole. Elution buffer with 250 mM imidazole was used in each application. Elution was continued until OD280 decreased to ~0.1 [39].
As the second method, ammonium sulfate precipitation was used to precipitate the proteins in the cell-free supernatants obtained from liquid culture. In order to optimize ammonium sulfate precipitation, samples treated with 20%, 40%, 60%, 80% saturated ammonium sulfate for half an hour (+4 °C) and in a magnetic stirrer were centrifuged at 5000 rpm (+4 °C) for 30 min. Pellets were dissolved in phosphate buffer (20 mM, pH 7.0). The precipitate was dialyzed against the same phosphate buffer for overnight on a magnetic stirrer at +4 ºC, using a 14000 Da dialysis membrane (Sigma-Aldrich, D9777-100FT) [40].
- Polyacrylamide gel electrophoresis (SDS-PAGE)
To visualize the proteins, a 12.5% separation and 4% loading gel was prepared and the proteins were run with a vertical electrophoresis device. Then, the proteins were visualized by staining the gel [36].
2.6 Immunization
7-week-old female BALB/c mice were used in this study. Experimental animals were kept in cages of 5 each under normal conditions (20-24 0C, 50-60% humidity) and were fed ad-libitum with ready-made commercial pellet feeds. During the experimental phase, animals were kept in single cages. Ribi Adjuvant (Sigma Adjuvant System-S6322) was prepared by dissolving it in PBS in accordance with the manufacturer's instructions. Considering the recommended antigen concentration (0.05-0.25 mg/mL), 200 µL/animal of antigen-adjuvant (1:1) mixture was applied to 50 µg/animal. It was administered intramuscularly to a group of 20 Balb/C mice 3 times at 2-week intervals. Only PBS was applied to the control group. At the end of the experimental phase (2 weeks after the last dose was given), the animals were sacrificed and blood samples were taken by intracardiac drawing and collected into EDTA tubes. Then, the serum was separated, and stored at -20 oC.
2.7 Determination of antibody titers in sera
ELISA method was used to determine the serum IgG levels. After the wells of the ELISA plates were coated with 100 µL antigen solution (10 µg/mL), they were incubated at +4 °C overnight. Unbound antigens were removed by washing 3 times with PBS-Tween 20 buffer. Two-hundred microliters of casein solution (0.2%) was added to each well and kept at 37 °C for 1 h. The wells then were washed 3 times with PBS-Tween 20 buffer. Immunized mouse sera (primary antibodies) were diluted 1/20, 1/80, 1/160 and 1/320 in PBS and blood serum from a non-immunized mouse was prepared in the same way and 100 µL was added to each well and incubated at 37 °C for 1 h. The plates were washed 3 times with washing buffer. Anti-mouse IgG conjugate (secondary antibody) diluted at 1/1000 was added to each well as 100 µL and kept at 37 °C for 1 h. Then, the wells were washed 6 times with washing buffer. Substrate buffer was added to each well as 100 µL and the plate was left in a dark environment for 30 min. The absorbance values of the microplates were read against the negative control at a wavelength of 450 nm in an ELISA reader. Infected mouse serum was used as a positive control and casein buffer was used as a negative control. The absorbance ratios (p/n) of positive (p) and negative (n) serum samples were calculated. P/n ratio values greater than 2 and 2 were considered positive [41].