Recombinant antigen expression, purification and characterization
The VP2 protein contains a conserved main epitope that stimulates the production of antibodies. Therefore, the VP2 protein has been used to produce subunit vaccines. Amplification of FPV preserved in the laboratory with primers (FPV-VP2-Primer-F: CGCGGATCCATGAGTGATGGAGCAGTTCAAC; FPV-VP2-Primer-R: GCTCTAGATTAATGATGATGATGATGATATAATTTTCTAGGTGCTAGTTGAG) to obtain the recombinant VP2 protein coding sequence with His tag. The recombinant VP2 protein coding sequence was cloned and inserted into the pCold-Ⅰ vector and transformed into BL21.DE3. The FPV-VP2 expression plasmid was induced by IPTG, followed by growth at 16°C for 30 h. Bacterial cells were harvested and lysed by sonication to release proteins. The supernatant of the lysed cells was purified by a HisPur Ni NTA kit (Smart-Lifesciences, China). Through elution steps, imidazole in the buffer was used to dissociate the binding of the VP2 protein and nickel ions on the purification column. Then, ammonium sulfate was added to a final concentration of 20%, and the mixture was incubated at 4°C for 8 h. The mixture was centrifuged, and the precipitate was resuspended in PBS. Then, a 10 kDa dialysis bag was used to remove salt. The quality of the purified VP2 protein was evaluated by protein concentration determination, SDS‒PAGE analysis, WB and other experimental methods to confirm the purity and integrity of the protein.
Preparation of fluorescent microsphere probes
First, 100 µL of a 200 nm diameter fluorescent microsphere (PS-COOH Europium Chelate Microspheres, excitation: 340 nm; emission: 620 nm) suspension (Bangs Laboratories, Inc-FCEU002) was added to 900 µL of pure water, centrifuged at 14000 rpm for 25 min at 9°C and washed. The supernatant was removed, and the microspheres were resuspended in 1000 µL of pure water, centrifuged at 14000 rpm for 25 min at 9°C and washed for a second time. The supernatant was removed, and the microspheres were resuspended in 1000 µL of 20 mM pH 5.3 2-(Nmorpholino)-ethanesulfonic acid (MES) (Sigma‒Aldrich, China). If the microspheres aggregated after centrifugation, they were dispersed by ultrasonic dispersion for 5 min. Then, 25 µL of 10 mg/ml 1-ethyl-3-(3-dimethylaminopropyl) carbodiimide hydrochloride (EDC) (Thermo, China) was added to the washed microspheres and mixed quickly. Then, 25 µL of 10 mg/ml N-hydroxysulfosuccinimide sodium salt (NHS) (OKA, China) was added to the microspheres, mixed quickly, ultrasonicated for 5 min, and incubated at 37°C for 30 min. The mixture was centrifuged at 14000 rpm for 25 min at 9°C, and the supernatant was removed. The microspheres were resuspended in 1000 µL coupling buffer (20 mmol/L Tris-HCl, pH 8.0), the experiment compared the effects of different conjugation buffers: Tris buffer (20 mmol/Lol/L Tris-HCl, pH = 8.0) and HEPES (4-hydroxyethylpiperazine-1-ethanesulfonic acid) buffer (20 mmol/Lol/L HEPES, pH = 8.0) on the conjugation.. If the microspheres aggregated after centrifugation, they were dispersed by ultrasonic dispersion for 5 min.
Conjugation of fluorescent microsphere probes
Then, 20, 40, 60, and 80 µg of rabbit anti-cat antibody (Biodragon, China) were separately added to 1000 µg of activated microspheres and incubated at 37 ℃ for 2 h (resulting in 2, 4, 6, and 8 µg/100 µg of fluorescent microspheres), to compare the optimal conjugation ratio between antibodies and microspheres. Bovine serum albumin (BSA) was added to a final concentration of 1%, mixed quickly and incubated at 37 ℃ for 1 h. The microsphere-antibody mixture was centrifuge at 14000 rpm for 25 min. The supernatant was removed and the microspheres were resuspended with resuspension solution (0.12 g Tris; 5 g sucrose; 2.5 g trehalose; 1.5 g BSA; 40.88 g water; pH 8.5). If the microspheres aggregated after centrifugation, they were dispersed by ultrasonic dispersion for 5 min.
FM-ICTS assembly
The sample pad and conjugate pad were saturated with Tris-HCl buffer 1 (20 mmol/L Tris-HCl, 1% Triton X-100, 0.3% BSA, pH 8.0) and Tris-HCl buffer 2 (20 mmol/L Tris-HCl, 0.3% BSA, and 0.2% Tween-20, pH 8.0), respectively, and air-dried for 2 h. The conjugate pad was then coated with a fluorescent antibody (10 µL/cm), and the purified rVP2 proteins were diluted with 0.01 M PB to 0.9 mg/mL as the test line (T). Goat anti-rabbit IgG (Sangon Biotech, China) was used at 0.02 mg/mL as the control line (C). The test line and control line were then dispensed (1 µL/cm) along a nitrocellulose membrane. A membrane strip was arranged, from left to right, with a sample pad, conjugate pad, nitrocellulose membrane, and absorbent pad pasted onto a 300 × 80 mmol/L backing card. The card was cut longitudinally, divided into 4.0 × 80 mmol/L strips using a strip cutter, and stored in sealed bags under dry conditions at room temperature.
Sensitivity and specificity
Utilizing a serial dilution of twofold increments of feline serum with a determined FPV anticoagulant inhibitory titre of 1:1024, the sensitivity of FM-ICTS was assessed. A calibration curve was constructed by plotting each relative T/C value against the titres of FPV antibodies. Additionally, the specificity of the FM-ICTS was evaluated by examining serum samples containing closely related feline viruses (feline herpesvirus, feline calicivirus).
Accuracy and stability
To assess the intra- and inter-batch reproducibility of FM-ICTS, three batches of test strips were used to determine the T/C values of serum samples. Five replicates were performed for each sample. Additionally, a stability assessment of the FM-ICTS was conducted by storing the test strips at 25°C for 1, 3 months and evaluating the T/C ratio using standard reference sera.
Clinical evaluation
Finally, a total of 84 clinical samples from Jilin, China were analysed. The serum samples used in this study were primarily obtained from our laboratory's serum repository. Clinical serum samples were diluted 100-fold using 10 mmol/L PBS. Subsequently, 100 µL of the diluted sample was dispensed onto the FM-ICTS sample pad. Following a 20 min incubation period, quantitative analysis was performed by employing a dry immuno-fluorescence analyser to measure the fluorescence intensity at the T-line and C-line of the test strip. This validation aimed to confirm the clinical utility of the FM-ICTS. Additionally, these samples underwent HI test simultaneously for comparative assessment.
Results and conclusions
Preparation of diagnostic antigens
The E. coli cells containing the FPV-VP2 expression plasmid were induced with isopropyl-l-D-throgalactopyranoside (IPTG), followed by purification from subsequent growth culture using a 3 mL HisPur Ni NTA kit. Finally, analysis was conducted through SDS‒PAGE and Western blotting (WB) to characterize the purified protein (Fig. 2).
Optimal conjugation amount
The amount of antibody coupled to FM is a critical component of making FM-ICTS. It impacts coupling efficiency and analytical performance. Insufficient surface antibodies can result in inadequate probe affinity to the antigen, while excessive antibodies can lead to protein congestion, thereby reducing sensitivity. FM (100 µg) was prepared and coupled with varying ratios of rabbit anti-cat IgG (2, 4, 6, and 8 µg) to assess the optimal antibody quantity for coupling. As shown in Fig. 3B, when coupled at a ratio of 6 µg of rabbit anti-feline antibodies to 100 µg FM, the most robust fluorescence signal was observed at both the T-line and C-line. Consequently, we adopted this optimal coupling proportion of 6 µg rabbit anti-feline antibodies per 100 µg of fluorescent microspheres.
Selection of the coupling buffer
The hydrophobic nature of FM makes them prone to aggregation under certain conditions, e.g., microspheres with neutralizing charged groups. The combination of antibodies and microspheres necessitates suitable pH and ion strength conditions. The appropriate pH range typically lies between 6 and 9. Probe precipitation becomes likely when the ion strength surpasses 0.2 M. Thus, an inadequate ionic strength of the conjugation buffer may lead to FM aggregation, resulting in suboptimal coupling efficiency. The particles employed for conjugation should maintain stability and dispersion. To explore optimal working conditions, a comparison of two distinct commonly used conjugation buffer solutions (20 mmol/L Tris-HCl, pH 8.0; 20 mmol/L HEPES, pH 8.0) was conducted. When 20 mmol/L Tris-HCl solution (pH 8.0) was applied, the brightest fluorescent signal and T/C value were obtained (Fig. 3A). Therefore, 20 mmol/L Tris-HCl solution (pH 8.0) was chosen as the optimal coupling buffer in this study.
Optimal encapsulation amount
In conclusion, the test strip’s performance was enhanced by fine-tuning the quantities of substances embedded within the T and C lines. It was observed that an embedding quantity of 0.9 mg/mL for the VP2 protein on the T line and 0.06 mg/mL for the goat anti-rabbit antibody on the C line yielded the most robust correlation with the serum hemagglutination inhibition (HI) titre. Notably, the T/C ratio surpassed 1 for positive samples and remained below 0.5 for negative samples, facilitating reliable interpretation. This effect is attributable to the influence of the T and C lines’ embedding quantities on both the capture efficiency of the fluorescent microspheres and the background signal intensity. Embedding quantities that are either too high or too low compromise the assay’s sensitivity and specificity. Consequently, the selected embedding quantities of 0.9 mg/mL for the VP2 protein and 0.06 mg/mL for the goat anti-rabbit antibody represent the optimal conditions for the test strip’s application.
The test of sensitivity and specificity
As shown in Fig. 4A, the standard curve of antibody titres was determined using the variable slope model in GraphPad Prism 9 (Y = Bottom + (Top-Bottom)/(1 + 10^((LogEC50-X)*HillSlope)), R2 = 0.9733, Bottom = -2.354, Top = 1.311, LogEC50 = -0.3265, HillSlope = 1.000). Specificity experiments of the FM-ICTS were conducted using feline herpesvirus and feline calicivirus sera. The results indicated that the FM-ICTS can detect FPV-positive sera while exhibiting no cross-reactivity with other sera.
The test of accuracy and stability
Three batches of test strips were used to assess the T/C ratio of three standard serum samples. Five replicates were performed for each sample, and the coefficient of variation (CV) was calculated as SD/X × 100%. Both intra-batch and inter-batch CV values were below 11%, meeting precision requirements (Fig. 4B). Furthermore, a stability test of FM-ICTS packaged in aluminium foil bags was conducted by storing the test strips at 25°C for 1, 3 months and evaluating the T/C ratio using standard reference sera, yielding a CV < 12% (Fig. 4D). Comparable sensitivity and specificity were observed between processed and unprocessed test strips, confirming its favourable stability.
Clinical evaluation
As shown in Fig. 4C, among the 84 clinical samples tested, 66 were identified as FPV antibody-positive, and 18 samples were determined to be negative. The coagulation inhibition assay detected a total of 66 FPV antibody-positive samples and 18 negative samples (Table. 1). R-squared value of 0.8798 suggests that approximately 87.98% of the variance in the dependent variable can be explained by the independent variable(s). This indicates a strong relationship between the variables in the regression model. Consequently, FM-ICTS demonstrates commendable diagnostic specificity, sensitivity, and accuracy.
Table 1
Comparison of the FM-ICTS assay with HI test using 84 clinical serum samples
Assays | FM-ICTS | Total |
Positive | Negative |
HI test | |
Positive | 66 | 0 | 66 |
Negative | 0 | 18 | 18 |
Total | 66 | 18 | 84 |