Enhanced Sensitivity of Non-Small-Cell Lung Cancer with Acquired Resistance to Epidermal Growth Factor Receptor-Tyrosine Kinase Inhibitors to Phenformin: The Roles of a Metabolic Shift to Oxidative Phosphorylation and Redox Balance

doi:10.21203/rs.3.rs-427767/v1

Download PDF

Research

Enhanced Sensitivity of Non-Small-Cell Lung Cancer with Acquired Resistance to Epidermal Growth Factor Receptor-Tyrosine Kinase Inhibitors to Phenformin: The Roles of a Metabolic Shift to Oxidative Phosphorylation and Redox Balance

https://doi.org/10.21203/rs.3.rs-427767/v1

This work is licensed under a CC BY 4.0 License

Version 1

posted

You are reading this latest preprint version

Background

Although the efficacy of epidermal growth factor receptor-tyrosine kinase inhibitor (EGFR- TKI) therapy has been proven in non-small cell lung cancer (NSCLC) patients, acquired resistance to EGFR-TKIs presents a serious clinical problem. Hence, the identification of new therapeutic strategy is needed to treat EGFR-TKI-resistant NSCLC.

Methods

Acquired EGFR-TKI resistant lung cancer cell lines (HCC827, H1993 and H292 cells with acquired resistance to gefitinib or erlotinib) were used for cell-based studies. IncuCyte live cell analysis system and XFp analyzer were used for the determination of cell proliferation and energy metabolism, respectively. In vivo anti-cancer effect of phenformin was assessed in xenografts implanting HCC827 and gefitinib-resistant HCC827 (HCC827 GR) cells.

Results

HCC827 GR and erlotinib-resistant H1993 (H1993 ER) cells exhibited different metabolic properties compared with their respective parental cells, HCC827 and H1993. In EGFR-TKI-resistant NSCLC cells, glycolysis markers including the glucose consumption rate, intracellular lactate level, and extracellular acidification rate were decreased; however, mitochondrial oxidative phosphorylation (OXPHOS) markers including mitochondria-driven ATP production, mitochondrial membrane potential, and maximal OXPHOS capacity were increased. Cell proliferation and tumor growth were strongly inhibited by biguanide phenformin via targeting of mitochondrial OXPHOS complex 1 in EGFR-TKI-resistant NSCLC cells. Inhibition of OXPHOS resulted in a reduced NAD⁺/NADH ratio and intracellular aspartate levels. Recovery of glycolysis by hexokinase 2 overexpression in erlotinib-resistant H292 (H292 ER) cells significantly reduced the anti-cancer effects of phenformin.

Conclusion

Long-term treatment with EGFR-TKIs causes reactivation of mitochondrial metabolism, resulting in vulnerability to OXPHOS inhibitor such as phenformin. We propose a new therapeutic option for NSCLC with acquired EGFR-TKI resistance that focuses on cancer metabolism.

Cancer Biology

Oncology

EGFR-TKI resistance

Metabolic switching

NSCLC

Phenformin

OXPHOS

Glycolysis

Epidermal growth factor receptor-tyrosine kinase inhibitors (EGFR-TKIs) such as gefitinib and erlotinib have generally been used in non-small cell lung cancer (NSCLC) patients as first-line targeted therapy since 2003, and their prognosis has significantly improved with the targeted therapy. Unfortunately, long-term treatment with EGFR-TKIs frequently causes resistance to targeted therapy, which led the development of second- and third-generation EGFR-TKIs that avoid point mutations in the EGFR tyrosine kinase domain (1). The T790M point mutation in EGFR exon 20 was reported as a major cause of EGFR-TKI resistance (1, 2). Consequently, diverse resistance research was conducted on the H1975 NSCLC cell line carrying the T790M mutation, and a third-generation EGFR-TKI, osimertinib (Tagrisso®), which targets T790M, has been approved by the United States Food and Drug Administration as first-line therapy for metastatic lung cancer patients with an EGFR exon 19 deletion or L858R mutation (3). However, acquired resistance to EGFR-TKIs may not be solely due to point mutations in some patients (2). Although several molecular mechanisms for acquired resistance to EGFR-TKIs have been suggested, clinically available new therapeutic strategies are still needed (1).

Because a principal hallmark of cancer cells is rapid growth, a sufficient supply of nutrients is a critical requirement for cancer cells. Therefore, understanding cell type-specific metabolic processes that consume or use nutrients in cancer is important and could offer potential target(s) for cancer chemotherapy. After the discovery of the Warburg effect (metabolic dependency on glycolysis even under aerobic conditions), metabolic reprogramming in tumors has been extensively studied, and several clinically effective targets for controlling cancer cell-specific metabolism have been identified (4, 5). In the present study, a new therapeutic strategy for treating EGFR-TKI-resistant NSCLC that focuses on cancer metabolism is proposed and the pharmacological efficacy of phenformin, a biguanide agent was elucidated.

Reagents and Antibodies

Antibodies recognizing Hexokinase I (C35C4), Hexokinase II (C64G5), phospho-pyruvate kinase isozymes M2 (PKM2)(Tyr105), PKM2 (D78A4), α-tubulin, phospho-EGFR (Tyr1068)(1H12), phospho-AKT (Ser473), and phospho-p44/42 mitogen-activated protein kinase (MAPK)(Thr202/Tyr204) (20G11) were purchased from Cell signaling Technology (Danvers, MA, USA). Anti-Pyruvate Dehydrogenase E1-alpha subunit (S293) and total OXPHOS human antibody cocktail was obtained from Abcam (Cambridge, United Kingdom). Anti-glyceraldehyde-3-phosphate dehydrogenase (GAPDH) was supplied from Millipore (Burlington, MA, USA) and anti-Flag was purchased from Sigma Aldrich (St. Louis, MO, USA). Epidermal growth factor (EGF), sodium 2-oxobutyrate (AKB), and L-aspartic acid were supplied from Sigma Aldrich. Gefitinib and osimertinib were obtained from MedChemExpress (Monmouth Junction, NJ, USA). Erlotinib, phenformin and rotenone were purchased from Cayman (Ann Arbor, MI, USA).

Cell culture and establishment of stably Hexokinase II overexpressing H292-ER cells

Human lung cancer cells H1993, H1993 ER, H292, and H292 ER cells were kind gifts of Dr. Sang Kook Lee (Seoul National University, Seoul, Republic of Korea). HCC827, HCC827 GR, H1975, H1993, H1993 ER, H292 and H292 ER cells were cultured in RPMI 1640 medium (Hyclone, Logan, UT, USA) with 10% fetal bovine serum (Biowest, MO, USA) and 1% penicillin/streptomycin (100 U/mL, Hyclone). All cells were maintained in an incubator humidified 5% CO₂ at 37°C.

To establish hexokinase II stably overexpressing cells, pCAG-Flag-HK2-IRES-Blas plasmid was transfected to H292 ER cells using Lipofectamine 2000 as specified by the manufacturer’s instruction (Invitrogen, Carlsbad, CA, USA). Colonies were selected by incubation with blasticidin (15 µg/mL, Invitrogen). pCAG-Flag-IRES-Blas vector was used for mock transfection. pCAG-Flag-IRES-Blas and pCAG-Flag-HK2-IRES-Blas plasmids were kindly donated from Dr. Hong-Duk Youn (Department of Molecular Medicine & Biopharmaceutical Sciences, Graduate School of Convergence Science, Seoul National University, Seoul, Republic of Korea).

Cell proliferation

Cells were seeded in 96-well plate (2×10³ cells/well) and cultured for 72 h. To determine cell proliferation, real time scanned phase contrast images were acquired and integrated confluence was analyzed by IncuCyte® ZOOM™ Live Cell Analysis system (Essen BioScience, Ann Arbor, MI, USA).

Genomic DNA Sequencing

Genomic DNA from lung cancer cell lines was extracted with lysis buffer [10% Sodium dodecyl sulfate (SDS), 100 mM NaCl, 100 mM ethylenediaminetetraacetic acid (EDTA), 50 mM Tris (pH 8.0)] and proteinase K (15 mg/mL). Exon 18–21 region of EGFR gene were amplified by polymerase-chain-reaction (PCR). Thermal cycler settings include an initial denaturation at 95°C for 3 min followed by 40 cycles of denaturation at 95°C for 20 sec, annealing at 59.1°C for 10 sec, and extension at 72°C for 30 sec. Primers for exon 18 (sense: CAAATGAGCTGGCAAGTGCCGTGTC, antisense: GAGTTTCCCAAACACTCAGTGAAAC), exon 19 (sense: GCAATATCAGCCTTAGGTGCGGCTC, antisense: CATAGAAAGTGAACATTTAGGATGTG), exon 20 (sense: CCATGAGTACGTATTTTGAAACTC, antisense: CATATCCCCATGGCAAACTCTTGC), and exon 21 (sense: CTAACGTTCGCCAGCCATAAGTCC, antisense: GCTGCGAGCTCACCCAGAATGTCTGG) were used, and capillary electrophoresis sequencing was performed in Macrogen (Seoul, South Korea).

Immunoblot analysis

After washing with cold sterile PBS, cells were lysed with lysis buffer containing 20 mM Tris-Cl (pH 7.5), 1% Triton X-100, 137 mM sodium chloride, 1 mM sodium orthovanadate, 10% glycerol, 2 mM EDTA, 25 mM β-glycerolphosphate, 1 mM phenylmethylsulfonylfluoride, 2 mM sodium inorganic pyrophosphate and 1 µg/ml leupeptin. Total cell lysates were separated using SDS polyacrylamide gel and electrophoretically transferred to nitrocellulose membranes. After serial incubation of the membranes with primary antibodies and horseradish peroxidase (HRP)-conjugated anti-IgG antibodies, the membranes were exposed to enhanced chemiluminecence (ECL) reagent (Millipore, Burlington, MA, USA) and images were obtained using LAS3000 mini (Fujifilm, Tokyo, Japan).

2-deoxyglucose (2-DG)-uptake assay

Cells seeded in 96-well plate (2×10⁴ cells/well) were incubated with 1 mM 2-DG for 10 min. 2-deoxyglucose-6-phosphate (2-DGP) was determined using Glucose uptake-Glo assay kit (Promega, Madison, WI, USA) following the manufacturer’s instruction.

Determination of NAD⁺/NADH ratio

Cells were plated in 96 well plate and treated with indicated concentration of phenformin for 24 h. Using NAD⁺/NADH Glo Assay (Promega), NAD⁺/NADH ratio was calculated (14).

Determination of glucose consumption in culture medium

Cell culture media were collected 24 h after incubation and 1000-fold diluted solution was achieved by adding ice-cold 50% methanol. The solution was introduced to 1 equivalent volume of chloroform for phase separation. Samples were vortexed for 10 s and subsequently centrifuged at 16,000 rcf for 5 min. The upper hydrophilic phase was transferred to a microcentrifuge tube and the extraction was repeated once with the remaining lower phase. Collected hydrophilic phase were dried under gentle stream of nitrogen. Dried samples were reconstituted with 100 µL methoxyamine hydrochloride (20 mg/mL, Sigma Aldrich) in pyridine and incubated at 37°C for 90 min. Following cool-down, samples were introduced to 100 µL N,O-bis(trimethylsilyl)trifluoroacetamide solution with 1% trimethylchlorosilane (Sigma Aldrich) and derivatized at 60°C for 40 min. Glucose contents were analyzed by the Shimadzu GCMS-QP2010 (Tokyo, Japan) system equipped with DB-5MS (30 m, 0.25 mm, 0.25 µm; Agilent Technologies, DE, USA). Inlet temperature was set at 270°C and the samples were injected in split mode (1:2). Column oven temperature was maintained as following gradient: 0 min, 80°C; 2 min, 80°C; 7 min, 100°C; 10 min, 100°C; 35 min, 200°C; 36 min, 200°C; 48.5 min, 300°C; 50.5 min, 300°C. Mass scan ranged from 40 to 600 m/z with 3.06 scan/s of scan rate. Absolute quantitative values were calculated with peak area based on calibration curve by external glucose standard solutions and normalized by total protein contents.

Determination of intracellular lactate and aspartate levels

The sample injection volume was 5 µL and peak separation was performed on a Hypersil GOLD C₈ (2.1 x 150 mm, 5 µm, Thermo scientific, Waltham, MA) maintained at 30℃. The analysis was performed to gradient condition using Agilent 1290 infinity Ⅱ system with autosampler, column oven and binary pump (HPLC water containing 0.01% (v/v) formic acid, A; 100% methanol, B) and flow rate was 0.2 ml/min. LC-MS/MS data were acquired with an Applied Biosystems SCIEX 4000 QTRAP hybrid triple quadrupole-linear ion trap mass spectrometer equipped with a Turbo V ionization source. The detection was conducted using multiple reaction monitoring (MRM) of the transitions of m/z 89 > 43 for lactate, m/z 132 > 88 for aspartate, and m/z 157 > 112 for ¹³C₅, D₅, ¹⁵N-glutamate (ISTD) in the negative ion mode. Acquisition and analysis data were performed with Analyst® software (ver.1.6.2; Applied Biosystems, Foster City, CA, USA).

Determination of mitochondria ATP production rate, oxygen consumption rate (OCR) and extracellular acidification rate (ECAR)

OCR and ECAR were determined using XFp analyzer (Seahorse Bioscience, North Billerica, MA, USA). XFp cell mito-stress test kit, XFp glycolysis stress test kit and XFp Real-Time ATP rate assay kit (Seahorse Bioscience) were used to detect OCR, ECAR and ATP ratio, respectively. All the reagents and assay conditions were followed by manufacturer’s instructions.

RNA preparation and RNA sequencing

Total RNA was extracted from HCC827 and HCC827 GR cells using TRIzol reagent (Invitrogen). Purity and concentration of RNA samples were evaluated by Nanodrop Lite (Thermo scientific, MA, USA), and transcriptome RNA-sequencing of the samples was performed by Macrogen.

Transmission Electron Microscopy

Cells were fixed with karnovskys fixative and fixed with 2% osmium tetroxide. 0.5% uranyl acetate was used for staining, and propylene oxide and ethanol were used for dehydration. By using spurr's resin, cells were embedded and polymerized at 70ºC. After embedding, blocks were trimmed with ultramicrotome (EM UC7, Leica, Wetzler, Germany) and detected with Transmission Electron Microscope (JEM1010, JEOL, Tokyo, Japan).

Xenograft assay

Five-week-old male Balb/c-nu mice were supplied from Raon Bio Inc. (Seoul, South Korea). Animal studies were performed according to the institute regulation and approval from Seoul National University Institutional Animal Care and Use Committee (Approval #: SNU-170717-6-1). Mice were kept in SNU semi pathogen-free animal facility, with five mice in each cage. After anesthesia with Zoletil®/Rompun® mixture, 3.5×10⁶ HCC827 or 3×10⁶ HCC827 GR cells were inoculated on right flanks of mice. One week after inoculation, the mice were randomly divided into two groups [Vehicle control group and phenformin treatment group (300 mg/kg/day, P.O.)]. Animal number in xenograft study is 6–10 per group. Mice were monitored every other day, tumor length and width were detected by calipers and tumor volume was calculated using the formula (length×width²)×0.5. Animals were sacrificed by carbon dioxide inhalation in euthanasia chamber.

Statistics

Student’s t-test was performed to compare difference between two groups. One-way ANOVA and Tukey’s post hoc was used to analyze differences in multiple comparison. Statistical analysis was calculated using SigmaPlot (version 12.5). The statistical significance was accepted at *P < 0.05, ** P < 0.01 and *** P < 0.001; ^#P < 0.05, ^##P < 0.01 and ^###P < 0.001.

Long-term treatment with EGFR-TKIs induces acquired resistance with downregulation of EGFR signaling in lung cancer cells

Gefitinib-resistant NSCLC HCC827 (HCC827 GR) cells were established via long-term exposure of the cells to stepwise escalation of gefitinib. HCC827 GR cells exhibited resistance to gefitinib at a level similar to that in H1975 cells (T790M mutation). Other lung cancer cell lines, H1993 (NSCLC) and H292 (mucoepidermoid lung cancer) cells, also exhibited resistance to erlotinib after long-term treatment (H1993 ER and H292 ER, respectively) (Figure 1A). Osimertinib, a third-generation EGFR-TKI, strongly inhibited H1975 cell proliferation but marginally affected cell proliferation in the lung cancer cell lines with acquired EGFR-TKI resistance (HCC827 GR, H1993 ER, and H292 ER) (Figure1B). Because various mutations in the EGFR tyrosine kinase domain associated with gefitinib resistance have been reported (6), DNA sequencing of EGFR exons 18 to 21 was performed for HCC827, HCC827 GR, H1975, H1993, H1993 ER, H292, and H292 ER cells. An exon 19 deletion mutation and inherited gefitinib resistance, T790M, were found in HCC827 and H1975 cells, respectively (Figure 1C). However, mutations were not detected in all the lung cancer cells with acquired EGFR-TKI resistance tested (Figure 1C). Furthermore, EGF-induced phosphorylation of EGFR (Tyr1068) and its downstream kinases, phosphorylation of AKT (Ser473) or p44/p42 MAPK (Thr202/Tyr204), was not observed or was weaker in the three acquired-resistance cells compared with their parental cell lines. In addition, the EGFR tyrosine kinase-inhibiting effects of gefitinib, erlotinib, and osimertinib were weaker (Figure 1D). Conversely, EGFR phosphorylation and its downstream signals were successfully suppressed by osimertinib but not by gefitinib or erlotinib in H1975 cells (T790M)(Figure 1D). The results showed that the acquisition of EGFR-TKI resistance by lung cancer cells led to relatively minimal effects on EGFR activity, and these cells subsequently exhibited decreased sensitivity to EGFR-TKIs, even osimertinib.

Glycolysis activity is decreased in lung cancer cells with acquired EGFR-TKI resistance

EGFR signaling promotes aerobic glycolysis in triple-negative breast cancer (TNBC) (7), and the inhibition of EGFR reverses the Warburg effect and reactivates oxidative phosphorylation (OXPHOS) in NSCLC cells (8). Because EGFR signaling is suppressed in the three acquired-resistance lung cancer cell lines (HCC827 GR, H1993 ER, and H292 ER), we examined glucose metabolism in these cancer cells. The 2-DG uptake assay showed that glucose uptake in all three resistant cancer cell lines was decreased (Figure 2A), and the glucose consumption assay showed that the amount of glucose remaining in the culture medium was higher in HCC827 GR cells compared with HCC827 parental cells (Figure 2B). Using the XFp analyzer with a glycolysis stress kit, changes in the extracellular acidification rate (ECAR) representing glycolysis were estimated. After exposed to the same amount of glucose (10 mM), HCC827 GR and H1993 ER cells showed less changes compared with their parental cells (Figure 2C). Furthermore, expression levels of enzymes involved in glycolysis (HK1, HK2, and GAPDH) were lower in the two resistant cell lines (HCC827 GR and H1993 ER) (Figure 2D), whereas the dimer (inactive) form of Tyr105-phosphorylated PKM2 was slightly reduced in HCC827 GR and H1993 ER cells (Figure 2D). Notably, H292 ER cells lacked both HK1 and HK2, first-step enzymes in glycolysis, and the Tyr105-phosphorylated PKM2 level was upregulated (Figure 2D), indicating that glycolysis dysfunction in the H292 ER cells was mainly due to HK1/2 defects. The mRNA expression associated with the glycolysis gene set was further analyzed using RNA sequencing for both HCC827 and HCC827 GR cells. However, mRNA expression patterns associated with glycolysis in the two cell types did not exhibit any specific trends (Figure 2E). Although metabolic differences were not clearly identified at the mRNA or protein level in glycolytic enzymes, the metabolic data indicate that glycolysis capacity was decreased in the lung cancer cells with acquired EGFR-TKI resistance.

Reactivation of mitochondrial OXPHOS function in lung cancer cells with acquired EGFR-TKI resistance

Because glycolysis is the main energy process using glucose in rapidly growing cancers, glycolysis is considered a hallmark of cancer (Warburg effect) (9). However, the role of mitochondrial OXPHOS in cancer progression has also been studied (4,5,10,11). Because EGFR inhibition induces the re activation of mitochondrial OXPHOS in NSCLC cells (8), and the lung cancer cells with acquired EGFR-TKI resistance exhibited decreased EGFR kinase signaling activities (Figure 1), OXPHOS activities in the three lung cancer cell lines with acquired EGFR-TKI resistance were compared with those in their parental cell lines. Using the XFp analyzer with a cell mito-stress test kit, oxygen consumption rate (OCR) changes were monitored after treatment with OXPHOS modulators (1.5 mM oligomycin, 0.5 mM trifluoromethoxy carbonylcyanide phenylhydrazone (FCCP), and a mixture of 0.5 mM rotenone and 0.5 mM antimycin A). ATP-linked mitochondrial respiration increased in HCC827 GR and H1993 ER cells compared with their parental cells (Figure 3A). In H292 ER cells, maximal respiration in mitochondria increased but ATP-associated respiration did not change significantly compared with the parental cells (Figure 3A). Then, the ATP production ratio was compared between glycolysis and OXPHOS using the XFp analyzer with an ATP real-time rate assay kit. ATP production in the HCC827 cells was highly dependent on glycolysis (88.75%), but not on OXPHOS (11.25%). However, HCC827 GR cells had more ATP production that depended on mitochondrial OXPHOS (27.14%) than did HCC827 cells (Figure 3B). Mitochondrial membrane potential is induced by a proton pump in OXPHOS and regarded as an essential component during mitochondrial ATP production. Mitochondrial membrane potential in HCC827 and HCC827 GR cells was analyzed via staining with tetramethylrhodamine methyl ester (TMRM, red dots). As shown in Figure 3C, total integrated red fluorescence intensity versus cell confluence was significantly higher in HCC827 GR cells. Conversely, the basal intracellular level of lactate, the end product of glycolysis, was significantly decreased in HCC827 GR cells compared with HCC827 cells (Figure 3D). Inhibition of OXPHOS can cause a compensative increase in glycolysis resulting in the conversion of pyruvate to lactate. The lactate level increased in phenformin (OXPHOS inhibitor)-treated HCC827 GR cells; however, a difference in HCC827 cells was not detected (Figure 3D). These results indicate that mitochondrial OXPHOS activity was reactivated in the NSCLC cell lines with acquired EGFR-TKI resistance (HCC827 GR and H1993 ER). Next, we assessed morphological changes in the mitochondria as well as the protein and mRNA expression of OXPHOS subunits. Transmission electron microscopy images showed no differences in the size and number of mitochondria in both HCC827 and HCC827 GR cells (Figure 3E). The expression of OXPHOS subunit proteins (complex 2, 3, 5) was slightly increased in HCC827 GR cells compared with HCC827 cells; however, expression in H1993 ER and H292 ER cells was not significantly different from that in their parental cells (Figure 3F). The distribution of expression levels of different mRNAs associated with OXPHOS subunits were viewed as a MA plot. Significant fold-changes between HCC827 and HCC827 GR cells were not found (Figure 3G). The data indicated that increased OXPHOS capacity in EGFR-TKI-resistant NSCLC is associated with enhanced mitochondrial function but not with changes in related gene expression.

Inhibition of proliferation in lung cancer cells with acquired EGFR-TKI resistance is caused by phenformin

Biguanides, the most prescribed anti-diabetic agents, have been recognized for their anti-cancer effects, and many clinical trials are currently in progress (12–15). The repositioning of biguanides as anti-cancer agents is attracting much attention due to the cost benefit and minimal safety issues. In a recent study, the combination of osimertinib with phenformin delayed osimertinib resistance in a preclinical NSCLC model (16). We hypothesized that phenformin, an OXPHOS complex 1 inhibitor, would selectively inhibit the proliferation of lung cancer cells with acquired EGFR-TKI resistance that mainly employ mitochondrial OXPHOS. A prototype biguanide, phenformin, more effectively inhibited the proliferation of HCC827 GR and H1993 ER cells than their parental cell lines (Figure 4A). However, the growth-inhibiting effect of phenformin was not enhanced in H292 ER cells compared with H292 cells (Supplemental Figure 1A), which is consistent with the data showing no difference in ATP-associated OCR change (Figure 3A). Next, the potential mechanism by which phenformin inhibits the proliferation of EGFR-TKI-resistant NSCLC cells was assessed. Because OXPHOS is required for aspartate biosynthesis in proliferating cells (17,18), intracellular aspartate level was measured after exposing HCC827 and HCC827 GR cells to phenformin. The intracellular aspartate level decreased to a greater extent in HCC827 GR cells than in HCC827 cells after exposure to phenformin (Figure 4B). Inhibition of aspartate biosynthesis occurs due to an imbalance in the NAD⁺/NADH ratio. When the cellular NAD⁺/NADH ratio was measured, phenformin-mediated NAD⁺/NADH imbalance was only observed in HCC827 GR cells (Figure 4C). a-Ketobutyrate (AKB) is a representative electron acceptor that participates in regenerating NAD⁺(17). The addition of both AKB and aspartate partially alleviated the growth-inhibiting effects of phenformin in HCC827 GR cells (Figure 4D). To assess if mitochondrial OXPHOS complex I is a target of phenformin, the effects of rotenone, a potent OXPHOS complex 1 inhibitor, were investigated. As expected, rotenone exerted strong growth-inhibiting effects in HCC827 GR cells, and its anti-proliferative effect was reversed with AKB treatment (Figure 4E). To evaluate the anti-cancer effects of phenformin in vivo, Balb/c nude mice were implanted with HCC827 or HCC827 GR cells. In xenografts inoculated with HCC827 GR cells, oral administration of phenformin (300 mg/kg/day) significantly reduced tumor growth derived from HCC827 GR cells. Conversely, phenformin administration did not significantly affect tumor growth in xenografts inoculated with HCC827 cells (Figure 4F and 4G).

Reversal of anti-cancer effects of phenformin is caused by glycolysis reactivation in lung cancer cells with acquired EGFR-TKI resistance

Because the reactivation of OXPHOS in most of the lung cancer cell lines with acquired EGFR-TKI resistance was observed, we hypothesized that phenformin sensitivity could be diminished by the restoration of glycolysis (Warburg effect) in the resistant cell types. Hexokinase (HK) is a first-step glycolytic enzyme that converts glucose into glucose 6-phosphate. Among the five HK isoforms, HK2 is highly expressed and functions as the predominant form in cancer cells (19). Because HK2 and HK1 expression was absent in H292 ER cells (Figure 2D), we hypothesized that HK enzyme deficiency is a key event for the metabolic shift to OXPHOS in H292 ER cells. HK2-overexpressing H292 ER cells (H292 ER-HK2) were established by transfection with a flag-tagged human HK2 overexpression vector (Figure 5A). XFp analysis with a glycolysis stress test kit showed that ECAR changes representing glycolysis and its capacity were greater in H292 ER-HK2 cells compared with mock-transfected cells (Figure 5B). The ATP production ratio from glycolysis also increased from 63.55% to 83.22% (Figure 5C). Furthermore, the inhibitory effects of phenformin on the proliferation of H292 ER cells were significantly decreased by HK2 overexpression, indicating that enhanced glycolysis reduces the anti-cancer effects of phenformin in lung cancer cells with acquired EGFR-TKI resistance (Figure 5D).

EGFR overexpression has been detected in approximately half of NSCLC patients and is associated with poor prognosis, whereas EGFR-TKIs such as gefitinib and erlotinib significantly increase the survival rate of patients without serious side effects (6). Unfortunately, most patients acquire resistance to EGFR-TKIs within 6–12 months (20, 21). Several heterogeneous mechanisms, such as de novo mutation, amplification, and downstream pathway activation of EGFR or the activation of bypass pathways (e.g., pathways involving c-Met, Axl, insulin-like growth factor receptor, and other members of the EGFR family), explain the acquired EGFR-TKI resistance in NSCLC (22–25). Osimertinib (Tagrisso®, a third-generation EGFR-TKI) has been approved for the treatment of patients with metastatic and EGFR T790M mutation-positive NSCLC (26). However, several cases of patients resistant to osimertinib have been reported in clinics (26). Although phenotype characteristics of EGFR-TKI-resistant NSCLC can be classified as EGFR-dependent and EGFR-independent growth (26), deciding an appropriate treatment strategy is difficult due to the acquired resistance being driven by heterogeneous mechanisms. Herein, we propose a plausible therapeutic strategy targeting the cancer metabolism of EGFR-TKI-resistant NSCLC that focuses on the metabolic shift to mitochondrial OXPHOS.

In the tested NSCLC cell lines, the metabolic use of glucose differed between EGFR-TKI-sensitive and EGFR-TKI-resistant NSCLC. Both glucose uptake and glycolytic capacity were significantly reduced in NSCLC cell lines with acquired EGFR-TKI resistance compared with their parental cell lines. Conversely, the overall function of mitochondria was enhanced in the resistant NSCLC cell lines, as evidenced by increases in mitochondrial ATP production and mitochondrial membrane potential. Reportedly, EGFR stimulation accelerates glycolysis in TNBC cell lines (7). Furthermore, suppression of EGFR signaling in NSCLC cells reverses the Warburg effect and reactivates OXPHOS (8). Because EGFR-TKI-resistant NSCLC cell lines (HCC827 GR, H1993 ER, and H292 ER) acquired resistance via stepwise exposure to EGFR-TKIs over a long-term period (21, 27) and exhibited downregulated signaling activity of EGFR (Fig. 1D), compensatory activation of mitochondrial OXPHOS in the resistant NSCLC cell lines appears reasonable.

Cancer metabolism is an emerging research area in cancer biology. Based on the reprogrammed pathways of nutrient utilization and metabolism in cancer cells, several metabolic characteristics have been identified as hallmarks of cancer and recognized as promising therapeutic targets for cancer chemotherapy (9, 28–32). The metabolic processes of mitochondria have attracted attention as part of the development of treatment strategies targeting cancer metabolism (5). In particular, biguanides inhibiting mitochondrial complex I could be of interest because metformin has been used for an extended period as an effective type 2 diabetes agent and its safety is proven (12). However, clear evidence showing the successful anti-cancer efficacy of biguanides has not been reported in numerous clinical trials, which may be due to the non-selection of either a proper biomarker that determines the reactivity of biguanide or an appropriate biguanide-responding carcinoma (33–35). In the present study, phenformin strongly inhibited cell proliferation and tumor growth in NSCLC with acquired EGFR-TKI resistance (Fig. 4).

We demonstrated that the anti-cancer effects of phenformin depend on the metabolic status of cancer cells, ATP production via glycolysis, or mitochondrial OXPHOS (Fig. 5C). Although diverse cellular proteins including AMP-activated protein kinase, liver kinase B1 (36), OXPHOS complex 1 (37), and mitochondrial glycerolphosphate dehydrogenase (38) have been suggested as pharmacological targets of biguanides, we considered the NAD⁺/NADH imbalance caused by OXPHOS complex 1 inhibition a plausible mechanism by which phenformin acts on EGFR-TKI-resistant NSCLC. Because NAD⁺ is required to activate cytosolic malate dehydrogenase to generate oxaloacetate and then for the synthesis of aspartate through aspartate aminotransferase, a key function of mitochondrial OXPHOS and the redox balance in cancer cells is the biosynthesis of aspartic acid for the rapid growth of cancer (17, 18). As shown in Fig. 4, the intracellular aspartate level was decreased by phenformin in EGFR-TKI-resistant NSCLC. Because the metabolic shift to mitochondrial OXPHOS is triggered by long-term exposure to EGFR-TKIs, biguanide targeting OXPHOS may result in sustained redox stress as well as a subsequent aspartic acid deficiency and can be proposed as a new therapeutic option for NSCLC with acquired EGFR-TKI resistance. Consistent with our data, the combination of phenformin with osimertinib delayed the occurrence of resistance in a preclinical model of NSCLC in a recent study (16).

The present study has several limitations. First, all NSCLC cell lines did not exhibit a metabolic shift from glycolysis to mitochondrial OXPHOS under long-term exposure to EGFR-TKIs. In fact, phenformin sensitivity in H292 ER cells was of a similar intensity to that of its parental H292 cells (Supplemental Fig. 1). Second, a proper biomarker indicating if a metabolic shift had occurred was not suggested. The expression levels of glycolytic enzymes, such as HK1, HK2, and GAPDH, were downregulated in HCC827 GR and H1993 ER cells. Conversely, Tyr105-phosphorylated PKM2, an inhibitory form of PKM2, and S293-phosphorylated PDHA1, which converts pyruvate into acetyl-CoA, were also downregulated in HCC827 GR and H1993 ER cells. Based on our results showing that the expression levels of glycolytic enzymes, such as HK1 and HK2, were low and those of the inactive form of PKM2 (Tyr105-phosphorylated PKM2) and S293-phosphorylated PDHA1 were high, H292 ER cells should be more dependent on OXPHOS and more vulnerable to phenformin. However, significant differences were not observed in terms of inhibitory effects of phenformin on the proliferation of H292 and H292 ER cells (Supplemental Fig. 1). Because the metabolic processes of cancer cells are diverse, elucidating an indicator that defines the metabolic characteristics of cancer is challenging. Although specific genes that uniquely control the metabolic status of cancer cells have been successfully elucidated in a few studies (33, 35, 39), we could not find a common metabolic point for which mitochondrial function is upregulated in three different EGFR-TKI-resistant NSCLC cell lines. However, we presume that biguanide sensitivity in NSCLC with acquired EGFR-TKI resistance relies on mitochondrial OXPHOS activity. Because mitochondrial function is precisely controlled by numerous enzymes involved in several biochemical cycles, predicting the responsiveness to biguanide by only assessing specific gene expression is difficult.

Long-term treatment with EGFR-TKIs induces chemoresistance with a metabolic shift from glycolysis to OXPHOS in NSCLC. Suppressing OXPHOS by phenformin causes redox imbalance, leading to inhibition of aspartate biosynthesis and ultimately cancer cell growth. Our research provides pharmacological evidence for a therapeutic strategy using biguanides for EGFR-TKI-resistant NSCLC (Figure 5E).

2-DG: 2-deoxyglucose, AA: antimycin A, AKB: sodium 2-oxobutyrate, Asp: aspartate, ECAR: extracellular acidification rate, EGF: epidermal growth factor, EGFR: epidermal growth factor receptor, Erlo: erlotinib, FCCP: trifluoromethoxy carbonylcyanide phenylhydrazone, GAPDH: glyceraldehyde-3-phosphate dehydrogenase, Gef: gefitinib, H1993 ER: erlotinib resistant H1993 cells, H292 ER: erlotinib resistant H292 cells, HCC827 GR: gefitinib resistant HCC827 cells, HK1: hexokinase 1, HK2: hexokinase 2, NSCLC: non-small cell lung cancer, OCR: oxygen consumption rate, Osi: Osimertinib, OXPHOS: oxidative phosphorylation, PDHA1: pyruvate dehydrogenase E1-alpha subunit, Phen: phenformin, PKM2: pyruvate kinase isozymes M2, Ro: rotenone, TKI: tyrosine kinase inhibitor, TMRM: tetramethylrhodamine methyl ester

Ethics approval and consent to participate: Animal studies were approved by Seoul National University Institutional Animal Care and Use Committee (Approval #: SNU-170717-6-1)

Consent for publication: Not applicable

Competing interests: The authors declare that they have no competing interests.

Funding: This research was funded by the National Research Foundation of Korea (NRF) grant NRF-2018R1A2B2003590.

Authors contribution: KWK and SK designed experiments and wrote the manuscript. WKK helped analyzing RNA sequencing results. SKK and SWK helped determination of cell metabolites. SK, JHI, YJC, JYL and SJK performed experiments.

Acknowledgements: We thank Dr. Sang Kook Lee (Seoul National University, Seoul, Republic of Korea) for donating human lung cancer cells H1993, H1993 ER, H292, and H292 ER cells and Dr. Hong-Duk Youn (Department of Molecular Medicine & Biopharmaceutical Sciences, Graduate School of Convergence Science, Seoul National University, Seoul, Republic of Korea) for donating pCAG-Flag-IRES-Blas and pCAG-Flag-HK2-IRES-Blas plasmids.

Availability of data and materials: The data and materials used and/or analyzed during the current study are available from the corresponding author on reasonable request.

Recondo G, Facchinetti F, Olaussen KA, Besse B, Friboulet L. Making the first move in EGFR-driven or ALK-driven NSCLC: first-generation or next-generation TKI? Nature Reviews Clinical Oncology. 2018;15(11):694–708.
Yu HA, Arcila ME, Rekhtman N, Sima CS, Zakowski MF, Pao W, et al. Analysis of Tumor Specimens at the Time of Acquired Resistance to EGFR-TKI Therapy in 155 Patients with EGFR-Mutant Lung Cancers. Clin Cancer Res. 2013;19(8):2240–7.
FDA resources for Information. Food and Drug Administration Web site. https://www.accessdata.fda.gov/drugsatfda_docs/label/2018/208065s008lbl.pdf. 2018.
DeBerardinis RJ, Chandel NS. Fundamentals of cancer metabolism. Science Advances. 2016;2(5).
Ashton TM, McKenna WG, Kunz-Schughart LA, Higgins GS. Oxidative Phosphorylation as an Emerging Target in Cancer Therapy. Clin Cancer Res. 2018;24(11):2482–90.
Sharma SV, Bell DW, Settleman J, Haber DA. Epidermal growth factor receptor mutations in lung cancer. Nat Rev Cancer. 2007;7(3):169–81.
Lim SO, Li CW, Xia WY, Lee HH, Chang SS, Shen J, et al. EGFR Signaling Enhances Aerobic Glycolysis in Triple-Negative Breast Cancer Cells to Promote Tumor Growth and Immune Escape. Can Res. 2016;76(5):1284–96.
De Rosa V, Iommelli F, Monti M, Fonti R, Votta G, Stoppelli MP, et al. Reversal of Warburg Effect and Reactivation of Oxidative Phosphorylation by Differential Inhibition of EGFR Signaling Pathways in Non-Small Cell Lung Cancer. Clin Cancer Res. 2015;21(22):5110–20.
Hanahan D, Weinberg RA. Hallmarks of Cancer: The Next Generation. Cell. 2011;144(5):646–74.
Hensley CT, Faubert B, Yuan Q, Lev-Cohain N, Jin E, Kim J, et al. Metabolic Heterogeneity in Human Lung Tumors. Cell. 2016;164(4):681–94.
Lehuede C, Dupuy F, Rabinovitch R, Jones RG, Siegel PM. Metabolic Plasticity as a Determinant of Tumor Growth and Metastasis. Can Res. 2016;76(18):5201–8.
Vancura A, Bu PL, Bhagwat M, Zeng J, Vancurova I. Metformin as an Anticancer Agent. Trends Pharmacol Sci. 2018;39(10):867–78.
Niraula S, Dowling RJO, Ennis M, Chang MC, Done SJ, Hood N, et al. Metformin in early breast cancer: a prospective window of opportunity neoadjuvant study. Breast Cancer Res Treat. 2012;135(3):821–30.
Schuler KM, Rambally BS, DiFurio MJ, Sampey BP, Gehrig PA, Makowski L, et al. Antiproliferative and metabolic effects of metformin in a preoperative window clinical trial for endometrial cancer. Cancer Med. 2015;4(2):161–73.
Joshua AM, Zannella VE, Downes MR, Bowes B, Hersey K, Koritzinsky M, et al. A pilot 'window of opportunity' neoadjuvant study of metformin in localised prostate cancer. Prostate Cancer Prostatic Diseases. 2014;17(3):252–8.
Martin MJ, Eberlein C, Taylor M, Ashton S, Robinson D, Cross D. Inhibition of oxidative phosphorylation suppresses the development of osimertinib resistance in a preclinical model of EGFR-driven lung adenocarcinoma. Oncotarget. 2016;7(52):86313–25.
Sullivan LB, Gui DY, Hosios AM, Bush LN, Freinkman E, Vander Heiden MG. Supporting Aspartate Biosynthesis Is an Essential Function of Respiration in Proliferating Cells. Cell. 2015;162(3):552–63.
Birsoy K, Wang T, Chen WW, Freinkman E, Abu-Remaileh M, Sabatini DM. An Essential Role of the Mitochondrial Electron Transport Chain in Cell Proliferation Is to Enable Aspartate Synthesis. Cell. 2015;162(3):540–51.
DeWaal D, Nogueira V, Terry AR, Patra KC, Jeon SM, Guzman G, et al. Hexokinase-2 depletion inhibits glycolysis and induces oxidative phosphorylation in hepatocellular carcinoma and sensitizes to metformin. Nature Communications. 2018;9.
Morgillo F, Della Corte CM, Fasano M, Ciardiello F. Mechanisms of resistance to EGFR-targeted drugs: lung cancer. Esmo Open. 2016;1(3).
Kim D, Bach DH, Fan YH, Luu TTT, Hong JY, Park HJ, et al. AXL degradation in combination with EGFR-TKI can delay and overcome acquired resistance in human non-small cell lung cancer cells. Cell Death & Disease. 2019;10.
Engelman JA, Zejnullahu K, Mitsudomi T, Song YC, Hyland C, Park JO, et al. MET amplification leads to gefitinib resistance in lung cancer by activating ERBB3 signaling. Science. 2007;316(5827):1039–43.
Zhang ZF, Lee JC, Lin LP, Olivas V, Au V, LaFramboise T, et al. Activation of the AXL kinase causes resistance to EGFR-targeted therapy in lung cancer. Nat Genet. 2012;44(8):852-+.
Morgillo F, Woo JK, Kim ES, Hong WK, Lee HY. Heterodimerization of insulin-like growth factor receptor/epidermal growth factor receptor and induction of survivin expression counteract the antitumor action of erlotinib. Can Res. 2006;66(20):10100–11.
Takezawa K, Pirazzoli V, Arcila ME, Nebhan CA, Song XL, de Stanchina E, et al. HER2 Amplification: A Potential Mechanism of Acquired Resistance to EGFR Inhibition in EGFR-Mutant Lung Cancers That Lack the Second-Site EGFR(T790M) Mutation. Cancer Discov. 2012;2(10):922–33.
Leonetti A, Sharma S, Minari R, Perego P, Giovannetti E, Tiseo M. Resistance mechanisms to osimertinib in EGFR-mutated non-small cell lung cancer. Br J Cancer. 2019;121(9):725–37.
Bach DH, Kim D, Bae SY, Kim WK, Hong JY, Lee HJ, et al. Targeting Nicotinamide N-Methyltransferase and miR-449a in EGFR-TKI-Resistant Non-Small-Cell Lung Cancer Cells. Molecular Therapy-Nucleic Acids. 2018;11:455–67.
Altman BJ, Stine ZE, Dang CV. From Krebs to clinic: glutamine metabolism to cancer therapy. Nat Rev Cancer. 2016;16(10):619–34.
Bajpai R, Shanmugam M. Targeting cancer metabolism through synthetic lethality-based combinatorial treatment strategies. Curr Opin Oncol. 2018;30(5):338–44.
Klement RJ. The emerging role of ketogenic diets in cancer treatment. Current Opinion in Clinical Nutrition Metabolic Care. 2019;22(2):129–34.
Luengo A, Gui DY, Vander Heiden MG. Targeting Metabolism for Cancer Therapy. Cell Chemical Biology. 2017;24(9):1161–80.
Cheng CM, Geng F, Cheng X, Guo DL. Lipid metabolism reprogramming and its potential targets in cancer. Cancer Communications. 2018;38.
Birsoy K, Possemato R, Lorbeer FK, Bayraktar EC, Thiru P, Yucel B, et al. Metabolic determinants of cancer cell sensitivity to glucose limitation and biguanides. Nature. 2014;508(7494):108-+.
Gui DY, Sullivan LB, Luengo A, Hosios AM, Bush LN, Gitego N, et al. Environment Dictates Dependence on Mitochondrial Complex I for NAD plus and Aspartate Production and Determines Cancer Cell Sensitivity to Metformin. Cell Metab. 2016;24(5):716–27.
Shackelford DB, Abt E, Gerken L, Vasquez DS, Seki A, Leblanc M, et al. LKB1 Inactivation Dictates Therapeutic Response of Non-Small Cell Lung Cancer to the Metabolism Drug Phenformin. Cancer Cell. 2013;23(2):143–58.
Shaw RJ, Lamia KA, Vasquez D, Koo SH, Bardeesy N, DePinho RA, et al. The kinase LKB1 mediates glucose homeostasis in liver and therapeutic effects of metformin. Science. 2005;310(5754):1642–6.
Bridges HR, Jones AJY, Pollak MN, Hirst J. Effects of metformin and other biguanides on oxidative phosphorylation in mitochondria. Biochem J. 2014;462:475–87.
Thakur S, Daley B, Gaskins K, Vasko VV, Boufraqech M, Patel D, et al. Metformin Targets Mitochondrial Glycerophosphate Dehydrogenase to Control Rate of Oxidative Phosphorylation and Growth of Thyroid Cancer In Vitro and In Vivo. Clin Cancer Res. 2018;24(16):4030–43.
Chiche J, Reverso-Meinietti J, Mouchotte A, Rubio-Patino C, Mhaidly R, Villa E, et al. GAPDH Expression Predicts the Response to R-CHOP, the Tumor Metabolic Status, and the Response of DLBCL Patients to Metabolic Inhibitors. Cell Metab. 2019;29(6):1243-+.

FigureS1.pdf
Supplemental Figure 1. Anti-proliferation effect of phenformin in acquired erlotinib resistant H292 cells. H292 and H292 ER cells were treated with vehicle or phenformin (30 and 100 μM) for 72 h, and cell proliferation was analyzed with Incucyte-Zoom. Data represent means ± S.E.M. (n =6).

Download PDF

Version 1

posted

You are reading this latest preprint version

Enhanced Sensitivity of Non-Small-Cell Lung Cancer with Acquired Resistance to Epidermal Growth Factor Receptor-Tyrosine Kinase Inhibitors to Phenformin: The Roles of a Metabolic Shift to Oxidative Phosphorylation and Redox Balance

Status:

Version 1

Abstract

Figures

Background

Materials And Methods

Reagents and Antibodies

Cell culture and establishment of stably Hexokinase II overexpressing H292-ER cells

Cell proliferation

Genomic DNA Sequencing

Immunoblot analysis

2-deoxyglucose (2-DG)-uptake assay

Determination of NAD⁺/NADH ratio

Determination of glucose consumption in culture medium

Determination of intracellular lactate and aspartate levels

Determination of mitochondria ATP production rate, oxygen consumption rate (OCR) and extracellular acidification rate (ECAR)

RNA preparation and RNA sequencing

Transmission Electron Microscopy

Xenograft assay

Statistics

Results

Long-term treatment with EGFR-TKIs induces acquired resistance with downregulation of EGFR signaling in lung cancer cells

Glycolysis activity is decreased in lung cancer cells with acquired EGFR-TKI resistance

Reactivation of mitochondrial OXPHOS function in lung cancer cells with acquired EGFR-TKI resistance

Inhibition of proliferation in lung cancer cells with acquired EGFR-TKI resistance is caused by phenformin

Reversal of anti-cancer effects of phenformin is caused by glycolysis reactivation in lung cancer cells with acquired EGFR-TKI resistance

Discussion

Conclusion

Abbreviations

Declarations

References

Supplementary Files

Status:

Version 1

Enhanced Sensitivity of Non-Small-Cell Lung Cancer with Acquired Resistance to Epidermal Growth Factor Receptor-Tyrosine Kinase Inhibitors to Phenformin: The Roles of a Metabolic Shift to Oxidative Phosphorylation and Redox Balance

Status:

Version 1

Abstract

Figures

Background

Materials And Methods

Reagents and Antibodies

Cell culture and establishment of stably Hexokinase II overexpressing H292-ER cells

Cell proliferation

Genomic DNA Sequencing

Immunoblot analysis

2-deoxyglucose (2-DG)-uptake assay

Determination of NAD+/NADH ratio

Determination of glucose consumption in culture medium

Determination of intracellular lactate and aspartate levels

Determination of mitochondria ATP production rate, oxygen consumption rate (OCR) and extracellular acidification rate (ECAR)

RNA preparation and RNA sequencing

Transmission Electron Microscopy

Xenograft assay

Statistics

Results

Long-term treatment with EGFR-TKIs induces acquired resistance with downregulation of EGFR signaling in lung cancer cells

Glycolysis activity is decreased in lung cancer cells with acquired EGFR-TKI resistance

Reactivation of mitochondrial OXPHOS function in lung cancer cells with acquired EGFR-TKI resistance

Inhibition of proliferation in lung cancer cells with acquired EGFR-TKI resistance is caused by phenformin

Reversal of anti-cancer effects of phenformin is caused by glycolysis reactivation in lung cancer cells with acquired EGFR-TKI resistance

Discussion

Conclusion

Abbreviations

Declarations

References

Supplementary Files

Status:

Version 1

Determination of NAD⁺/NADH ratio