Streptomyces small laccase expressed in Aspergillus niger as a new addition for the lignocellulose bioconversion toolbox

doi:10.21203/rs.3.rs-4280442/v1

Download PDF

Research Article

Streptomyces small laccase expressed in Aspergillus niger as a new addition for the lignocellulose bioconversion toolbox

https://doi.org/10.21203/rs.3.rs-4280442/v1

This work is licensed under a CC BY 4.0 License

Journal Publication

published 02 Sep, 2024

Read the published version in Fungal Biology and Biotechnology →

You are reading this latest preprint version

Laccases are multi-copper oxidases that are usually composed of three Cu-oxidase domains. Domain one and three house the copper binding sites, and the second domain is involved in forming a substrate-binding cleft. However, Streptomyces species are found to have small laccases (SLAC) that lack one of the three Cu-oxidase domains. This type of SLAC with interesting bioconversion activities have not been reported in Aspergillus niger. In our research, we explored the expression and engineering of the SLAC from Streptomyces leeuwenhoekii C34 in A. niger. Genes encoding two versions of the SLAC were expressed. One encoding the SLAC in its native form and a second encoding the SLAC fused to two N-terminal CBM1 domains. The latter is a configuration also known for specific yeast laccases. Both SLAC variants were functionally expressed in A. niger as shown by in vitro activity assays and proteome analysis. Laccase activity was also analyzed toward bioconversion of lignocellulosic rice straw. From this analysis it was clear that the SLAC activity improved the efficiency of saccharification of lignocellulosic biomass by cellulase enzyme cocktails.

Small laccase

Streptomyces

Aspergillus niger

protein-domain engineering

lignocellulose degradation

carbohydrate binding module

Laccases are categorized as multi-copper oxidases (MCO) belonging to the Auxiliary Activities from family 1 (AA1) in the Carbohydrate-Active Enzymes (CAZy) database (1). They play a role in catalyzing the oxidation of a wide range of phenolic and non-phenolic compounds, including lignin (2, 3). Lignin, a complex and rigid polymer present in lignocellulose, acts as a barrier for cellulolytic enzymes attempting to access the (hemi)-cellulose chains within lignocellulose. Therefore, laccases are pivotal players in the intricate process of lignocellulose breakdown, holding a significant interest in various industrial applications, including the production of biofuels and other value-added biobased products.

From the CAZy database, it is clear that laccases have been identified in diverse organisms, including fungi and bacteria (1). Fungal laccases are widely represented in basidiomycete and ascomycete fungi, while research on bacterial laccase is mainly focused on Streptomyces, Bacillus, Pseudomonas (3, 4). According to the molecular architecture, a typical laccase consists of three Cu-oxidase domains holding in total 4 copper ions. In three-domain laccase, domain 1 and 3 harbor the four copper ions, whereas domain 2 is involved in substrate binding (5–7). In contrast to this domain arrangement, the genomes of various Streptomyces encode smaller laccases which lack one of the Cu-oxidase domains (typically domain 2 in the three-domain laccase), known as small laccase (SLAC) (8). Streptomyces two-domain laccases exhibit unique properties, such as high stability at a wide range of temperatures and pH-values. Furthermore they demonstrated activity on a broad range of substrates including lignin (8–14) which make them interesting enzymes for lignocellulose bioconversion.

Many CAZY enzymes in particular of the GH families have a modular domain architecture, with the enzyme domains linked to an accessory domain involved in carbohydrate binding such as Carbohydrate Binding Modules (CBM). CBMs are non-catalytic domains that are commonly associated with enzymes participating in the degradation of complex insoluble substrates (15, 16). The CBM domain exhibits a high affinity for carbohydrate structures, hence enhancing the proximity of the enzyme and its substrate, thereby promoting the substrate degradation (17–19). The fusion of CBM1 at the C-terminus of the three-domain laccase from Pycnoporus cinnabarinus expressed in A. niger was less thermostable than the native laccase but improved its efficiency for softwood kraft pulp biobleaching (20). In Aspergillus, the CBM from family 1 (CBM1) is the sole CBM family identified in combination with cellulases (21). Moreover, no CBM1 was found attached to the laccases from Aspergillus (1, 22).

Given the unique domain arrangement and characteristics of the SLAC from Streptomyces, especially considering its absence in A. niger genome, it is of great interest to investigate the expression of engineered SLAC in A. niger for an improve fungal enzyme cocktail in lignocellulose degradation. Furthermore, A. niger has been frequently used as a host for three domain laccase production (20, 23–25) but no reports are published on the utilization of A. niger as host for bacterial SLAC production. Hence, this study presents the novel heterologous expression of engineered SLAC variants in A. niger. The activity of the SLAC variants toward lignocellulose was investigated using rice straw biomass as lignocellulosic substrate.

Microbial strains, plasmid and culture medium.

A.niger strain MGG029 pyrE⁻, derived from A. niger MGG029 (26) was used as the transformation host for heterologous expression of SLAC genes, while Escherichia coli DH5α was employed for plasmid propagation (27). E. coli DH5α was grown on Luria–Bertani medium supplemented with ampicillin at 100 µg/mL. Plasmid pMA351 containing the gpdA promoter and trpC terminator from Aspergillus nidulans, was derived from pAN52-1Not (28, 29) and was used for SLAC gene construction. Additionally, a plasmid containing the A. niger pyrE gene (An04g08330) including promoter and terminator region was amplified from the genomic DNA of A. niger N402 as a template using primers pyrEP13f (5’-GACGTGTCGTTCCGGTATCC) and pyrEP14r (5’-ACTGTGCCGCATCCCAAT), for selection marker in fungal transformation. Minimal medium (MM) and complete medium (CM) were utilized for culturing the A. niger strains.

Gene design and expression vector construction

The SLAC gene from S. leeuwenhoekii C34 (WP_029383517) was used as the basis to generate two versions of engineered SLAC, including native SLAC (SLAC) and a chimeric variant with two N-terminal CBM1 domains (CBM-SLAC), respectively. In CBM-SLAC, the sequence of the two CBM1 domains including the signal peptide was retrieved from the yeast laccase of Rhodotorula toruloides NP11 (EMS24156). While, for the native SLAC, the signal sequence from A. niger laccase (Uniprot accession: A2QGL7) was used for secretion. Protein domain analysis to demarcate the various domains was performed using HMMER program (Version 3.3.2) (30). Signal sequence was predicted using SignalP 6.0 (31). SLAC with and without CBM1 were codon optimized for A. niger expression and synthesized by Invitrogen GeneArt and BaseClear, respectively. For generating the expression vectors, each SLAC variant was cloned into NcoI-BamHI-linearized pMA351 plasmid. The final constructs with SLAC variants were verified by sequencing a PCR product (Macrogen Europe B.V), from a pair of primers MBL852-forward (5′-GCTACATCCATACTCCA) and MBL858-reverse (5′- ATATCCAGATTCGTCAAGCTG). These primers amplify the gpdA promoter sequence, the inserted SLAC open reading frame and part of the trpC terminator.

Fungal transformations and cultivation

For fungal transformation, the expression vectors of SLAC variants and selection marker vector of A. niger pyrE gene were co-transformed into A. niger MGG029 pyrE⁻, following the protocol outlined in (32). A. niger pyrE⁺ transformants were selected on minimal media containing sucrose as an osmotic stabiliser. Twenty pyrE⁺ transformants were purified by single colony streaks on minimal medium and incubated for 3 days at 30°C. Subsequently, these A. niger transformants were grown on complete medium agar for 3 days at 30°C for spore production followed by spore isolation with the addition of 10 mL of physiological saline solution (0.9% NaCl dissolved in miliQ water) to the plate as well as gently scraping with a sterile cotton stick. The spore suspension was then transferred to a 15mL screw-cap tube and stored at 4°C. The spore suspension was used for cultivation and screening of the putative laccase transformants. Cultivation was carried out by submerged fermentation using 300 mL Erlenmeyer flasks with a 100 mL working volume of complete medium supplemented with 0.01 mM CuSO₄.7H₂O, inoculated with 1 × 10⁸ A. niger transformant spores, and incubated at 180 rpm, 30°C for 3 days. The culture medium was collected by filtration. The culture medium were tested for laccase activity with N,N-Dimethyl-p-phenylenediamine sulfate salt (DMPPDA) as substrate (12).

DMPPDA enzymatic assay

For the screening of laccase producing transformants, 200 µL of the culture medium were mixed with 800 µL DMPPDA solution in 1.5 mL Eppendorf tube, as essentially described (12). DMPPDA solution contained 0.125 mg/mL DMPPDA and 0.125 mg/mL 1-naphthol in 100 mM NaPi pH 6.8 buffer. The assay solution was incubated at 30°C for 30 minutes. The presence of laccase activity was visualized by the formation of a blue precipitate. As a negative control the culture medium from the parental strain, A. niger MGG029 transformed with an empty expression vector was used.

Effect of SLAC on lignocellulosic rice straw degradation

To measure the effect of the presence of SLAC on the degradation of rice straw the following reaction mixture was prepared: 5 mg of pre-treated rice straw prepared according to (33), 1 endo-glucanase unit (EGU) of cellulase (Trichoderma reesei, ATCC 26921), 100 µl culture medium from the A. niger co-transformant that was 5 times concentrated using a spin filter (Vivaspin, 10000 MWCO, VS0102) and 400 µl of 100 mM NaPi buffer (pH 6.8) in a 1.5 mL Eppendorf tube. The control samples had no culture medium added or an aliquot of culture medium of the transformed with the empty expression vector. The reaction mix was briefly vortexed and incubated at 30°C. Samples (200 µL) were taken after 8 hours, 24 hours and 48 hours of incubation. Subsequently, the reducing sugars released was determined with the DNS assay, as essentially described in (34). To remove remaining rice straw 50 µL of each time point sample was centrifuged and 25 µL of supernatant was mixed with 25 µL of DNS reagent. The DNS reagent comprises 1% 3.5-dinitrosalicylic acid, 0.05% sodium sulfite, and 1% sodium hydroxide. The samples were incubated at 100°C for 10 min. The reaction was stopped by adding 30 µL of sodium-potassium tetrahydrate solution (40% w/v). The absorbance was measured at 540 nm (TECAN, Spark 10M) and plotted against a standard curve to quantify the amount of reducing sugar released (mM). The measurements were done in triplicate.

SDS-PAGE and Zymogram analysis

Sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) was performed in 10% precast polyacrylamide gels (Bio-Rad, Mini-PROTEAN® TGX™, #4561033) as described in (27). The A. niger transformants culture medium sample was mixed with SDS-PAGE loading buffer containing 50 mM Tris-HCL pH 6.8, 25% glycerol, 0.05% bromophenol blue, 1% SDS, in a 3:1 ratio, without boiling and then loaded into the precast polyacrylamide gel. As a molecular weight standard, 5 µL unstained marker (Bio-Rad, precision plus protein unstained standard #161–0363) was loaded as well. The electrophoresis was run at 120 V for 1 hour at room temperature. Afterwards, the SDS-PAGE gel staining process was conducted as addressed in (27) using Sypro Ruby staining solution (Bio-Rad, Cat# 1703125). The Gel imaging was performed with the BioRad GelDoc™ EZ Imager.

SLAC zymogram analysis was carried out based on activity staining using DMPPDA substrate as essentially described in (12). Sample preparation and PAGE electrophoresis was conducted as addressed in SDS-PAGE procedure above. For a molecular weight standard, the Prestained Protein Ladder ranging from 10 to 250 kDa was used (Thermo Scientific™, #26619). Upon electrophoresis, the gel was incubated in 100 mM NaPi pH 6.8 buffer for 1 hour while shaking gently using a rocking shaker (VWR®) at room temperature. The buffer was refreshed every 20 minutes. Afterwards, the gel was incubated at 37°C for 15 minutes using 100 mM NaPi pH 6.8 buffer. The buffer solution was discarded and the gel was overlayed with 50 mL of DMPPDA-solution and incubated for 15 minutes at 37°C. The SLAC activity was visible directly on the gel from the formation of a blue precipitate at the position of the laccase protein bands.

Western-blot of SLAC

The presence of SLAC was confirmed using a western-blot as essentially described according to the instruction manual (Bio-Rad, Mini-Trans-Blot Electrophoretic Transfer Cell), using polyvinylidene difluoride (PVDF) membrane and polyclonal SLAC antiserum. Protein samples were run on SDS-PAGE as mentioned above (SDS-PAGE method section), and transferred onto PVDF membrane. For blocking, 5% non-fat milk was used and as secondary antibodies, goat-anti-rabbit-alkaline phosphatase (SIGMA A3812) was used.

Proteomic analysis

Samples for proteomic analysis were prepared from the culture medium of SLAC and CBM-SLAC transformants grown for 3 days. The culture medium was collected by filtration to remove A. niger biomass. Subsequently, 2 mL culture medium was 10x concentrated through ultrafiltration using a spin column with 3 kDa molecular cut-off membrane (Amicon® Ultra-15 Centrifugal Filter Units, MWCO 3 kDa). In total 200 µl of the concentrated culture medium was dissolved in 800 µl of 20mM phosphate buffer. The MS/MS analysis was carried out by Alphalyse (Alphalyse A/S, Odense, Denmark). The tandem mass spectrometry (MS/MS) data converted into mgf format were analyzed using X! Tandem version 17-02-01-4 (35).

Modular architecture of Laccases from Streptomyces and Aspergillus genera

For the exploration of the laccase modular architecture, sequence datasets of laccases from Streptomyces and Aspergillus were retrieved from Uniprot database, accessed on December 2023 (Additional file 1). In Aspergillus, to date a comprehensive analysis revealed 716 sequences identified as three-domains of multicopper oxidases / laccases. A parallel investigation in Streptomyces identified 281 sequences predicted to be three-domain laccase as well. In addition, for Streptomyces, 392 sequences were specifically classified as two domain multicopper oxidases, also called small-laccases, which are absent from Aspergillus and any other filamentous fungi. The modular-domain architecture represented by the different laccases found in the genome of A. niger CBS 513.88 and S. leeuwenhoekii C34 is shown in Fig. 1.

Three-domain laccases typically consist of three cupredoxin domains, of which according to Pfam protein family database are defined as Cu-oxidase_3, Cu-oxidase, and Cu-oxidase_2, respectively (Fig. 1). Based on the crystal structure the Cu-oxidase_3 and Cu-oxidase_2 domains are responsible for the catalytic function (36). Within these domains, two catalytic copper sites have been identified, a tri-nuclear cluster consisting of a single type-2 (T2) and a pair of type-3 (T3) copper ions located at the interface of Cu-oxidase_3 and Cu-oxidase_2 and a mono-nuclear center containing type-1 (T1) copper ion in the Cu-oxidase_2 domain (6, 7). Previous studies have indicated that the T1 copper ion plays a role in the initial substrate oxidation process, hence receiving electrons from the reducing substrate. Subsequently, these electrons are transferred from T1 copper ion to the tri-nuclear copper cluster, facilitating dioxygen reduction into water (36, 37). Moreover, several amino acid residues close to the T1 copper center have been implicated in substrate binding (5–7). Additionally, the middle Cu-oxidase domain of three-domain laccase plays a role in bridging the other two domains, facilitating the proper 3-dimentional structure for the formation of the tri-nuclear cluster (7, 36).

On the other hand, SLAC is characterized by its reduced size lacking one of Cu-oxidase domains compared to the typical three-domain laccases (Fig. 1). Despite their smaller size, the SLAC still maintains the essential cupredoxin-like domains and copper centers, contributing to their catalytic activity (38–40). The mono-nuclear copper site of SLAC from S. coelicolor resides in the Cu-oxidase_2 domain as is the case in the three domain laccases (7, 41). To form a catalytically active structure with a tri-nuclear site, SLAC needs to form a dimeric or trimeric structure where this catalytic site is at the interface between the N-terminal domain of one monomer and the C-terminal domain another monomer (7, 41). Moreover, the type-1 copper site of the Cu-oxidase_2 of SLAC is important for substrate binding, suggesting different substrate interaction compared to that of three domain laccases (42). The smaller size and enzymatic characteristics of the SLAC such as broad pH and temperature range, wide substrate acceptance, and inhibitor resistance, make them interesting enzymes for biotechnological applications such as lignin degradation (8–10, 14, 43, 44).

Both Aspergillus and Streptomyces have been well documented as laccase-producing organism (14, 23, 45). However, as SLAC encoding genes were absent in the A. niger genome (Fig. 1), we explored Streptomyces leeuwenhoekii SLAC expression in A. niger, whereby we also engineered a SLAC variant containing CBM1 domain. CBM1 has been known for its ability to bind specifically to crystalline cellulose, a component found alongside lignin in complex lignocellulosic substrates (16). The C-terminal CBM attachment to fungal laccase has been effective in improving pulp bio-bleaching (20). Incorporating CBM1 into SLAC was expected to guide the SLAC to anchor more effectively towards complex lignocellulosic substrate, thereby increasing SLAC proximity to lignin which facilitating lignin degradation.

The design of SLAC variants and screening of co-transformants

Two variants of SLAC encoding genes were generated, one with and one without CBM1 encoding domains, defined as CBM-SLAC and SLAC, respectively (Fig. 2). For the design of SLAC minus CBM1 (Fig. 2A), the SLAC sequence originated from S. leeuwenhoekii C34 (WP_029383517) and the native signal peptide was substituted with that from A. niger CBS 513.88 laccase (Uniprot accession: A2QGL7) that is known to be secreted (23) (Additional file 2: Fig.S1A, for the sequence). For the chimeric SLAC encoding gene with two CBM1s (Fig. 2B), the design was inspired by the modular domain of a yeast laccase carrying two CBM1 domains at the N-terminus (EMS24156) (Additional file 2: Fig.S1B, for the sequence). The yeast signal peptide along with its two CBM1s encoding sequence was retrieved from Rhodotorula toruloides NP11 (EMS24156), while the gene encoding the SLAC was obtained from S. leeuwenhoekii C34 (WP_029383517). The coding sequences for both SLAC variants were obtained by gene synthesis and cloned in plasmid pMA351 in between the constitutive gpdA promoter and trpC terminator as described in the Methods section.

Subsequently, each SLAC gene variant was transformed into A. niger MGG029. To identify the best performing transformants, an activity-based screen was conducted on around twenty putative co-transformants of SLAC (Additional file 2: Fig. S2A) and CBM-SLAC (Additional file 2: Fig. S2B). The activity screen used DMPPDA as substrate and culture medium collected from submerged fermentation of the co-transformants as enzyme source. Several transformants showed laccase activity (Additional file 2: Fig. S2). One Co-transformant from each laccase variant showing the most intense activity, CBM-SLAC#22 and SLAC#14, was selected for further research (Fig. 3). Moreover, colony PCR was carried out to confirm the presence of the SLAC gene variants introduced in A. niger transformants (Additional file 2: Fig. S3).

Zymogram, SDS-PAGE and Western Blot analysis

The presence of heterologous SLAC variants in the culture medium of PCR- and DMPPDA activity-validated co-transformants were further investigated through a series of rigorous protein gel analysis. The SDS-PAGE showed different banding pattern for the CBM-SLAC and SLAC co-transformants culture medium (Fig. 4). Both CBM-SLAC and SLAC transformants revealed a protein band estimated around 70 kDa, while an additional band around 95 kDa was detected in the SLAC co-transformant (Fig. 4). As expected, these bands were not present in the culture medium of transformants with empty vector, A. niger MGG029. Notably, the 70 and 95 kDa bands appeared to have molecular weights approximately two and three times larger than the expected size of monomeric CBM-SLAC and SLAC, which is 45 kDa and 35 kDa, respectively. This showed that these SLAC variants did not migrate according to their molecular weight on this protein gel analysis, indicating the SLAC protein as produced in Aspergillus remained non-denatured when running un-boiled samples on SDS-PAGE. Previous studies confirmed the resilience of the SLAC to denaturation by SDS thus retaining laccase activity under these conditions (8, 14). Therefore, zymogram analysis was carried out to further confirm and explore if the proteins observed on SDS-PAGE corresponded to active SLAC protein.

The Zymogram analysis using DMPPDA substrate was conducted in the presence of SDS without boiling the samples similar to that performed on SDS-PAGE in panel A and the Western blot in panel C (Fig. 4), as detailed in the methods section. The results revealed enzymatic activity corresponding to the protein bands identified in the SDS PAGE gel (Fig. 4B). Specifically, the active CBM-SLAC displayed a single band, while the active SLAC exhibited double bands, indicative of the typical di- and tri-meric state of active SLAC, in accordance with previous reports (7, 41). Our result suggests that CBM-SLAC is present as an active dimer, and not capable of forming a trimer probably due to structural hindrance attributed to the presence of two CBM’s at the N-terminus. For further confirmation, a Western blot using specific SLAC antibody was conducted. As expected, the western blot analysis showed a consistent result with those of SDS-PAGE and zymogram (Fig. 4C). CBM-SLAC exhibited a single band, while SLAC displayed double bands (Fig. 4C).

The fact that we detected protein bands in the gel analysis corresponding to putative dimeric and trimeric conformations of SLAC is in line with previous crystal structure analysis and the conclusion that functional SLAC requires multimerization (42, 46–48). The dimeric forms of active Streptomyces SLACs have been documented for the SilA from Streptomyces ipomoea, SvSL from Streptomyces viridochromogene, and SLAC from Streptomyces coelicolor (8, 40, 44), while the trimeric structures have been reported for EpoA from Streptomyces griseus and Ssl1 from Streptomyces aviceus (12, 13), all expressed in Escherichia coli. Moreover, an active SLAC from S. coelicolor exhibited trimeric and dimeric conformation when expressed in different hosts (8, 41, 48). In our study, SLAC expressed in A. niger displayed both the putative dimeric and trimeric conformation in a Zymogram with DMPPDA as substrate. The difference in reported multimeric forms of SLAC could be attributed to the use of different substrates (49).

Overall, the protein gel analysis conducted through above electrophoresis techniques (Fig. 4) provided confirmation that these SLAC variants were expressed and exhibited activity. On SDS-PAGE, the band corresponding to CBM-SLAC exhibited higher intensity compared to that of SLAC, suggesting a higher expression level of CBM-SLAC (Fig. 4A). However, on the zymogram, the levels of active bands were comparable between CBM-SLAC and SLAC, while the same amount of sample was loaded into the gel. This suggested that SLAC was more active than CBM-SLAC toward the DMPPDA substrate (Fig. 4B).

Proteomic analysis for identification of SLAC variants

In further attempt to characterize the secreted SLAC in A. niger culture medium, mass-spectrometry (LC-MS/MS)-based proteomics analysis was conducted with the two protein samples obtained for SLAC and CBM-SLAC. Through meticulous peptide matching, peptide fragments corresponding to most of the SLAC protein variants were successfully identified with high reliability (Additional file 3). A total of 228 and 121 amino acids (aa) were identified based on the peptide fragments referred to the sequence from SLAC and CBM-SLAC, respectively (Fig. 5). These numbers represent a protein coverage of 75% for SLAC and 31% for CBM-SLAC sequences (Fig. 5).

The identified peptides are in agreement with the effective expression of SLAC from Streptomyces leeuwenhoekii in A. niger, highlighting the robustness of the heterologous expression system. However, the absence of peptide fragments corresponding to the N-terminal region containing the CBM1 domain as depicted in Fig. 5, precluded conclusions on the presence of this N-terminal domain of the CBM1-SLAC protein. Therefore, N-terminal processing of the CBM-SLAC variant cannot be excluded. More detailed analysis of the amino acid sequence of the CBM1 suggests that specific interactions or structural properties of the domain hinders its detection in (LC-MS/MS)-based proteomics analysis. This could be attributed to the challenges associated with the trypsin fragmentation and identification of peptides containing disulfide bonds (50) and the fact that the CBM1 region is rich in Cysteine residues (Additional file 2: Fig. S4) which are involved in forming disulfide bonds in the CBM1 domains (22). Overall our results lay the groundwork for investigation of their impact on degradation of lignocellulosic material, as laccases are known to play a role in the efficient degradation of lignin (10, 51).

Effect of SLAC on lignocellulose degradation

The functional significance of the SLAC variants in lignocellulose degradation was explored using lignocellulosic biomass derived from rice straw. Crude enzyme samples containing recombinant SLAC were supplemented with commercial cellulases to evaluate the impact of SLAC on enhancing cellulase access and subsequent release of reducing sugars from rice straw. Previously it has been reported that the degradation of lignin by laccase in lignocellulose substrates, such as rice straw, enhance the accessibility of cellulase onto the cellulose chain to release reducing sugars (52). In our analysis, the amount of reducing sugars released was quantified using the DNS assay as described in method section and reflects the effect of SLAC activity on the lignocellulose degradation.

A notable increase in reducing sugar concentration was observed following 24- and 48- hours incubation of rice straw with crude enzyme containing SLAC alongside with cellulase (Fig. 6). At 24 hours, the sample treated solely with commercial cellulase displayed 8 mM of reducing sugars, whereas with SLAC variants added, the amount rose to 10 mM, marking a 20% increase in released reducing sugars. Moreover, a substantial enhancement in reducing sugar release was detected after 48 hours, with approximately a 30% rise observed in samples containing each SLAC variant alongside commercial cellulase compared to cellulase treatment alone (Fig. 6). This suggests that cellulase gains better access to cellulose degradation, likely due to reduced hindrance from lignin post degradation by laccase, implying SLAC addition enhances rice straw degradation into reducing sugars.

Furthermore, a similar amount of reducing sugars was observed for the reactions with the addition of SLAC with and without CBM1 in supporting the cellulase action, suggesting that addition of CBM1 N-terminally did not significantly further enhance rice straw degradation. Typically, in most cases, a CBM domain augments enzymatic hydrolysis by facilitating recognition and adsorption of the enzyme onto the substrate surface (15, 53, 54). However, it is noteworthy that in certain cases, CBM did not catalyse reactions of particular enzymes (55, 56). Furthermore, CBM1 can exhibit irreversible binding to cellulose (16), suggesting a constrained mobility of the SLAC in such circumstances. Moreover, the data presented in Fig. 4, suggest the addition of CBM could affect intermolecular interactions between CBM-SLAC monomers, which may affect the folding kinetics or stability of specific structural elements critical for catalytic activity and enzyme-substrate interactions of multi-domain proteins (57).

In conclusion, the engineered SLAC genes from Streptomyces leeuwenhoekii were successfully expressed in A. niger. Both variants of SLACs exhibited activity towards the DMPPDA substrate, with the SLAC variant displaying better activity on this substrate compared to the CBM-SLAC variant. Additionally, both SLAC variants combined with commercial cellulase showed a considerable increase in the release of reducing sugars, highlighting its potential synergistic role for SLAC in lignocellulosic biomass degradation. This lays the groundwork for exploring targeted strategies in enzyme domain engineering to produce heterologous modular enzymes as a constituent of improved fungal enzyme cocktails in lignocellulose degradation. In summary, this study represents the first report of the expression of Streptomyces SLAC in A. niger and its impact on lignocellulosic substrate degradation. These results hold significant implications toward the application of SLAC in biotechnological processes like lignin degradation.

SLAC

Small laccase

CBM

Carbohydrate Binding Modules

CBM1

Carbohydrate Binding Modules family 1

AA1

Auxiliary Activities from family 1

CAZy

Carbohydrate-Active Enzymes

DMPPDA

N,N-Dimethyl-p-phenylenediamine sulfate salt

NaPi

Sodium Phosphate

EGU

endo-glucanase unit

SDS-PAGE

Sodium dodecyl sulfate-polyacrylamide gel electrophoresis

T1, T1, T3

type-1,-2, -3 copper ion in respectively

Ethics approval and consent to participate

Not applicable.

Consent for publication

Not applicable.

Availability of data and materials

All data generated or analyzed during this study are included in this published article and its supplementary information files.

Competing interests

The authors declare that they have no competing interests.

Funding

This study was supported by a scholarship of the Indonesia Endowment Fund for Education (LPDP) from the Ministry of Finance, Indonesia (20160422026103) to AS and by a grant of the Dutch National Organization for Scientific Research NWO, in the framework of an ERA-IB project FilaZyme (053.80.721/EIB.14.021) to EV, GV, and PP.

Authors’ Contributions

AS wrote the original draft, generated figures, performed the experiment, data and formal analysis. GV interpreted the MS/MS analysis data and involved in software and resources. AEM involved in conducting formal analysis. EV and PJP were involved in the conceptualization, presents ideas, planning, supervision, validation, manuscript outline, writing, review and editing. All authors reviewed and approved the final version of manuscript.

Acknowledgements

We thank Prof. Dr. Arthur F.J. Ram (Fungal Genetics and Biotechnology, Institute Biology Leiden University) for the insight during work discussion. Additionally, we greatly appreciate Ing. Mark Arentshorst (Fungal Genetics and Biotechnology, Institute Biology Leiden University) for providing the plasmid containing pyrE gene and some laboratory technical assistance. Moreover, we thank Dr. Erica D Albuquerque for the design of CBM-SLAC construct.

Drula E, Garron ML, Dogan S, Lombard V, Henrissat B, Terrapon N. The carbohydrate-active enzyme database: functions and literature. Nucleic Acids Res. 2022;50(D1):D571–7.
Khan SI, Sahinkaya M, Colak DN, Zada NS, Uzuner U, Belduz AO, et al. Production and characterization of novel thermostable CotA-laccase from Bacillus altitudinis SL7 and its application for lignin degradation. Enzyme Microb Technol. 2024;172:110329.
Zhang W, Wang W, Wang J, Shen G, Yuan Y, Yan L, et al. Isolation and Characterization of a Novel Laccase for Lignin Degradation, LacZ1. Appl Environ Microbiol. 2021;87(23):e01355–21.
Guan ZB, Luo Q, Wang HR, Chen Y, Liao XR. Bacterial laccases: promising biological green tools for industrial applications. Cell Mol Life Sci. 2018;75(19):3569–92.
Camarero S, Pardo I, Cañas AI, Molina P, Record E, Martínez AT, et al. Engineering Platforms for Directed Evolution of Laccase from Pycnoporus cinnabarinus. Appl Environ Microbiol. 2012;78(5):1370–84.
Mehra R, Muschiol J, Meyer AS, Kepp KP. A structural-chemical explanation of fungal laccase activity. Sci Rep. 2018;8:17285.
Hakulinen N, Rouvinen J. Three-dimensional structures of laccases. Cell Mol Life Sci. 2015;72(5):857–68.
Machczynski MC, Vijgenboom E, Samyn B, Canters GW. Characterization of SLAC: A small laccase from Streptomyces coelicolor with unprecedented activity. Protein Sci. 2004;13(9):2388–97.
Blánquez A, Ball AS, González-Pérez JA, Jiménez-Morillo NT, González-Vila F, Arias ME, et al. Laccase SilA from Streptomyces ipomoeae CECT 3341, a key enzyme for the degradation of lignin from agricultural residues? PLoS ONE. 2017;12(11):e0187649.
Majumdar S, Lukk T, Solbiati JO, Bauer S, Nair SK, Cronan JE, et al. Roles of small laccases from Streptomyces in lignin degradation. Biochemistry. 2014;53(24):4047–58.
Lu L, Zeng G, Fan C, Ren X, Wang C, Zhao Q, et al. Characterization of a laccase-like multicopper oxidase from newly isolated Streptomyces sp. C1 in agricultural waste compost and enzymatic decolorization of azo dyes. Biochem Eng J. 2013;72:70–6.
Endo K, Hayashi Y, Hibi T, Hosono K, Beppu T, Ueda K. Enzymological Characterization of EpoA, a Laccase-Like Phenol Oxidase Produced by Streptomyces griseus. J Biochem. 2003;133(5):671–7.
Gunne M, Urlacher VB. Characterization of the Alkaline Laccase Ssl1 from Streptomyces sviceus with Unusual Properties Discovered by Genome Mining. PLoS ONE. 2012;7(12):e52360.
Kaur R, Salwan R, Sharma V. Structural properties, genomic distribution of laccases from Streptomyces and their potential applications. Process Biochem. 2022;118:133–44.
Boraston AB, Bolam DN, Gilbert HJ, Davies GJ. Carbohydrate-binding modules: fine-tuning polysaccharide recognition. Biochem J. 2004;382(Pt 3):769–81.
Bernardes A, Pellegrini VOA, Curtolo F, Camilo CM, Mello BL, Johns MA, et al. Carbohydrate binding modules enhance cellulose enzymatic hydrolysis by increasing access of cellulases to the substrate. Carbohydr Polym. 2019;211:57–68.
Telke AA, Ghatge SS, Kang SH, Thangapandian S, Lee KW, Shin HD, et al. Construction and characterization of chimeric cellulases with enhanced catalytic activity towards insoluble cellulosic substrates. Bioresour Technol. 2012;112:10–7.
Duan CJ, Huang MY, Pang H, Zhao J, Wu CX, Feng JX. Characterization of a novel theme C glycoside hydrolase family 9 cellulase and its CBM-chimeric enzymes. Appl Microbiol Biotechnol. 2017;101(14):5723–37.
Monica P, Ranjan R, Kapoor M. Family 3 CBM improves the biochemical properties, substrate hydrolysis and coconut oil extraction by hemicellulolytic and holocellulolytic chimeras. Enzyme Microb Technol. 2023;174:110375.
Ravalason H, Herpoël-Gimbert I, Record E, Bertaud F, Grisel S, de Weert S, et al. Fusion of a family 1 carbohydrate binding module of Aspergillus niger to the Pycnoporus cinnabarinus laccase for efficient softwood kraft pulp biobleaching. J Biotechnol. 2009;142(3):220–6.
Sidar A, Albuquerque ED, Voshol GP, Ram AFJ, Vijgenboom E, Punt PJ. Carbohydrate Binding Modules: Diversity of Domain Architecture in Amylases and Cellulases From Filamentous Microorganisms. Front Bioeng Biotechnol. 2020;8:871.
The UniProt Consortium. UniProt: the Universal Protein Knowledgebase in 2023. Nucleic Acids Res. 2023;51(D1):D523–31.
Ramos JAT, Barends S, Verhaert RMD, de Graaff LH. The Aspergillus niger multicopper oxidase family: analysis and overexpression of laccase-like encoding genes. Microb Cell Fact. 2011;10:78.
Bohlin C, Jönsson LJ, Roth R, van Zyl WH. Heterologous expression of Trametes versicolor laccase in Pichia pastoris and Aspergillus niger. Appl Biochem Biotechnol. 2006;129–132:195–214.
Piscitelli A, Pezzella C, Giardina P, Faraco V, Sannia G. Heterologous laccase production and its role in industrial applications. Bioeng Bugs. 2010;1(4):252–62.
Weenink XO, Punt PJ, van den Hondel CAMJJ, Ram AFJ. A new method for screening and isolation of hypersecretion mutants in Aspergillus niger. Appl Microbiol Biotechnol. 2006;69(6):711–7.
Sidar A, Voshol GP, Vijgenboom E, Punt PJ. Novel Design of an α-Amylase with an N-Terminal CBM20 in Aspergillus niger Improves Binding and Processing of a Broad Range of Starches. Molecules. 2023;28(13):5033.
Van den hondel CAMJJ, Punt PJ, Van gorcom RFM. 18 - Heterologous Gene Expression in Filamentous Fungi. In: Bennett JW, Lasure LL, editors. More Gene Manipulations in Fungi [Internet]. San Diego: Academic Press; 1991 [cited 2023 Feb 24]. pp. 396–428. https://www.sciencedirect.com/science/article/pii/B9780120886425500259.
Punt PJ, van den Hondel CAMJJ. [39] Transformation of filamentous fungi based on hygromycin b and phleomycin resistance markers. In: Methods in Enzymology [Internet]. Academic Press; 1992 [cited 2024 Apr 11]. pp. 447–57. (Recombinant DNA Part G; vol. 216). https://www.sciencedirect.com/science/article/pii/007668799216041H.
Potter SC, Luciani A, Eddy SR, Park Y, Lopez R, Finn RD. HMMER web server: 2018 update. Nucleic Acids Res. 2018;46(W1):W200–4.
Teufel F, Almagro Armenteros JJ, Johansen AR, Gíslason MH, Pihl SI, Tsirigos KD, et al. SignalP 6.0 predicts all five types of signal peptides using protein language models. Nat Biotechnol. 2022;40(7):1023–5.
Arentshorst M, Ram AFJ, Meyer V. Using Non-homologous End-Joining-Deficient Strains for Functional Gene Analyses in Filamentous Fungi. In: Bolton MD, Thomma BPHJ, editors. Plant Fungal Pathogens [Internet]. Totowa, NJ: Humana Press; 2012 [cited 2023 Feb 24]. pp. 133–50. (Methods in Molecular Biology; vol. 835). https://link.springer.com/10.1007/978-1-61779-501-5_9.
Sidar A, Voshol GP, El-Masoudi A, Vijgenboom E, Punt PJ. Highly variable domain architecture in carbohydrate-active enzymes highlights Streptomyces as promising resource for rice straw bioconversion. Bioresource Technol Rep. 2024;25:101775.
Miller GL. Use of Dinitrosalicylic Acid Reagent for Determination of Reducing Sugar. Anal Chem. 1959;31(3):426–8.
Craig R, Beavis RC. TANDEM: matching proteins with tandem mass spectra. Bioinformatics. 2004;20(9):1466–7.
Arregui L, Ayala M, Gómez-Gil X, Gutiérrez-Soto G, Hernández-Luna CE et al. Herrera de los Santos M,. Laccases: structure, function, and potential application in water bioremediation. Microbial Cell Factories. 2019;18(1):200.
Solomon EI, Chen P, Metz M, Lee SK, Palmer AE. Oxygen Binding, Activation, and Reduction to Water by Copper Proteins. Angew Chem Int Ed Engl. 2001;40(24):4570–90.
Gabdulkhakov A, Kolyadenko I, Kostareva O, Mikhaylina A, Oliveira P, Tamagnini P, et al. Investigations of Accessibility of T2/T3 Copper Center of Two-Domain Laccase from Streptomyces griseoflavus Ac-993. Int J Mol Sci. 2019;20(13):3184.
Worrall JAR, Vijgenboom E. Copper mining in Streptomyces: enzymes, natural products and development. Nat Prod Rep. 2010;27(5):742.
Trubitsina LI, Tishchenko SV, Gabdulkhakov AG, Lisov AV, Zakharova MV, Leontievsky AA. Structural and functional characterization of two-domain laccase from Streptomyces viridochromogenes. Biochimie. 2015;112:151–9.
Skálová T, Dohnálek J, Østergaard LH, Østergaard PR, Kolenko P, Dušková J, et al. The Structure of the Small Laccase from Streptomyces coelicolor Reveals a Link between Laccases and Nitrite Reductases. J Mol Biol. 2009;385(4):1165–78.
Komori H, Higuchi Y. Structure and molecular evolution of multicopper blue proteins. Biomol Concepts. 2010;1(1):31–40.
Dubé E, Shareck F, Hurtubise Y, Daneault C, Beauregard M. Homologous cloning, expression, and characterisation of a laccase from Streptomyces coelicolor and enzymatic decolourisation of an indigo dye. Appl Microbiol Biotechnol. 2008;79(4):597–603.
Molina-Guijarro JM, Pérez J, Muñoz-Dorado J, Guillén F, Moya R, Hernández M, et al. Detoxification of azo dyes by a novel pH-versatile, salt-resistant laccase from Streptomyces ipomoea. Int Microbiol. 2009;12(1):13–21.
Välimets S, Pedetti P, Virginia LJ, Hoang MN, Sauer M, Peterbauer C. Secretory expression of recombinant small laccase genes in Gram-positive bacteria. Microb Cell Fact. 2023;22(1):72.
Komori H, Miyazaki K, Higuchi Y. X-ray structure of a two-domain type laccase: A missing link in the evolution of multi-copper proteins. FEBS Lett. 2009;583(7):1189–95.
Lawton TJ, Sayavedra-Soto LA, Arp DJ, Rosenzweig AC. Crystal Structure of a Two-domain Multicopper Oxidase *. J Biol Chem. 2009;284(15):10174–80.
Skálová T, Dohnálek J, Ostergaard LH, Ostergaard PR, Kolenko P, Dusková J, et al. Crystallization and preliminary X-ray diffraction analysis of the small laccase from Streptomyces coelicolor. Acta Crystallogr Sect F Struct Biol Cryst Commun. 2007;63(Pt 12):1077–9.
Janusz G, Pawlik A, Świderska-Burek U, Polak J, Sulej J, Jarosz-Wilkołazka A, et al. Laccase Properties, Physiological Functions, and Evolution. Int J Mol Sci. 2020;21(3):966.
Mormann M, Eble J, Schwöppe C, Mesters RM, Berdel WE, Peter-Katalinić J, et al. Fragmentation of intra-peptide and inter-peptide disulfide bonds of proteolytic peptides by nanoESI collision-induced dissociation. Anal Bioanal Chem. 2008;392(5):831–8.
Rashid GMM, Sodré V, Luo J, Bugg TDH. Overexpression of endogenous multi-copper oxidases mcoA and mcoC in Rhodococcus jostii RHA1 enhances lignin bioconversion to 2,4-pyridine-dicarboxylic acid. Biotechnol Bioeng. 2024;121(4):1366–70.
Wu J, Li Z, Wang J, Gan H, Wang J, Jin C, et al. Effects of laccase and cellulase on saccharification of barley malt. Heliyon. 2022;8(9):e10744.
Carli S, Parras Meleiro L, Salgado JCS, Ward RJ. Synthetic carbohydrate-binding module-endogalacturonase chimeras increase catalytic efficiency and saccharification of lignocellulose residues. Biomass Conv Bioref [Internet]. 2022 May 3 [cited 2024 Jan 31]; https://doi.org/10.1007/s13399-022-02716-6.
Pan R, Hu Y, Long L, Wang J, Ding S. Extra carbohydrate binding module contributes to the processivity and catalytic activity of a non-modular hydrolase family 5 endoglucanase from Fomitiporia mediterranea MF3/22. Enzym Microb Technol. 2016;91:42–51.
Hu Y, Li H, Ran Q, Liu J, Zhou S, Qiao Q, et al. Effect of carbohydrate binding modules alterations on catalytic activity of glycoside hydrolase family 6 exoglucanase from Chaetomium thermophilum to cellulose. Int J Biol Macromol. 2021;191:222–9.
Koskela S, Wang S, Xu D, Yang X, Li K, Berglund LA, et al. Lytic polysaccharide monooxygenase (LPMO) mediated production of ultra-fine cellulose nanofibres from delignified softwood fibres. Green Chem. 2019;21(21):5924–33.
Rajasekaran N, Kaiser CM. Co-Translational Folding of Multi-Domain Proteins. Front Mol Biosci. 2022;9:869027.

No competing interests reported.

Download PDF

Journal Publication

published 02 Sep, 2024

Read the published version in Fungal Biology and Biotechnology →

Editorial decision: Revision requested
14 May, 2024
Reviews received at journal
13 May, 2024
Reviews received at journal
06 May, 2024
Reviewers agreed at journal
04 May, 2024
Reviews received at journal
04 May, 2024
Reviewers agreed at journal
25 Apr, 2024
Reviewers agreed at journal
24 Apr, 2024
Reviewers invited by journal
18 Apr, 2024
Submission checks completed at journal
17 Apr, 2024
Editor assigned by journal
17 Apr, 2024
First submitted to journal
17 Apr, 2024

You are reading this latest preprint version

Streptomyces small laccase expressed in Aspergillus niger as a new addition for the lignocellulose bioconversion toolbox

Status:

Journal Publication

Version 1

Abstract

Figures

Background

Materials and Methods

Gene design and expression vector construction

Fungal transformations and cultivation

DMPPDA enzymatic assay

Effect of SLAC on lignocellulosic rice straw degradation

SDS-PAGE and Zymogram analysis

Western-blot of SLAC

Proteomic analysis

Results and Discussion

The design of SLAC variants and screening of co-transformants

Zymogram, SDS-PAGE and Western Blot analysis

Proteomic analysis for identification of SLAC variants

Effect of SLAC on lignocellulose degradation

Conclusion

Abbreviations

Declarations

References

Additional Declarations

Supplementary Files

Status:

Journal Publication

Version 1