Attenuation of c-Myc expression in breast cancer by hesperidin-mediated stabilization of its promoter proximal G quadruplex region

doi:10.21203/rs.3.rs-4275818/v1

Download PDF

Research Article

Attenuation of c-Myc expression in breast cancer by hesperidin-mediated stabilization of its promoter proximal G quadruplex region

https://doi.org/10.21203/rs.3.rs-4275818/v1

This work is licensed under a CC BY 4.0 License

Version 1

posted

You are reading this latest preprint version

The G-Quadruplex (G4) silencer element (Pu-27), an epigenetic regulator located upstream of the c-Myc promoter, when stabilized and restored to its basal expression, presents a potential avenue for effective anticancer therapy. This study investigates Hesperidin, a citrus flavanone, as a potential breast cancer therapy by targeting the c-Myc G-quadruplex (G4) silencer element, Pu-27. Hesperidin showed strong interaction with Pu-27, indicated by a binding score of -7.241 and the formation of hydrogen bonds with five regions of Pu-27 G4, with a binding free energy of -48.344 kcal/mol. Increasing Hesperidin concentration significantly increased Pu-27 G4 ellipticity and melting temperature, suggesting structural stabilization. Atomic force microscopy revealed higher-order nanostructure formation in Pu-27 G4 with Hesperidin. Functional assays demonstrated reduced Pu-27 primer dimer PCR product and mTFP expression with increasing Hesperidin concentration. Selective cytotoxicity against MDA-MB-231 breast cancer cells, attenuation of clonogenicity and migration, along with downregulation of c-Myc expression both in vitro and in vivo in mice tumor models, further supported Hesperidin's potential as a breast cancer therapeutic. These findings highlight Hesperidin's ability to interact with the c-Myc G4 element, influencing cancer cell behavior, and suggest its promise as a therapeutic agent for breast cancer.

c-Myc

G quadruplex

Hesperidin

Breast Cancer

Epigenetic Regulations

Natural polyphenols

Breast cancer is one of the leading reasons for cancer-related deaths and is the most frequently diagnosed cancer in women(1). Breast cancer progression is a multistep process involving genetic and epigenetic alterations that transform normal breast cells into highly malignant derivatives with metastatic potential. The c-myc gene expression is upregulated mainly in human breast carcinoma(2, 3). and has been documented to play a very prominent role in breast cancer progression and metastasis(4). Together with MAX (MYC Associated Factor X), the MYC protein forms a heterodimer and acts as a transcription initiation factor of several downstream genes involved in cell cycle progression and cellular metabolism and plays a pivotal role in cell survival and metabolism(4). For ages, the hyperactivated Myc oncoprotein has been proposed as an ideal drug target. Nevertheless, no specific drug is currently available to directly target Myc, mainly because of its “undruggable” properties: lack of enzymatic pocket for conventional small molecules and inaccessibility for antibodies due to the predominant nucleus localization of c-Myc (5). Thus, alternative strategies to downregulate Myc at its transcriptional and translational points are being widely explored as a potential strategy for the treatment of c-Myc-driven cancer(6).

The c-Myc promoter contains a 27 base pair nuclease hypersensitivity element III1 (NHE III1)rich in guanine base pairs(Pu-27), and that controls up to 80–90% of the transcriptional activity of this gene(7). The characteristic attribute of self-association and forming four-stranded helical structures of guanine has been known over long periods. These secondary structures are known as G-quadruplex (G4), which are guanine-rich and may contain one, two, or four strands of guanine tetrads. G-quadruplex is formed by the arrangement of planar G-quartets one over the other, thus forming four-stranded helical structures. G-quartets are created by the Hoogsten hydrogen bonding between four guanine structures. Polynucleotides can interact to form tetraplexes where G-quartets stack on each other to form a multi-layered structure. These structures are stabilized by Na⁺ and K⁺ which interact with guanine atoms in the center of the quartet plane(8). The NHEIII 1 has been documented to form a G-quadruplex consisting of a mixture of four loop isomers that act as a silencer element of the gene by hindering the progression of RNA polymerase. Nuclear Magnetic Resonance studies have reported this G -quadruplex as a propeller-type parallel structure consisting of three stacked G-tetrads and three double-chain reversal loops(7). Many recent reports suggest that Pu-27 is a potent target for silencing c-Myc expression by stabilizing the G quadruplex region in many cancer cell types(9). However, most of the studies reports about synthetic ligands used for these studies have been documented to show adverse side effects on normal cells(10).

Since ancient times natural products have played a dominant role in treating human ailments. Traditional remedies are majorly based on plants and nutraceuticals, moreover, natural products comprise a large portion of current-day pharmaceutical agents, especially in the areas of antibiotic and cancer therapies. More than 60% of the current anticancer drugs were derived in one way or another from natural source(11), however, the development of acquired resistance and adverse side effects demands the development of new ligands and strategies for cancer treatment. Nature continues to be an abundant source of bioactive agents while relatively few of the actual isolated natural products are developed into clinically effective drugs(12). Many studies have reported about the potential of some natural bioactive compounds like alkaloids and plant secondary metabolites as well as nutraceuticals to bind and stabilize the c-Myc G4 region(13–16), some of these bioactive nutraceuticals like curcumin and quercetin have indeed proven to depict promising anticancer potential for breast cancer treatment(17, 18); However, the potency of many bioflavonoids remains unexplored that could act as a core molecule for the synthesis of more efficacious analogs for breast cancer therapy. In this work, we have studied the effect of an anti-inflammatory flavanone glycoside hesperidin, which is widely found in citrus fruits like lemon and oranges(19), for its potency to target and stabilize the c-Myc G quadruplex region via in-silico molecular docking, M.D. simulation as well as in-vitro assays and also studied the anticancer activity of this nutraceutical in vitro on MDA-MB-231 breast cancer cell lines, which are reported show hyperactivated c-Myc expression in many previous articles(20, 21). The efficacy of this bioflavonoid in regulating c-Myc expression in mice tumor models was also studied.

Chemicals and reagents:

DMEM nutrient media (supplemented with 1 mM L-glutamine), bovine fetal serum, HAM's nutrient media, penicillin-streptomycin amphotericin mixture, and Trypsin-EDTA were purchased from Hi-Media, India. Hesperidin, Diamino Benzedine (DAB) and RNase were purchased from SIGMA USA. Agarose powder, Acridine orange, and ethidium bromide were obtained from Thermo Fischer; Primary antibodies against cMyc and β-actin, as well as anti-rabbit and anti-mouse secondary antibodies, were obtained from ABclone Technology (India) and Alexa Fluor™ 594 tagged anti-rabbit antibody was obtained from Invitrogen. Calf Thymus DNA (ctDNA)[10mg/ml] was obtained from Thermo Fischer. The list of oligonucleotides obtained from Eurofins Genomics (India) is listed in below:

Name Sequence

Pu-27 OLIGO F 5’-TGGGGAGGGTGGGGAGGGTGGGGAAGG-3’

Mutant PU-27 F 5’-TGGTTAGGTTGATATGGCTGGGGAAGG-3’

FA-Pu-27 OLIGO FAM 5’- TGGGGAGGGTGGGGAGGGTGGGGAAGG-3

[For fluorescence studies]

Pu 27 R 5’-TATCGATCGTTCTCGTCCTTCCCCA-3'

c-Myc F (in frame) 5’- AAAGGCCCCCAAGGTAGTTA − 3’

c-Myc R (in frame) 5’- GCACAAGAGTTCCGTAGCTG − 3’

β-Actin F (in frame) 5’- CATGTACGTTGCTATCCAGGC − 3’

β-Actin R (in frame) 5’- CTCCTTAATGTCACGCACGAT − 3’

In-silico docking analysis and Molecular Dynamics (M.D.) simulations:

In computational study, the structures of hesperidin and the c-myc G-quadruplex (PDB ID: 7KBV) were prepared using Ligprep and Protein Preparation Wizard, respectively. Hesperidin was then docked against the c-myc G-quadruplex structure using Glide with extra precision (XP) method, and three possible binding poses were generated for further analysis. Binding energy was subsequently calculated using Prime's MM-GBSA method to assess the stability of the interaction. Molecular dynamics (MD) simulations were conducted using Desmond, where the selected docked poses were simulated in an orthorhombic box with TIP4P water model and 0.15 M NaCl concentration, followed by a production run of 100 ns. Trajectory analysis was performed using Desmond's Simulation Event Analysis module to gain insights into the dynamics of the binding interaction.(22, 23).

Condition optimization for stabilizing G-quadruplex structure in vitro

The Pu-27 and Fa-PU-27 oligos were incubated at 95 ◦C for 5 mins in 50 mM Tris-HCl and 100 mM KCl at pH 7.4; the samples gradually cooled down to 37◦C, at which temperature it is incubated for an hour, aiming the formation of G quadruplex, then stored at 4◦C for future studies. The buffer above was used for all experiments with G quadruplex(24).

Steady-state fluorescence spectroscopy

Fluorescence measurements were carried out by using Shimadzu RF-6000 Spectrofluorometer. The Fa-Pu-27 G-quadruplex sample was excited at 495 nm, and the emission spectrum was recorded in the range of 500–600 nm with both excitation and emission bandwidth of 5 nm. The Fa -Pu-27 (50nm) was excited at 495nm, and emission spectra were recorded from 500-600nm in the presence of Hesperidin(5µM) from 0 min to 60 mins to determine the saturation time. After that, Fa-Pu-27 was incubated with different concentrations of hesperidin (0 to 1mM) for 45 mins each, before taking the reading. The Stern-Volmer equation (Eq. (1)) was used to analyze the fluorescence data, and the plots F0/F against [Q] were constructed.

F₀/F = 1 + K_SV [Q] (1)

where F₀ and F are the fluorescence intensities in the absence and presence of the quencher, respectively, whereas KSV is the Stern Volmer constant and Q is the ligand concentration. Binding affinity and number of binding sites were evaluated using a modified Stern Volmer equation (Eq. (2)).

log (F0 − F)/F = log K + n log[Q] (2)

K and n are the binding constants and number of binding sites, respectively. (25).

Circular dichroism spectroscopy

CD spectra were obtained using a Jasco-1500 spectrophotometer with a 1 mm path length cuvette and a Peltier system. Oligonucleotide Pu-27 (20 µM) in 10 mM potassium phosphate buffer (pH 7.0) with 100 mM potassium chloride was titrated with increasing Hesperidin concentrations (10–200 µM). Spectra were recorded at 25°C after 10 minutes of each addition. CD melting experiments, conducted in triplicate, varied the temperature from 25°C to 95°C at 5°C intervals for Pu-27 alone or with 20 µM and 80 µM Hesperidin. Melting curves were analyzed using a 'two-state transition' model to estimate melting temperatures (Tm) by fitting the fraction folded against temperature with a sigmoidal 3-parameter binding model.(16).

Drop deposition Raman spectroscopy

For drop deposition Raman measurements, a 0.1-µl aliquot of each G4 stock solution (10uM) prepared in the presence or absence of potassium was placed on a glass coverslip and allowed to dry at room temperature (~ 30 min). Raman spectra of the dried sample were collected with an Xplora Raman microscope (Horiba Scientific, Edison, NJ) using a 50× objective, 785-nm laser excitation, and 10-mW laser power at the sample. Ten spectra from a 15-µm line map with 1.5-µm steps and two 30-s exposures per point were averaged for each example. Spectra were then baseline corrected, and intensity normalized(26).

In-vitro PCR stop assay:

PCR stop assay is based on the principle that as the compound binds with the oligonucleotide sequence, its amplification is stopped further since the compound creates an obstacle for the Taq DNA polymerase enzyme, inhibiting its activity. Hence no further amplification occurs, and the bands disappear gradually with an increase in the compound concentration. EtBr intercalates to dsDNA. Since the binding of the compound decreases the amount of dsDNA during PCR, the intensity of bands decreases. PCR stop assay was carried out in the presence of oligonucleotides designed as mentioned above (set1-Pu-27 F and Pu-27 R, set2-mutant Pu-27 F with Pu-27R), containing complementary regions to anneal with each other during PCR. The PCR assay was performed in a final volume of 25µL reaction mixture containing 10mM Tris buffer, 50mM KCl, 10.0µmol of each oligonucleotide, 2.5 units of Taq polymerase with an increase in the concentration of Hesperidin (0 to 200µM). Reaction mixtures were incubated in thermal cycler Biorad (T100) with the following cycling conditions: 94°C for 2 min, followed by 30 cycles consisting of 94°C for 30 s, 58°C for 30 s, and 72°C for 30 s. Amplified products were resolved on a 3% agarose gel in 1X TAE and stained with EtBr. Gel Image was analyzed on gel doc(Biorad)(27). The approximate PCR product size with the primers (Pu-27 F/mutant Pu-27 F and Pu-27 Rev) has been around 43 base pairs (28).

Isothermal titration calorimetry (ITC) measurement:

The ITC measurements were performed at a constant temperature of 25°C using a MicroCal affinity isothermal titration calorimeter TGA550(WATERS^™). 4µL of Hesperidin was added at each step to the sample cell containing 25µM G-quadruplex DNA. The heats of dilution were also determined by injecting the same concentration of hesperidin into the same buffer. These heats of dilution were subtracted from the binding isotherm prior to fitting the curve. Heats were integrated and binding parameters were calculated according to an independent binding site model using NanoAnalyze software (WATERS^™) analysis that provides ΔH (reaction enthalpy change, kcal. mol^− 1), K_a (binding constant, M^− 1), and n (number of bound ligands) whereas the Gibbs energy and the entropic contribution were calculated using the relationships ΔG = −RT ln K_a and ΔG = ΔH − TΔS, respectively(29).

Fluorescent intercalator displacement assay:

To determine the mode of binding of Hesperidin with c-myc G quadruplex, an Ethidium Bromide (EtBr) displacement assay was performed. Initially, 2.5µM EtBr was saturated with 5µM of Pu-27 G-quadruplex in one set and double-stranded ct DNA(5µM) in another set having a sample volume of 200 µl and then both sets were titrated with increasing concentration of hesperidin. The excitation wavelength of EtBr was set at 510 nm and the emission profile was monitored at a range of 590–630 nm. The fluorescence of the sample was measured at 25°C in a JASCO fluorescence spectrophotometer. This method is based on the competition of an added compound with EtBr for DNA intercalation sites. The fluorescence intensity of EtBr increases upon DNA binding. The addition of a compound displacing intercalated EtBr leads to quenching the fluorescence caused by the EtBr/DNA complex. The percent of fluorescence decrease was plotted against the concentration (µM) of each compound and the C₅₀ value of each was determined.C50 is defined as the concentration of the added compound required to reduce the fluorescence of the EtBr/DNA complex to 50%(30).

Atomic Force Microscopy:

Atomic force microscopy (AFM) was performed on a Nanoscope IIIa scanning probe microscope (Bruker) from Digital Instruments in the tapping mode with NANOSENSORS™ PPP-NCHR AFM probes. AFM microscopy was performed on the fresh mica surfaces with the help of magnesium ions which can bind negatively charged DNA (Pu-27F and Pu-27 F mutant) strands. The Pu-27 (25 µM) samples were annealed in 100 mM K + solution at 4°C for one week in the presence or absence of hesperidin. The analytes were spread evenly on the mica surface for 5–8 min. Subsequently, the mica surface was washed with Milli-Q water to wipe off the excess salt and finally dried in the air(31).

Cell culture and maintenance:

Human epithelial breast cancer cell line (MDA-MB-231) (ATCC HTB-26) and non-carcinomas human embryonic kidney cells (HEK-293) were cultured in DMEM media; both the media were supplemented with 10% fetal bovine serum,0.2% NaHCO₃ and antimycotic solution (1mM penicillin,1mM Streptomycin, 1mM Amphotericin B) (pH – 7.4). The cells were cultured at 37°C in a humified incubator containing 5% CO₂.

Cytotoxicity assay:

The MDA-MB-231 and HEK 293 cells were treated with different concentrations of hesperidin, and the cytotoxicity induced by the compounds concerning untreated cells was measured by MTT assay. Cells were seeded in 96-well flat-bottom microtiter plates at a density of 1×10⁴cells/ml, incubated for 24 h, and then exposed to varying concentrations of the ligand for 48 hrs. After treatment, MTT (5 mg/ml) dissolved in PBS and filter sterilized was added to each well and incubated in a humidified 5% CO₂ incubator at 37°C for 4 h until violet crystals were visible. The crystals were then dissolved in 100 µl TritonX/well. The absorbance of the solution was measured at 570nm with a microtiter plate reader (Bio-Tek ELX800). Cell viability was calculated according to the following formula:

% inhibition = (100 – (A_t/A_s) × 100) %

A_t and A_s indicated the absorbance of the test substances and solvent control, respectively(32).

Cell cycle assay:

The MDA-MB-231 cells were plated in 60 mm culture dishes and hesperidin (0–100µM) was added and the cell were incubated for 48 hours. Thereafter the cells were harvested, fixed in ice-chilled methanol for at least 30 min at 4°C, and again incubated for 4 h at 37C in a PBS solution containing 1 mg/ml RNase A, and stained with propidium iodide, thereby the cell cycle progression patterns were measured and analyzed using the Beckman Coulter Cytoflex LX flow cytometer. (33).

AO/EtBr dual staining assay:

An equal number of MDA-MB-231 cells were plated on coverslips in a 6-well plate and incubated in the presence or absence of Hesperidin for 48hrs. After that, the cells were washed, stained with A.O./EtBr (1µl/ml), and observed under a fluorescence microscope. Acridine orange is a vital dye and will stain both live and dead cells. EtBr will stain only cells that have lost membrane integrity. Live cells will appear uniformly green. Early apoptotic cells will stain green and contain bright green dots in the nuclei due to chromatin condensation and nuclear fragmentation. Late apoptotic cells will also incorporate ethidium bromide and therefore stain orange, but, in contrast to necrotic cells, the late apoptotic cells will show condensed and often fragmented nuclei. Necrotic cells stain orange but have a nuclear morphology resembling viable cells, with no condensed chromatin(34).

In vitro scratch assay:

The cells were allowed to grow in a confluent monolayer in 35 mm cell culture dishes; with the help of a scale and p200 tip, the cell monolayers were scratched in a straight line, the debris washed, and these plates were photographed under the microscope. After that, the cells were grown in the presence or absence of hesperidin in varying concentrations for 48 hrs in a humified CO2 incubator, then the media were removed, and the same scratched regions were photographed after washing(35–37).

Colony formation assay:

The MDA-MB-231 cells were trypsinized and seeded in 6 well plates at a density of 200 cells/well. After 24 h, when the cells got attached to the substratum, the media was replaced, treatments were given for 48 hours, and new culture media was added after a PBS wash. The cells were then allowed to grow in standard culture conditions for 2 weeks without any drugs. After that, the colonies formed were photographed, fixed with 4% glutaraldehyde, and stained with 0.5% crystal violet; excess stained was washed, and the colonies formed were photographed. The colonies formed were quantified by dissolving the stained cells in methanol for colorimetric reading at 540 nM (33).

Semiquantitative RT PCR:

MDA-MB-231 cells were grown in a T-25 tissue culture flask and incubated with various concentrations of Hesperidin for 48 hours at 37°C in humidified 5% CO2 incubator. Total RNA was extracted from treated and control cells using HiPurA total RNA purification Kit (Himedia, India) following standard procedure, and cDNA was prepared from it using the iScript cDNA synthesis kit (Biorad, India), according to the manufacturer's protocol. A reverse transcriptase reaction was performed on Biorad TM100 thermal cycler. As mentioned in the reagents section, semi-quantitative PCR was performed using gene-specific primers (forward and reverse) with the respective forward and reverse primers. Equal amounts of each PCR product were run on a 2.5% agarose gel in 1X TAE, stained with EtBr, and visualized and quantified in gel doc(27).

c-Myc G quadruplex mTFP construction and it’s transfection:

The c-Myc G-quadruplex DNA sequence was incorporated upstream of the monomeric teal fluorescent protein (mTFP) gene within a pCAG-mTFP plasmid using PCR-based mutagenesis employing forward and reverse primers. The PCR product was purified and transformed into DH5α E. coli cells. Plasmid purification was performed using a commercial kit. HEK293 cells were cultured and seeded in 6-well plates until reaching 60–75% confluency was attained. The cells were then transfected with the pCAG-c-myc-mTFP plasmid using Lipofectamine 3000 following the manufacturer's protocol (Invitrogen Pvt. Ltd,). Following transfection, cells were treated with varying concentrations of Hesperidin. Fluorescence microscopy was subsequently employed to visualize and analyze cellular responses to the treatment(38) .

In-vivo animal experiment in mice model and treatment scheme:

15 Swiss albino mice (30 ± 5 g) were kept in institutional animal facility under controlled conditions and received food and water ad libitum. Experiments were carried out following institutional animal ethics committee approved protocol (Proposal No. IAEC-1774/BB-3/2019/12).EAC cells were maintained intaperitonially and after PBS wash, counted and 5×10⁶ cells were transplanted in the right flank of mice. After palpable tumor formation, mice were divided into three groups (N = 5/group). Group 1 was treated with Hesperidin (80 mg/kg) administered orally every other day for 15 days. Group 2 group was orally fed with 80 mg/Kg 5-FU. In Group 3 or vehicle treated control group, PBS was administered orally for the same period. The tumor volume was measured with digital calipers and calculated using the formula V = (A² × B) /2 (A = shortest diameter, B = longest diameter). The relative tumor volume (RTV) on day ‘n’ was calculated using RTV = TVn/TV0, where TVn is the Tumor volume on day n and TV0 is the Tumor volume on day 0. Tumor growth inhibition rate (TIR) was calculated by the following formula: TIR = {(1 − (mean volume of treated tumors)/mean volume of control tumors)} × 100%. Relative tumor volume (RTV) and tumor growth inhibition rate (TIR) were calculated in regular intervals, and treatment was continued upto 28 days, post which all mice were sacrificed (39).

Tissue morphology analysis by Haematoxylin and Eosin staining:

On day 28, tumor, kidney, and liver tissues were collected and fixed in formalin for 24 hours. Next tissues were washed in PBS and dehydrated overnight in 70% alcohol. Next day the tissues were incubated in 90% alcohol, acetone and xylene for 1 hour each. Then the tissues were incubated in liquid paraffin at 65°C for overnight. Tissue blocks were prepared and sectioned at 5 µm thickness with tissue microtome. For hematoxylin and eosin staining, sections were deparaffinized in xylene, rehydrated with decreasing downgrading alcohol concentrations and then stained with haematoxylin and eosin. Slides were dehydrated again with increasing alcohol concentration, cleared with xylene and mounted with DPX mountant for microscopical analysis of tissue morphology. (40, 41).

Immunohistochemical analysis:

The Paraffin-embedded tumor tissue sections were initially deparaffinized in xylene and then rehydrated through graded ethanols. Heat-induced antigen retrieval was performed by submerging the sections into citric acid buffer. Following this, sections were blocked with 10% bovine serum albumin and then incubated with c-Myc primary antibodies at 4°C overnight. Subsequently, after PBS wash, the sections were incubated with an HRP-conjugated secondary antibody for 2 hours, washed with PBS and developed using the DAB substrate kit from Abcam (ab64238). Finally, the sections were counterstained with hematoxylin, dehydrated, cleared, and mounted for analysis(42, 43).

Protein sample preparation and western blot:

MDA-MB-231 cells were cultured with varying concentrations of Hesperidin (20, 40, 80, 100µM) for 48 hours, with untreated cells serving as controls. Total protein was extracted from the cell samples using a whole protein extraction kit, and the protein concentration was determined using the Bradford method.(44) Western blot analysis for c-Myc protein expression was performed using a rabbit monoclonal anti-cMyc antibody (A19032), with β-actin used as a loading control (AC038).(33). For the tumor tissue samples (control, hesperidin and 5-FU treated), equal amount of each tissues (0.2g) were weighed, homogenised in 9 volumes of RIPA buffer containing NP-40. The homogenate was centrifuged at 12,000×g for 20 mins. The supernatant was collected and total protein content of each sample were measured by Bradford (Himedia) method according to kit protocol.

For Western blot analysis, c-Myc protein expression was assessed using a rabbit monoclonal anti-cMyc antibody (A19032, ABclonal), with β-actin used as a loading control (AC038, ABclonal). Equal amounts of total protein from each sample were separated by SDS-PAGE and transferred onto a PVDF membrane. The membrane was then blocked with 5% BSA in TBST for 1 hour at room temperature. Following blocking, the membrane was incubated with the primary antibody (anti-cMyc) overnight at 4°C with gentle shaking. After washing with TBST, the membrane was incubated with the appropriate secondary antibody conjugated with HRP for 1 hour at room temperature. Protein bands were visualized using an enhanced chemiluminescence (ECL) detection system.

Statistical analysis:

GraphPad Prism 7 software (La Jolla, CA, USA) was used for statistical analysis. Data were presented as mean ± standard deviation. Differences among groups were analyzed by a two-way analysis of variance (ANOVA). For all statistical tests, P < 0.05 were considered significant.

In-silico binding profile of Hesperidin with cMYC G quadruplex:

The binding energy (MMGBSA) and the binding score of the ligand and 7KBV complex were calculated from 10 separate docking assays in Schrodinger using Glide. Hesperidin was observed to interact with five different regions of 7KBV, namely guanine13,18,21, 22 and adenine 24, forming nonpolar hydrogen bonds (Fig. 1b). The docking score and binding energy from three separate experiments were calculated to be -7.241 Kcal/Mol and − 48.344Kcal/Mol, respectively. M.D. simulation assay for 100nsec using desmond depicted some fluctuations with time as tabulated in Supplementary Table 1; the docked structure was found to have average binding energy (dG bind) of -27.744 Kcal/mol (Fig. 1c). The bond interactions and distances also showed some variations with time (Fig. 1d-g, Table 1).

Table 1

Variation in bond interactions and bond distances between Hesperidin and 7KBV with time (25ns,50ns,75ns, and 100ns) acquired by M.D. simulation using Desmond
	7KBV-Hesperidin
Time (ns)	Nucleotide	Nucleotide atom	Hesperidin atom	Distance (Å)	Interaction type
25 ns	DA24	C2	O9	3.44	Aromatic H-bond
50 ns	DA25	O3	H17	1.91	hydrogen bond
	DG17	O6	H18	2.2	hydrogen bond
	DG18	O6	H19	1.74	hydrogen bond
	DG18	H1	O7	2.03	hydrogen bond
75 ns	DG23	N7	H17	2.06	hydrogen bond
	DG18	O6	H18	1.84	hydrogen bond
100 ns	DG22	N7	H0	2.13	hydrogen bond
	DA24	H61	O11	1.93	hydrogen bond
	DA15	H61	O6	2.3	hydrogen bond
	DG18	O6	H17	2.01	hydrogen bond

Raman Spectroscopy and CD spectra confirming G quadruplex formation:

The Pu-27 oligo (F) condition stabilized for G quadruplex formation (described in the methods section) in the presence or absence of potassium were tested for their signature G quadruplex bond formation by Raman spectroscopy, where the oligos contained in the presence of potassium depicted distinct sharp peaks at 1466(C8-N7 H2 Hoogsten bond vibration) and 1095 Po²⁻ vibrations involved in Hoogsten base pair, indicating quadruplex formation(45). Both these peaks were absent in oligo conditioned in the absence of potassium (Supplementary Fig. 1a). Likewise, the CD spectra of condition stabilized Pu-27 oligo (F) also depicted characteristics of parallel G quadruplex giving positive and negative maxima at around 260nm and 240nm respectively (supplementary Fig. 1b) (46, 47).

Hesperidin interacts with cMyc G quadruplex by stacking mode:

The Fa -Pu-27 (50nm) was excited at 495nm, and emission spectra were recorded from 500-600nm in the presence of Hesperidin (5µM) where the saturation time for Hesperidin, was observed to be about 45 mins (Supplementary Fig. 2). The fluorescence of Fa-Pu-27 was observed to decline when incubated with increasing concentration of Hesperidin (incubation for each concentration was 45mins). By using the stern Volmer equation, the K_a and n of Fa-Pu-27 and Hesperidin were calculated from the intercept and slope of the plot of log (F₀ − F)/F vs. log [Q]. The Stern Volmer constant of Hesperidin and Pu-27 was to be 3×10⁴ M^− 1, and the association constant (K_a) was observed to be 1.8(± 0.12)×10⁴ M^− 1 (Fig. 2a).

To determine the mode of interaction of Hesperidin, EtBr displacement assay was performed. EtBr is reported to bind with G-quadruplex DNA by end stacking mode(48). We observed a major increase in EtBr fluorescence intensity when complexed with Pu-27 G-quadruplex which declined steadily upon gradual addition of Hesperidin to this complex, indicating towards probable stacking mode of interaction between Hesperidin and Pu-27 G quadruplex by displacement of EtBr with C₅₀ (concentration of added compound required to reduce maximal EtBr fluorescence by 50%) of 60.38 ± 1.2µM (Fig. 2b). However, when titrated with ctDNA-EtBr complex, its C₅₀ was found to be 334.24 ± 2.5 µM (supplementary Fig. 3), indicating its relatively much low affinity towards double-stranded DNA.

Hesperidin augmented the ellipticity and thermal stability of Pu-27 G-quadruplex:

The CD spectrum of G-quadruplex in the absence and presence of Hesperidin was measured to examine any structural change that may be induced in Pu-27 structure upon binding with hesperidin. When Pu-27 (25µM) was titrated with increasing concentration of the ligand (0–80µM), the intensity of the positive band (at 260nm) increased with increasing hesperidin concentration, however, no change in the characteristic parallel G quadruplex spectrum was observed indicating unperturbed Pu-27 G-quadruplex conformation upon hesperidin binding (Fig. 2c). The addition of 20µM and 80µM of Hesperidin to Pu-27 G-quadruplex (Tm: 64.36 ± 1.36°C) increased the melting temperatures of the quadruplex structure to 70.97 ± 1.17°C (ΔTm:6 °) and 75.97 ± 1.82 (ΔTm:11°C) respectively indicating towards elevation in thermodynamic stability of c-myc G quadruplex on binding to hesperidin (Fig. 2d).

Thermodynamic spontaneity of Hesperidin – Pu-27 G- quadruplex binding:

The energetics of the binding reaction between hesperidin and Pu-27 G4 was analyzed using isothermal calorimetry, from the thermograms it can be inferred that binding reactions are associated with a significant amount of heat change (Fig. 2e, Table 2). The dissociation constant K_d (8.62 × 10^− 5 M^− 1) and association constant K_a(1.16×10⁴M⁻¹) of Pu-27 G4 - hesperidin complex is associated with negative enthalpy contribution (ΔH: -18.52 Kcal/mole) We also observed that Pu-27-hesperidin binding is associated with favorable entropic change (ΔS: -43.51Kcal) with overall negative DG (Table 3). The negative enthalpic contribution obtained from ITC reveals a probable stacking mode of interaction between hesperidin and Pu-27 G4 sequence. The negative value of DG indicates that the interaction of hesperidin-Pu-27 G4 is spontaneous.

Table 2

Thermodynamic parameters of Hespridin-Pu27 G4 binding derived from isothermal calorimetric titration:
Variable	Value
Kd (M^− 1)	8.62×10^− 5
n	1
ΔH (kcal/mol)	-18.52
ΔS (Kcal/mol·K)	-43.51
ΔG	-5.545
Ka(M^− 1)	1.16×10⁴

Atomic Force microscope images depicting variations in G-quadruplex nanostructure:

The formation of DNA supramolecular nanostructures was observed through AFM measurements. The small ellipsoids with average sizes of around 3.5nm in height and 90 nm in length corresponding to single G-quadruplex were observed for the Pu-27 F(25µM) structure when condition stabilized in 50 mM Tris-HCl and 100 mM KCl at pH 7.4 (Fig. 3a), however on incubating the Pu-27 F under the same condition in presence of Hesperidin (200µM) short bar shaped aggregate with an average height of 6 nm and 190 nm in length were observed corresponding to probable G4 dimer formation (Fig. 3b)[27]. The mutant Pu-27 F oligonucleotide however showed very few ellipsoid dots with an average height of 2.5 nm and 70nm length when the condition stabilized in the same buffer (Fig. 3c); likewise incubating this mutant oligonucleotide with hesperidin also did not depict significant change the size or structure of the ellipsoids (Fig. 3d).

Variation of in-vitro PCR stop assay products with different hesperidin concentrations:

In-vitro PCR stop assay depicted a steady decline in 43 bp PCR product (primer dimer) of set 1 (Pu-27 F and Pu-27R) with an increase in the concentration of Hesperidin (lane 3 to lane 7), however in set 2 (mutant Pu-27F and Pu-27R) no change in PCR product was observed with the rise in hesperidin dose (lane 3’ to 7’) (Fig. 3e). The first two lanes on both sides of the ladder represents the PCR products of single primers, P_f and P_r (lane 1,2) or mutant P_f and P_r (lane 1’ and 2’) respectively; these four lanes didn’t show the formation of dimer confirming the requirement of both primers for dimer formation.

Effect of Hesperidin on cell viability, cell cycle distribution phases, migration Potential, and Clonogenicity of MDA-MB-231 cells:

Cytotoxicity of Hesperidin was found to be much more in MDA-MB-231 breast cancer cells (IC₅₀-50 ± 2.9 µ M) than in non-carcinomas embryonic kidney cell line HEK293 with an IC₅₀ of 550 ± 5.5 µM, this assay’s selective toxicity towards breast cancer cells (Fig. 4a). Cell cycle assay using flow cytometry with Propidium iodide also indicated a rise in sub-G₀ cell population in MDA-MB-231 cells with an increase in Hesperidin dosage (0 to 100µM). Here at 25µM hesperidin treatment, the cells depicted an increase in cell population in the S phase (23.63 ± 1.4%), however with a further increase in dose, there was a substantial increase in sub G0 cell population (36.92 ± 2.46% with 50 µM and 49.66 ± 2.2% with 100 µM) indicating a decline in cell viability of MDA-MB-231 cells (Fig. 4e), these observations were further confirmed by A.O./EtBr dual staining where the number of orange-yellow cells increased with increasing concentration of Hesperidin indicating a rise in apoptotic and necrotic cells (Fig. 4b) here cells treated with 15 µM 5-Fluorouracil were used as a positive control. The colony formation assay also depicted a significant decline in colony numbers with increased hesperidin dosage (Fig. 4c, d). Likewise, the in-vitro scratch assay also indicated a decrease in the migration capacity of the cells with an increase in the Hesperidin dose (Fig. 4f).

Variation in c-myc expression at a transcriptional and translational level due to Hesperidin treatment in MDA-MB-231 cells:

Treatment of MDA-MB-231 cells with hesperidin caused a steady decline in c-myc RNA (measured by semi-quantitative RT PCR) in the cells with an increase in Hesperidin concentration. Treatment of the cells with 12.5µM of the compound caused around 30% reduction in c-Myc expression compared to control, which further reduced by 57%,63%, and 80% when treated with 25,50 and 100µM Hesperidin, here β-actin was used as a positive control, which did not show any significant change owing to Hesperidin treatment and were used to normalize the gene expression data. The decline in c-myc RNA depicts the inhibitory effect of the G-quadruplex binding compound Hesperidin on c-myc transcript formation which could probably be attributed to the stabilization of c-myc G quadruplex (Fig. 4g).

Likewise, a significant decline in cMyc protein expression was observed with a surge in hesperidin dose in MDA-MB-231 cells. The cMyc expression level declined significantly (20%,80%, and 92% compared to control with 25,50, and 100µM of Hesperidin treatment) with an increase in hesperidin dose. The expression of β-actin protein in MDA-MB-231 did not show any significant variation with an increase in Hesperidin dose (Fig. 4h). All these indicate specific downregulation of cMyc both at transcriptional and translational level in the MDA-MB-231 cells by Hesperidin.

Promoter G quadruplex (Pu27) targeted repression of c-Myc transcription by Hesperidin in cells:

The G-quadruplex forming sequence up to 24 base pairs were introduced upstream of a monomeric Teal Fluorescent Protein (mTFP) gene(38). The resulting plasmid was transfected into HEK293 cells, and a dose-dependent decrease in mTFP expression was observed upon treatment with increasing concentrations of Hesperidin. These findings suggest that Hesperidin binds to the G-quadruplex, potentially influencing the downstream expression of mTFP protein (Fig. 5a,b).

In vivo Efficacy of Hesperidin treatment in tumor volume regression:

The impact of Hesperidin treatment on tumor formation in mice was investigated by examining solid tumors obtained from groups treated with vehicle, Hesperidin, and 5-fluorouracil (5-FU). Tumor volume and relative tumor volume were assessed at various time points. On the 28th day, the relative tumor volume was 3.35 for the control group, 1.74 for the Hesperidin-treated group, and 1.32 for the 5-FU-treated group. Hesperidin treatment resulted in a mean tumor growth inhibition of 48.86% compared to the vehicle-treated control, indicating its efficacy in inducing tumor regression. In comparison, 5-FU treatment demonstrated a tumor growth inhibition of 60.6%. (Fig. 6a, b)

Hesperidin treatment demonstrated significant histopathological changes in tumor tissues without affecting vital organs:

Histopathological examination of tumor tissues revealed notable differences among the experimental groups. The control group exhibited a high density of densely packed tumor cells, contrasting with Hesperidin-treated mice where a significant reduction in tumor cell density and increased necrotic areas were observed. In comparison, the 5-FU treated mice, serving as the positive control group, displayed the highest degree of necrosis within tumors compared to untreated controls (Fig. 6c, panel 1). Interestingly, neither the control nor the Hesperidin-treated group showed substantial histological changes in liver or kidney tissues (Fig. 6c, panel 2) whereas 5-FU treatment groups showed marked toxicity, as observed from liver and kidney histology. Liver tissues from the 5-FU treated groups exhibited steatosis, characterized by fat accumulation within hepatocytes, as well as ruptured central vein areas (black arrow) and irregular sinusoidal arrangements. Kidney histology of 5-FU treated mice revealed damaged and reduction of renal corpuscles (Fig. 6c, panel 3).

Variations in c-Myc expression in tumor tissues:

Immunohistochemistry of tumor sections revealed a significant reduction in c-Myc expression in mice treated with hesperidin and 5-FU compared to untreated controls (Fig. 6d). Western blot analysis of tumor tissue lysates also confirmed a pronounced attenuation in c-Myc expression in hesperidin and 5-FU treated mice compared to controls (Fig. 6e).

Despite the increased expression of c-Myc in many cancer types, no clinically approved therapies that target this gene currently exist, the major challenge for direct inhibition of cMyc function is that it is an essential, pleiotropic transcription factor that controls the expression of hundreds of genes, although some of the small molecules like 10058-F4 have been evaluated in-vitro to prevent MYC-MAX protein dimerization(49), however, these molecules did not depict effective results in-vivo and are currently being studied, in this scenario the only alternative strategy being clinically used are drugs, targeting the cMyc downstream signaling pathways(50), although the synthetic lethality of many such drugs is still being evaluated. Therefore, the current scenario demands the development of new drugs that could downregulate c-Myc gene expression effectively in cancer cells with low synthetic toxicity.

The unique nature of c-Myc G quadruplexes has established it as a new target for epigenetic regulation of c-Myc expression. The findings presented in this study shed light on the promising potential of hesperidin, a citrus flavanone, as a novel therapeutic agent for downregulating c-Myc expression in cancer cells. The study utilized a combination of computational modeling, in vitro assays, spectroscopic analysis, and in vivo experiments to elucidate the mechanism of action and efficacy of hesperidin in targeting c-Myc G-quadruplexes. The in silico docking and molecular dynamics simulations revealed strong interactions between hesperidin and c-Myc G-quadruplexes, indicating the binding potential of hesperidin to the c-Myc promoter proximal G-quadruplex region. Subsequent in vitro assays, including dose-dependent fluorescence quenching and isothermal calorimetry, confirmed stable interactions between hesperidin and c-Myc G-quadruplexes, suggesting the involvement of hydrogen bonding and Van der Waals forces in the binding process. Circular dichroism spectroscopy and melting temperature analysis further supported the formation of stable c-Myc G-quadruplexes in the presence of hesperidin, indicating its ability to stabilize the secondary structure of c-Myc G-quadruplexes. Atomic force microscopy images demonstrated larger nanostructure formation of c-Myc G-quadruplexes in the presence of hesperidin, highlighting its potential to induce structural changes in c-Myc G-quadruplexes. Moreover, hesperidin exhibited selective binding to c-Myc G-quadruplexes, inhibiting Taq Polymerase progression and downstream mTFP expression, thus suggesting its potential as a therapeutic agent for targeting c-Myc expression. Importantly, hesperidin demonstrated efficacy in downregulating c-Myc expression both in vitro and in vivo, with minimal toxicity observed in vital organs.The chemoprotective capacities of Hesperidin have been demonstrated in many previous studies(51, 52), however, the evidence of this study points towards downregulation of c-Myc expression by Hesperidin presumably, due to its preferential binding and stabilization of the c-Myc promoter proximal G-quadruplex region.The identification of hesperidin as a potent inhibitor of c-Myc expression through its interaction with c-Myc G-quadruplexes opens up new avenues for the development of targeted therapies for c-Myc-driven cancers. Given the crucial role of c-Myc in regulating gene expression and promoting tumorigenesis, the ability of hesperidin to downregulate c-Myc expression holds promise for the treatment of various cancer types. Furthermore, the selective binding of hesperidin to c-Myc G-quadruplexes suggests its potential for targeted delivery and precision medicine approaches in cancer treatment. Hesperidin's favorable pharmacological properties, including its anti-inflammatory and antioxidant effects(53), further enhance its attractiveness as a therapeutic agent for cancer. Moreover, additional preclinical studies are warranted to assess the efficacy and biocompatibility of hesperidin in diverse cancer models, including patient-derived xenografts and genetically engineered mouse models. Understanding the potential synergistic effects of hesperidin with other anticancer agents or conventional therapies could also enhance its therapeutic efficacy in clinical settings.

The authors declare no conflict of interests

Acknowledgments:

SDC is willing to acknowledge CSIR, Govt of India for RA fellowship [File No.-09/0667(11122)/2021-EMR-I. The work was supported by grant from CSIR, Govt of India [File No.-09/0667(11122)/2021- EMR-I]. BB is willing to thank the Director, CNCI for intramural funding and ICMR-Govt of India for extramural funding (Project File no. 17X(3)/Adhoc/87/2022-ITR) pertaining to this work. DC is willing to acknowledge ICMR-Govt of India for extramural funding (Project File no. 17X(3)/Adhoc/63/2022-ITR).

All animal experiments were performed following the protocol approved by the Institutional animal ethical committee of Chittaranjan National Cancer Institute, Kolkata (Proposal No. IAEC-1774/BB-3/2019/12)

Author contributions:

DC, SDC: Conceptualization; SDC, SG, BB, PK, RG, AB, KS, AS: performed the experiments; SDC, SG, PK, AK, DC: analyzed the results; SG, DC, BB, RG, AK: resource generation; DC: Project administration; SDC: manuscript drafting; SDC, SG, PK, KS: figure preparation; All: Manuscript approval.

Chen Y, Olopade OI (2008) MYC in breast tumor progression. Expert Rev Anticancer Ther 8:1689–1698
Liao DJ, Dickson RB (2000) c-Myc in breast cancer. Endocr Relat Cancer 7:143–164
Xu J, Chen Y, Olopade OI (2010) MYC and Breast Cancer. Genes Cancer 1:629–640
Escot C, Theillet C, Lidereau R et al (1986) Genetic alteration of the c-myc protooncogene (MYC) in human primary breast carcinomas. Proc Natl Acad Sci U S A 83:4834–4838
Wang C, Zhang J, Yin J et al (2021) Alternative approaches to target Myc for cancer treatment. Signal Transduct Target Ther 6:117
Delmore JE, Issa GC, Lemieux ME et al (2011) BET bromodomain inhibition as a therapeutic strategy to target c-Myc. Cell 146:904–917
Yang D, Hurley LH (2006) Structure of the biologically relevant G-quadruplex in the c-MYC promoter. Nucleosides Nucleotides Nucleic Acids 25:951–968
Bhattacharyya D, Mirihana Arachchilage G, Basu S (2016) Metal Cations in G-Quadruplex Folding and Stability. Front Chem 4:38
Zhang J, Wang T, Geng X, Liu L, Gao J (2022) Identification of Trovafloxacin, Ozanimod, and Ozenoxacin as potent c-Myc G-quadruplex stabilizers to suppress c-Myc transcription and myeloma growth. Mol Inform
Cunha BA (2001) Antibiotic side effects. Med Clin North Am 85:149–185
Newman DJ, Cragg GM (2012) Natural products as sources of new drugs over the 30 years from 1981 to 2010. J Nat Prod 75:311–335
Cragg GM, Pezzuto JM (2016) Natural Products as a Vital Source for the Discovery of Cancer Chemotherapeutic and Chemopreventive Agents. Med Princ Pract 25(Suppl 2):41–59
Che T, Wang YQ, Huang ZL, Tan JH, Huang ZS, Chen SB (2018) Natural Alkaloids and Heterocycles as G-Quadruplex Ligands and Potential Anticancer Agents. Molecules 23.
Zenkov RG, Kirsanov KI, Ogloblina AM et al (2022) Effects of G-Quadruplex-Binding Plant Secondary Metabolites on c-MYC Expression. Int J Mol Sci 23
Tawani A, Mishra SK, Kumar A (2017) Structural insight for the recognition of G-quadruplex structure at human c-myc promoter sequence by flavonoid Quercetin. Sci Rep 7:3600
Roy A, Chatterjee O, Banerjee N et al (2022) Curcumin arrests G-quadruplex in the nuclear hyper-sensitive III(1) element of c-MYC oncogene leading to apoptosis in metastatic breast cancer cells. J Biomol Struct Dyn 40:10203–10219
Barcelos KA, Mendonca CR, Noll M, Botelho AF, Francischini CRD, Silva MAM (2022) Antitumor Properties of Curcumin in Breast Cancer Based on Preclinical Studies: A Systematic Review. Cancers (Basel) 14
Ezzati M, Yousefi B, Velaei K, Safa A (2020) A review on anti-cancer properties of Quercetin in breast cancer. Life Sci 248:117463
Miles EA, Calder PC (2021) Effects of Citrus Fruit Juices and Their Bioactive Components on Inflammation and Immunity: A Narrative Review. Front Immunol 12:712608
Chen J, Yuan YW, Zhang JR, Zhou DY (2002) [Up-regulation of c-myc expression in MCF-7/Adr human breast cancer cells and its association with resistance against doxorubicin]. Di Yi Jun Yi Da Xue Xue Bao 22:124–126
Wu Y, Sato H, Suzuki T et al (2015) Involvement of c-Myc in the proliferation of MCF-7 human breast cancer cells induced by bHLH transcription factor DEC2. Int J Mol Med 35:815–820
Borkotoky S, Meena CK, Murali A (2016) Interaction Analysis of T7 RNA Polymerase with Heparin and Its Low Molecular Weight Derivatives - An In Silico Approach. Bioinform Biol Insights 10:155–166
Ivanova L, Tammiku-Taul J, Garcia-Sosa AT, Sidorova Y, Saarma M, Karelson M (2018) Molecular Dynamics Simulations of the Interactions between Glial Cell Line-Derived Neurotrophic Factor Family Receptor GFRalpha1 and Small-Molecule Ligands. ACS Omega 3:11407–11414
Del Mundo IMA, Zewail-Foote M, Kerwin SM, Vasquez KM (2017) Alternative DNA structure formation in the mutagenic human c-MYC promoter. Nucleic Acids Res 45:4929–4943
Pattanayak R, Basak P, Sen S, Bhattacharyya M (2016) Interaction of KRAS G-quadruplex with natural polyphenols: A spectroscopic analysis with molecular modeling. Int J Biol Macromol 89:228–237
Pagba CV, Lane SM, Wachsmann-Hogiu S (2010) Conformational changes in quadruplex oligonucleotide structures probed by Raman spectroscopy. Biomed Opt Express 2:207–217
Ma DL, Chan DS, Fu WC et al (2012) Discovery of a natural product-like c-myc G-quadruplex DNA groove-binder by molecular docking. PLoS ONE 7:e43278
Li Z, Liu C, Huang C et al (2016) Quinazoline derivative QPB-15e stabilizes the c-myc promoter G-quadruplex and inhibits tumor growth in vivo. Oncotarget 7:34266–34276
Musetti C, Krapcho AP, Palumbo M, Sissi C (2013) Effect of G-quadruplex polymorphism on the recognition of telomeric DNA by a metal complex. PLoS ONE 8:e58529
Szumilak M, Merecz A, Strek M, Stanczak A, Inglot TW, Karwowski BT (2016) DNA Interaction Studies of Selected Polyamine Conjugates. Int J Mol Sci 17
Yan Y, Cao Y, Xiao C, Li Y, Xiang X, Guo X (2018) 5'-(CGA) (n) sequence-assisted pH-controlled assembly of supramolecular DNA nanostructure. R Soc Open Sci 5:180123
Choudhury D, Ganguli A, Dastidar DG, Acharya BR, Das A, Chakrabarti G (2013) Apigenin shows synergistic anticancer activity with curcumin by binding at different sites of tubulin. Biochimie 95:1297–1309
Datta S, Choudhury D, Das A et al (2019) Autophagy inhibition with chloroquine reverts paclitaxel resistance and attenuates metastatic potential in human nonsmall lung adenocarcinoma A549 cells via ROS mediated modulation of beta-catenin pathway. Apoptosis 24:414–433
Liu K, Liu PC, Liu R, Wu X (2015) Dual AO/EB staining to detect apoptosis in osteosarcoma cells compared with flow cytometry. Med Sci Monit Basic Res 21:15–20
Grada A, Otero-Vinas M, Prieto-Castrillo F, Obagi Z, Falanga V (2017) Research Techniques Made Simple: Analysis of Collective Cell Migration Using the Wound Healing Assay. J Invest Dermatol 137:e11–e16
Kaur P, Sharma AK, Nag D et al (2019) Novel nano-insulin formulation modulates cytokine secretion and remodeling to accelerate diabetic wound healing. Nanomedicine 15:47–57
Attri K, Chudasama B, Mahajan RL, Choudhury D (2023) Therapeutic potential of lactoferrin-coated iron oxide nanospheres for targeted hyperthermia in gastric cancer. Sci Rep 13:17875
Pandya N, Khan E, Jain N et al (2021) Curcumin analogs exhibit anti-cancer activity by selectively targeting G-quadruplex forming c-myc promoter sequence. Biochimie 180:205–221
Kaur P, Ghosh S, Bhowmick A et al (2022) Bacterioboat-A novel tool to increase the half-life period of the orally administered drug. Sci Adv 8:eabh1419
Deleanu B, Prejbeanu R, Crișan D et al (2015) Subtrochanteric Fracture as First Sign of Metastatic Breast Cancer: Case Presentation. J Med Cases 6:367–372
Sharda D, Ghosh S, Kaur P, Basu B, Choudhury D (2023) Chitosan-insulin nano-formulations as critical modulators of inflammatory cytokines and Nrf-2 pathway to accelerate burn wound healing. Discov Nano 18:154
Liu C, Billet S, Choudhury D et al (2021) Bone marrow mesenchymal stem cells interact with head and neck squamous cell carcinoma cells to promote cancer progression and drug resistance. Neoplasia 23:118–128
Cheng R, Billet S, Liu C et al (2020) Periodontal inflammation recruits distant metastatic breast cancer cells by increasing myeloid-derived suppressor cells. Oncogene 39:1543–1556
Bradford MM (1976) A rapid and sensitive method for the quantitation of microgram quantities of protein utilizing the principle of protein-dye binding. Anal Biochem 72:248–254
Li Y, Han X, Zhou S et al (2018) Structural Features of DNA G-Quadruplexes Revealed by Surface-Enhanced Raman Spectroscopy. J Phys Chem Lett 9:3245–3252
Lee S, Kim J, Han S, Park CJ (2020) Recognition and Unfolding of c-MYC and Telomeric G-Quadruplex DNAs by the RecQ C-Terminal Domain of Human Bloom Syndrome Helicase. ACS Omega 5:14513–14522
Del Villar-Guerra R, Trent JO, Chaires JB (2018) G-Quadruplex Secondary Structure Obtained from Circular Dichroism Spectroscopy. Angew Chem Int Ed Engl 57:7171–7175
Koeppel F, Riou JF, Laoui A et al (2001) Ethidium derivatives bind to G-quartets, inhibit telomerase and act as fluorescent probes for quadruplexes. Nucleic Acids Res 29:1087–1096
Huang MJ, Cheng YC, Liu CR, Lin S, Liu HE (2006) A small-molecule c-Myc inhibitor, 10058-F4, induces cell-cycle arrest, apoptosis, and myeloid differentiation of human acute myeloid leukemia. Exp Hematol 34:1480–1489
Horiuchi D, Kusdra L, Huskey NE et al (2012) MYC pathway activation in triple-negative breast cancer is synthetic lethal with CDK inhibition. J Exp Med 209:679–696
Ahmadi A, Hosseinimehr SJ, Naghshvar F, Hajir E, Ghahremani M (2008) Chemoprotective effects of hesperidin against genotoxicity induced by cyclophosphamide in mice bone marrow cells. Arch Pharm Res 31:794–797
Parhiz H, Roohbakhsh A, Soltani F, Rezaee R, Iranshahi M (2015) Antioxidant and anti-inflammatory properties of the citrus flavonoids hesperidin and hesperetin: an updated review of their molecular mechanisms and experimental models. Phytother Res 29:323–331
Aggarwal V, Tuli HS, Thakral F et al (2020) Molecular mechanisms of action of hesperidin in cancer: Recent trends and advancements. Exp Biol Med (Maywood) 245:486–497

No competing interests reported.

SupplementaryMaterials.docx
GraphicalAbstract.tif
Graphical Abstract: Hesperidin mediated stabilisation of G-quadruplex region in c-Myc promoter gene leads to downregulation of c-Mycexpression resulting in cancer cell death and tumor regression.

Download PDF

Version 1

posted

You are reading this latest preprint version

Attenuation of c-Myc expression in breast cancer by hesperidin-mediated stabilization of its promoter proximal G quadruplex region

Status:

Version 1

Abstract

Figures

INTRODUCTION

MATERIALS AND METHODS

Chemicals and reagents:

In-silico docking analysis and Molecular Dynamics (M.D.) simulations:

Condition optimization for stabilizing G-quadruplex structure in vitro

Steady-state fluorescence spectroscopy

F0/F = 1 + KSV [Q] (1)

Circular dichroism spectroscopy

Drop deposition Raman spectroscopy

Isothermal titration calorimetry (ITC) measurement:

Fluorescent intercalator displacement assay:

Atomic Force Microscopy:

Cell culture and maintenance:

Cytotoxicity assay:

Cell cycle assay:

AO/EtBr dual staining assay:

Colony formation assay:

Semiquantitative RT PCR:

c-Myc G quadruplex mTFP construction and it’s transfection:

Tissue morphology analysis by Haematoxylin and Eosin staining:

Immunohistochemical analysis:

Protein sample preparation and western blot:

Statistical analysis:

RESULTS

Raman Spectroscopy and CD spectra confirming G quadruplex formation:

Hesperidin interacts with cMyc G quadruplex by stacking mode:

Hesperidin augmented the ellipticity and thermal stability of Pu-27 G-quadruplex:

Thermodynamic spontaneity of Hesperidin – Pu-27 G- quadruplex binding:

Atomic Force microscope images depicting variations in G-quadruplex nanostructure:

Variation of in-vitro PCR stop assay products with different hesperidin concentrations:

Promoter G quadruplex (Pu27) targeted repression of c-Myc transcription by Hesperidin in cells:

In vivo Efficacy of Hesperidin treatment in tumor volume regression:

Hesperidin treatment demonstrated significant histopathological changes in tumor tissues without affecting vital organs:

Variations in c-Myc expression in tumor tissues:

DISCUSSION

Declarations

References

Additional Declarations

Supplementary Files

Status:

Version 1

F₀/F = 1 + K_SV [Q] (1)