CERTL interaction with APP/Aβ
Immunoprecipitation (IP). Wild type HEK293 and transgenic HEK293cells that stably overexpress humanAPP695 isoform (NP_958817.1) (33), were cultured in Dulbecco’s modified Eagle’s medium (DMEM) supplemented with fetal bovine serum (FBS), penicillin/streptomycin (Pen/Strep), and L-glutamine. Stable transfected HEK-APP were maintained in G418 selective medium. Prior to the experiment, cells were seeded in 25 cm2 flasks and maintained in serum-free DMEM for 24 hours. For the homogenization, cells were washed two times with phosphate buffered saline (PBS), collected in lysis buffer (25 mM Tris HCl pH 7.5,150 mM NaCl, 0.5% Triton X-100 and protease inhibitors), centrifuged at 20,000 g for 30 minutes and the resultant supernatants collect for the Bradford protein analysis. Protein extracts (100 µg) from HEK or HEK-APP were used for immunoprecipitation experiments. Pull down of endogenous CERTL and APP was performed with 1 µg mAb anti CERTL (3A1-C1) (29) and anti-Aβ mAb 6E10 (Covance), respectively by 1-hour incubation at room temperature. mAb anti-syntaxin 6335 (clone 3D10, Abcam) was used as an isotype control. Next, anti-mouse secondary antibodies (Eurogentec) were used to pull down the immune complex. Thereafter, samples were centrifuged at 20,000 g for 30 minutes. Pellets were washed three times in 50 µL PBS and boiled in reducing sample buffer containing mercaptoethanol to solubilize immunocomplexes. Then, the proteins were separated on a Tris-HCl 4-15% gradient gel (Bio-Rad), and blotted on nitrocellulose membrane (Millipore). Next, the membranes were probed with anti-Aβ/APP(6E10) or rabbit pAb anti-CERTs (epitope 1-50 of human CERTs, Bethyl Laboratories) antibodies. After 3 washes, membranes were incubated with donkey anti-mouse IRdye 680 and goat anti-rabbit IRdye 800 (Rockland Immunochemicals) and scanned using the Odyssey infrared imaging system (LI-COR Biosciences).
Neuronal culture and immunofluorescent staining. Primary neurons were cultured from 5xFAD neonates P0 as described, with modifications (34). After the cortical area was dissected, the tissue was digested in 0.25% trypsin in Hank's Balanced Salt Solution (HBSS, Corning) for 15 minutes. Trypsin activity was stopped with plating medium, DMEM (Gibco, Invitrogen) containing 10% FBS and N2 supplement. Then, the digested tissue was passed through a cell strainer, spun down, and cells resuspended in plating medium. Cells were seeded onto poly-D-lysine-coated coverslips and cultured at 37 °C in a 5% CO2 atmosphere. After 4 hours the plating medium was replaced with Neurobasal medium supplemented with B27 supplement, Pen/Strep, and 0.5 mM L-glutamine and kept on for 10-14 days. Every other day, supplemented Neurobasal medium was partially replaced.
Neurons were fixed with 4% PFA in PBS (Thermo Scientific) at 4 °C for 10 minutes, permeabilized with 0.25% Triton-X in PBS for 5 minutes, washed three times with PBS and incubated with 3% BSA for 30 minutes. Cells were stained with rabbit polyclonal anti-CERTs (epitope 300-350 of human CERTs, Bethyl Laboratories), goat anti-MAP-2 (D-19) (Santa Cruz Biotechnology) and with 6E10 anti APP/ Aβ (29). The following secondary antibodies conjugated to fluorophores were used for detection: anti-mouse IgG Alexa 647, anti-rabbit IgG cy3 and anti-goat IgG Alexa 488. Fluorescence microscopy was performed using Eclipse Ti2-E inverted microscope system (Nikon). Images were processed using Nikon NIS-Elements software equipped with a 3D deconvolution program.
Microscale thermophoresis binding analysis. Microscale thermophoresis (MST) analysis was performed in the Monolith NT.155 instrument (Nanotemper). In brief, 20 nM of NT647 labeled CERT was incubated for 20 minutes at room temperature in the dark with different concentrations of either Aβ1-42 (rPeptide Athens) (3-100,000 nM) or control 17 kDa Lama antibody fragment (H6) (1-35,000 nM) in PBS Tween20 (0.01%). Afterward, 3-5 µL of the samples were loaded into glass capillaries (Monolith NT Capillaries, Cat#K002), and the thermophoresis analysis was performed (LED40.51%, IR laser 80%). Statistical analysis was performed with Origin8.5 Software.
Aβ aggregation assay and cell-based toxicity assay
Transmission Electron Microscopy (TEM). Aβ1-42, purchased as the lyophilized salt (Bachem), was dissolved in 0.01 M NaOH in ultrapure water to give an Aβ1-42 stock solution of ca 0.20 mM, which was used immediately to prepare each of the treatments. The remaining peptide stock solution was frozen at -20 °C until required. Under these highly alkaline conditions, the peptide is fully dissolved and exists only as monomers (35). Treatments containing Aβ1-42 and / or CERTL (29), were prepared in 0.20 μm filtered modified Krebs-Henseleit (KH) medium (118.5 mM NaCl, 4.8 mM KCl, 1.2 mM MgSO4, 1.4 mM CaCl2, 11.0 mM glucose), buffered in 100 mM PIPES at pH 7.4, including 0.05 % w/v sodium azide to inhibit microbial growth. Samples were incubated at 37 °C until their specified time points prior to being prepared onto TEM grids. For replicate samples, Aβ1-42 was thawed thoroughly immediately before use and then vortexed briefly. The stock solution was centrifuged at 15,000 rpm for 5 minutes, and 2.0 μL was then taken ready for concentration determination by absorbance at 280 nm, utilizing a NanoDrop 1000 spectrophotometer (Thermo). The concentration of Aβ1-42 was calculated with the Beer-Lambert law and the extinction coefficient 1390 M-1 cm-1. CERTL concentrations were determined in the same manner with a value of 107925 M-1 cm-1 taken as the extinction coefficient using the 72 kDa recombinant CERTL sequence (hCERTL, 1875bp NP_005704.1).
All samples for TEM were prepared via a modified TEM staining protocol (36). Pre-coated S162 200 mesh formvar / carbon coated copper grids (Agar Scientific), were inserted into 20.0 μL of the sample beaded onto paraffin film for 60 seconds, then wicked, passed through ultra-pure water, re-wicked and placed into 30 μL 2% uranyl acetate (in 70% ethanol), for 30 s. Following staining with uranyl acetate, grids were removed, wicked, passed through ultra-pure water, re-wicked, and placed into 30 μL 30% ethanol for 30 s. Grids were finally re-wicked following this step, covered and allowed to dry for up to 24 h, prior to analysis via TEM.
Samples for TEM were viewed on a JEOL 1230 transmission electron microscope operated at 100.0 kV (spot size 1), equipped with a Megaview III digital camera from Soft Imaging Systems (SIS). Images were obtained on the iTEM universal TEM imaging platform software.
Aggregation assay. Aβ1-42 was purchased from Anaspec. The peptide was solubilized in sterilized PBS, 0.1% trifluoroacetic acid (TFA) at the concentration 2 mM and frozen in aliquots at -80 °C. Aliquots were diluted at the final concentration of 20 µM in a total volume of 400 µL containing 1 or 2.5 µM of affinity-purified recombinant CERTL (29). Samples were kept under rotarod shacking for 1, 2, 4, 8, 12 and 24 hours at 37 °C before adding 5 µL to 95 µL of thioflavin T (ThT) concentrated 20 µM, dispensed in 96 well optical plate and measuring fluorescent excitation at 450 nm and emission 486 nm in Victor X3 plate reader (Perkin-Elmer). Two Aβ antibodies against epitope 1-16 (6E10, Biolegend) and 17-24 (4G8, Biolegend) respectively were used to antagonize aggregation at a concentration of 0.1 mg/mL.
Toxicity assay. SH-SY5Y cells were seeded on a 96-well plate at a density of 3×104 cells per well in 1:1 DMEM:F12 with phenol red, 4 mM glutamine, 200 U/ml penicillin, 200 U/ml streptomycin, MEM non-essential amino acids (100×; Gibco) and 10% FBS, and incubated at 37 °C for 24 hours, reaching up to 100% confluency, with 5% CO2. After 24 hours, the medium was removed and replaced with 100 µl/well medium without phenol-red, containing 2% FBS and with 10 µM Aβ1-42 oligomers, and/or 1 µM CERTL, or alone to control wells and incubated for 24 hours. 10 µl of MTT (4 mg/ml) was added to each well and incubated at 37 °C for 3 hours. MTT solution was decanted and the formazan was extracted with 100 µl of 4:1 DMSO:EtOH. Plates were read at 570 nm, with a reference filter at 690 nm.
Generation of adeno-associates virus
Human collagen type IV alpha 3 binding protein cDNA sequence (hCERTL, 1875bp NP_005704.1) was cloned into the plasmid AAV-6P-SEW a kind gift of Prof. S. Kugler, Department of Neurology, University of Göttingen. The transgene expression was controlled by a human synapsin-1 promoter (hSYN, 480bp), and an internal ribosome entry site (IRES 566bp) enabled the co-expression of EGFP (37). The plasmid expressing exclusively EGFP was used as a control (pAAV-EGFP). The AAV-CERTL plasmid was sequenced by GATC Biotech laboratories and both AAVs plasmids were tested in vitro. AAVs particles were produced as explained previously (38). In brief, the transfer plasmids pAAV-EGFP or pAAV-CERTL were used to produce AAV2 particles. Eight 15-cm petri dishes each containing 1.25x107 HEK 293T cells in DMEM containing 10% fetal calf serum (FCS) and 1% Pen/Strep (all GIBCO-Invitrogen Corp., New York, NY, USA) were prepared one day before transfection. The medium was refreshed 1 hour prior to transfection to Iscove’s modified Eagle medium (IMEM) containing 10% FCS, 1% Pen/Strep, and 1% Glutamine. Transfer plasmids were co-transfected using polyethylenimine (PEI, MV25000; Polysciences Inc.) in a ratio of 1:3 with the pAAV-EGFP or pAAV-CERTL resulting in a total amount of 50 µg of plasmid DNA per plate. The day after transfection, the medium was replaced with fresh IMEM with 10% FCS, 1% PS, and 1% glutamine. Two days later (3 days post-transfection), cells were harvested in Dulbecco-PBS (D-PBS, GIBCO) and lysed with 3 freeze-thaw cycles. Genomic DNA was digested by adding 10 µg/ml DNAseI (Roche Diagnostics GmbH) into the lysate and incubated for 1 hour at 37 °C. The crude lysate was cleared by centrifugation at 4000 rpm for 30 minutes. The virus was purified from the crude lysate using the iodixanol gradient method, diluted in D-PBS/5% sucrose and concentrated using an Amicon 100kDa MWCO Ultra-15 device (Millipore). All AAV vectors were stored at -80 °C until use. Titers (genomic copies/ml) were determined by quantitative PCR on viral DNA primers directed against the EGFP portion (Forward: GTCTATATCATGGCCGACAA; Reverse: CTTGAAGTTCACCTTGATGC). The AAV particles produced with pAAV-CERTL are referred to in this paper as AAV-CERTL while the particles produced with pAAV-EGFP are named AAV-control.
Animals
In this study, male mice were used. To investigate transduction efficiency over time we employed 24 C57BL/6 wild type (WT) animals. B6/SJL WT and 5xFAD animals were obtained from the Jackson Laboratory and bred in house using 5xFAD x non-carriers. This breeding strategy may breed out the retinal degeneration allele Pde6brd1 from the original strain. The Jackson Lab has observed a less robust amyloid phenotype in this strainThe 5xFAD model carries 5 familial AD mutations, three of them in the human APP transgene (Swedish, Florida, and London), and two in the human presenilin-1 (PS1) transgene (M146L and L286V mutations). These mutations lead to an increase in Aβ peptide production (32). nimals were individually housed under a 12 h light/dark cycle in individually ventilated cages. One week before behavioral tests, animals were adjusted to a reversed day-night cycle. Food and water were provided ad libitum throughout the study. All experiments were approved by the Animal Welfare Committee of Maastricht University (project number DEC2013-056 and DEC2015-002) and followed the laws, rules, and guidelines of the Netherlands.
Stereotactic injection
The animals underwent bilateral stereotactic injections. Mice were placed in a stereotactic head frame, and after midline incision of the skin, two holes were drilled in the skull in the appropriate location using bregma and lambda as references. The layer V of the motor-sensory frontal cortex was targeted; this was verified by light microscopy to observe the dye. Coordinates were determined as follows: anterior-posterior [AP] 0.06; mediolateral [ML] +/- 0.15; dorsoventral [DV] -0.1 (39). The AAVs were injected at the dose of 1.12*108 transducing unit (t.u.) in the anesthetized mice at a rate of 0.2 μL / minute with a final volume of 1 μL for each side.
Behavioral procedures
The Open field (OF) task was performed as described elsewhere (40). Briefly, locomotion activity was assessed in a square divided into 4 equal arenas. At the start of a trial, the animals were placed in the center of each arena. The total distance traveled was measured under low light conditions by a video camera connected to a video tracking system (Ethovision Pro, Noldus).
The Y-maze spontaneous alternation (AYM) test was conducted to assess spatial working memory. Mice were placed randomly in one of the three arms of the Y-maze and were left free to explore the arena for 6 minutes. The number of arm entries and the number of triads were recorded in order to calculate the percentage of alternations to measure working memory.
The Elevated zero-maze (EZM) was used to measure anxiety. It consists of a circular runway which is divided equally into two opposite open and two opposite enclosed arms. The mice were placed into one of the open arms and allowed to explore the maze over a period of 5 minutes. The total and relative duration (in %) and distance traveled in the open and enclosed arms were measured in the dark via an infrared video camera connected to a video tracking system (Ethovision Pro, Noldus). Percentage of time spent in the open arms was corrected for latency to first closed arm entry.
The Y-maze spatial memory test (SYM) was performed using the same arena as described in AYM above. One arm of the arena was closed by a removable blockade placed in front of it. The mice were placed in one of the open arms, which was randomized over the groups and allowed to explore the 2 open arms of the maze for 5 minutes (pre-test). Afterward, the animal was taken from the arena and put back into its home cage. Five hours later, the mouse was placed back into its corresponding start arm of the arena, now with all three arms accessible (post-test). The previously blocked arm was termed the “novel arm”. Memory was evaluated by calculating the amount of time spent in the novel arm corrected for the latency to move from the start arm to another arm and the amount of time the animal spent in the center of the maze (41).
Immunofluorescence staining
Mice were sacrificed by intracardial perfusion using Tyrode's solution for the first minute, followed by fixation solution 4% paraformaldehyde (PFA) for 10 minutes under deep sodium pentobarbital anesthesia (150 mg/kg). The brains were removed and post-fixated overnight in 4% PFA fixation solution, and subsequently moved every 24 hours in a buffer containing a gradually higher sucrose percentage: 10% and 20% sucrose in 0.1 M PBS. Afterwards, brains were quickly frozen using CO2 and dissected into 16 μm thick sagittal sections using a cryostat (at -25 °C; Leica). All series of sections were subsequently stored at -80 °C until further processing. For the CERTS and neuron co-localization stain, we incubated the antibodies separately to reduce the antibody-antigen interaction. Before the antibodies incubation, the slice sections were fixed with acetone 10 minutes and blocked with 0.3% H2O2 for 1 h. The sections were incubated with a monoclonal NeuN primary antibody (1:50, chemicon international Inc, Temecula, CA, USA) overnight at 4 °C. Sections were washed 3 times with Tris buffered saline (TBS), TBS with 0.2% TritonX-100, and TBS. Subsequently, streptavidin Alexa 594 (1:500) applied for 1h at room temperature. Then rabbit polyclonal anti-CERTS (epitope 300-350, Bethyl Laboratories) diluted 1:250 was used to detect CERTS. After overnight incubation, and the corresponding secondary antibody Alexa Fluor- 647(1:100) was applied for 1 h at RT. The slices were mounted and stored in 4 °C before taking pictures. Next immunofluorescence co-labeling was performed with either rabbit IgG anti-Iba1 (Wako Pure Chemical Corporation) or mouse IgG anti-glial fibrillary acidic protein (GFAP) combined with human IgG anti-Aβ (42). Subsequently, the corresponding anti-rabbit or anti-mouse and anti-human secondary antibodies conjugated to Alexa Fluor-594 or 488 (Jackson ImmunoReseach Laboratories) were added for 2 hours. Washes were performed 3 times for 10 minutes in TBS, TBS with 0.2% TritonX-100, and TBS, respectively in between the antibody incubation steps. Densitometric analysis of the stainings were performed on sagittal brain sections at different lateral depth (6-9 sections per animal) with ImageJ. Microglia ramification and sphericity were analyzed as described (43).
Sphingolipid analysis
High pressure liquid chromatography-tandem mass spectrometry (HPLC-MS/MS). Neuro-2a (N2a) were maintained and prepared for HPLC-MS/MS as described in Supplementary methods. Powder aliquots of cortex, hippocampus, and cerebellum tissue or Neuro-2a (N2a) cell pellet were homogenized in PBS at the concentration of 10 µL / mg. Then, 50 µL of the brain preparation (or 25 µL of plasma) were used to measure Cer, sphinganine (SPA), sphingosine (SPH), sphingosine-1-phosphate (S1P) as previously described (44, 45). Briefly, brain preparation (or plasma) was spiked with internal standards mixture prior to undergoing extraction. Data acquisition was done using select ion monitor (SRM) after chromatographic separation and electrospray ionization on the Thermo TSQ Quantum Ultra mass spectrometer (West Palm Beach) coupled with a Waters Acquity UPLC system (Milford) for Cer, sphinganine (SPA), sphingosine (SPH), sphingosine-1-phosphate (S1P). SM data acquisition was done using multiple reaction monitoring after chromatographic separation and electrospray ionization on the Sciex Qtrap 5500 quadruple mass spectrometer (AB Sciex Inc., Thornhill, Ontario, Canada) coupled with a Shimadzu HPLC system (Shimadzu, Kyoto, Japan). Concentrations of each analyte were calculated against each corresponding calibration curve and corrected for internal standard concentrations.
Protein extraction
Mice were terminally anesthetized with sodium pentobarbital, perfused and the brain removed and dissected into cortex, hippocampus and cerebellum. Each brain region was then powdered in iron mortar partly emerged in liquid nitrogen, and aliquoted. Frozen tissue from dissected brains was sonicated in about 15 volumes (w/v) of TBS with PhosSTOP and protein inhibitors (Roche). Samples were centrifuged, and the TBS-soluble fraction was aliquoted prior to freezing in liquid nitrogen and stored at −80 °C in aliquots. The pellet was re-suspended by sonication for 10 seconds in about 15 volumes of TBS containing 1% Triton-X 100 (TBS-T) and protease inhibitor cocktail. Samples were centrifuged, and the TBS-T-soluble fraction and frozen in aliquots as described for the TBS fraction. The pellet was re-suspended in 70% formic acid to 150 mg/ml based on tissue weight, and mixed by rotation at room temperature for 2 h. Samples were centrifuged, and the formic acid-soluble fraction was neutralized (with 20 volumes of 1 M Tris base), and frozen in aliquots at −80 °C. Total protein content in the TBS and TBS-T extractions was determined with Bio-Rad DC (Life Science Group) protein assay following the manufacturer's instructions.
Aβ immunoassay and Western blot
Immunoassay. Microplates Microlon/F-shape REF 655092 (Greiner) were coated with 1 µg/mL of human 3D6 (29) overnight at room temperature in coating buffer (sodium carbonate pH=9.6 0.05 M NaCO3 in MQ water). After washing plates (washing buffer 0.05% Tween- 20 in PBS were blocked with 4% not fat dry milk and incubated with brain homogenates or with Aβ to generate the standard curve. Next plates were washed, incubated with 50 ng/mL of biotinylated human 20C2 (29) and washed again. Finally, plates were incubated with streptavidin-HRP (Jackson ImmunoResearch Laboratories) diluted 1:8,000 and developed using 3,3',5,5'-Tetramethylbenzidine (TMB). The absorption was measured at 450 nm within 30 minutes of stopping the reaction with 2 M H2SO4 using the Perkin Elmer 2030 manager system.
Western blot. TBS and TBS-T samples corresponding to 40 µg of total protein we loaded onto a precast TGX 4-16% gel (Bio-Rad). Then samples were transferred to PDVF membranes, blocked with Odyssey blocking buffer (LI-COR Bioscience) and probed with 1 µg / mL mAb anti-Aβ (6E10, Covance). After incubation with donkey anti-mouse IRdye680 (Rockland Immunochemicals) diluted 1:1,000 in Odyssey blocking buffer, the membrane was scanned and analyzed with the Odyssey imager. The intensities of the APP bands detected at 100 kDa, were measured with the Odyssey imager.
Reverse transcription polymerase chain reaction (RT-PCR)
Total RNA was isolated from 20-50 mg of cortex using Trizol reagent (Invitrogen). One microgram of total RNA was treated with DNAse I and transcribed into cDNA (Superscript III, Invitrogen). PCR was performed in duplicate with SensiMix™ SYBR® Low-ROX Kit (Bioline) using the set of primers reported in supplementary table 1. Fold changes of expression relative to control were determined after normalization to GAPDH and Actin. Fold change was calculated by the comparative Ct method (46).
Statistical analysis
Statistical analysis was performed using the Statistical Package for the Social Sciences (SPSS 23.0 SPSS Inc., Chicago, IL, USA). All graphs were designed in GraphPad Prism (version 5, GraphPad Software, San Diego, CA, USA). All data shown are expressed as mean ± standard error of the mean (SEM). Behavioral tasks, SLs, RT-PCR and cytokines data were analyzed with two-way analysis of variances (ANOVA) with AAV treatment and genotype as independent factors. Least Significant Difference (LSD) was used for post-hoc testing. Fluorescence Amyloid-β aggregation assays were analyzed with repeated measure ANOVA or ANOVA followed by Dunnett's multiple comparisons test. Comparison of mean values from two groups were performed by an unpaired two-tailed Student’s t-test or by Mann–Whitney U test for non-parametric testing. P-Values were considered as significant if p ≤ 0.05 and marked with (*). Results were marked with (**) if p ≤ 0.01, or (***) if p ≤ 0.001.