Plant materials
The seeds of C. korshinskii Kom (http://www.iplant.cn/info/Caragana%20korshinskii?t=foc) were collected by Dr. Xinwu Pei from the Minqin Shasheng Botanical Garden in Gansu Province, China. The seeds were sown in a greenhouse and used as a source of material to clone WRKY33. A. thaliana ecotype Columbia-0 was used for the overexpression experiments and the WT and transgenic A. thaliana lines were grown at 22°C, 70% relative humidity and a long-day photoperiod (16-h light/8-h dark).
CkWRKY33 cloning and sequence analysis
Total RNA was extracted from the leaves using the ZR Plant RNA MiniPrep Kit (ZYMO RESEARCH, Beijing, China), following the manufacturer’s protocol. First-strand cDNA was synthesized using PrimeScriptTM RTase (TaKaRa Biotechnology, Dalian, China) according to the manufacturer’s instructions. A CkWRKY33 cDNA corresponding to the predicted ORF was amplified by PCR using the gene-specific primers F1 (5’-ATGACTATGGATGATCATAACTG-3’) and R1 (5’-TTAGAAGTCCTTTGACATAAAT-3’). The PCR product was cloned into the pEasy-T1 cloning vector (Transgen, Beijing, China), and was then sequenced. Amino acid sequences of homologous WRKY33 proteins from other plant species were obtained from the NCBI database (https://www.ncbi.nlm.nih.gov)using BLASTP. A multiple sequence alignment of the deduced protein sequences and phylogenetic analyses were carried out using the DNAMAN software.
Subcellular localization of CkWRKY33
Using in-fusion homologous recombination technology, the CkWRKY33 full-length DNA sequence fragment was inserted into a CaMV 35s-GFP vector constructed previously by our laboratory to obtain the recombinant fusion construct 35s-CkWRKY33-GFP. Then the new recombinant vector (35s-CkWRKY33-GFP) and the control (35s-GFP) were independently delivered to competent cells of Agrobacterium tumefaciens LBA4404using the freeze-thaw approach. After the positive bacterial clones were identified, yeast extract peptone medium was employed to cultivate these clones, as well as the mRFP-AHL22 strain conserved by the laboratory as a localization marker[40]. The medium was supplemented with the appropriate antibiotics, 5 mM MES (pH=5.7) and 200 μM acetosyringone. When the bacterial solution’s concentrations reached OD600=0.6-1.0, they were centrifuged at 8,000 rpm for 6 min to harvest the bacterial sediment. The sediment was washed with buffer containing 10 mM MgCl2, 10 mM MES twice and resuspended in the buffer above supplemented with 200 μM acetosyringone. The suspension’s concentrations were adjusted to OD600=0.5-0.6, and then, it was placed at 4°C in the darkness for 3-4 h. Before injecting the Nicotiana benthamiana leaves, the suspension of mRFP-AHL22 was added at a 1:1 ratio and mixed well. The mixture was infiltrated into tobacco leaves using a syringe. The GFP signals in leaves were observed under a laser scanning confocal microscope after 24-48 h.
Generation of transgenic A. thaliana plants over-expressing the CkWRKY33 gene
The coding sequence of CkWRKY33 (with EcoRI and XmaI sites added to its 5’ and 3’ ends, respectively) was amplified from pEasy-T1-CkWRKY33 using gene-specific primers F2 (5’-
ACTGACGTAAGGGATGACGCACA ATGACTATGGATGATCATAACTG-3’
) and R2 (5’-GTTGCTAGCACTATTGCCAAAAA TTAGAAGTCCTTTGACATAAAT-3’). It was then inserted in the plant over-expression vector, 35sRED using the in-fusion method, and called 35S::CkWRKY33. A. tumefaciens EHA105 harboring the 35S::CkWRKY33 construct was used to transform Arabidopsis by the floral-dip method [41]. T0 seeds were harvested and selected using a red light. T2 homozygous lines were generated and used for all the subsequent experiments.
Drought stress treatments of transgenic A. thaliana lines
To test the effects of drought stresses, 5-d-old transgenic and WT seedlings grown on 1/2MS medium plates were transferred to plates containing 1/2MS medium, or 1/2MS medium supplemented with either 50 mM or 100 mM mannitol. WT and transgenic Arabidopsis seeds were planted in cultivation pots at a density of four seeds per pot, using a total of 24 seeds. Three replicates were set and cultured in a greenhouse under 16h light / 8h dark conditions. After 3 weeks of plant growth, a natural drought treatment was carried out. WT plants were used as the controls. After the WT plants showed signs of death, all the plants were rehydrated for 2-3 d to determine their survival rates and the phenotypes of transgenic and WT plants were recorded.
To determine the water loss rate, 10 leaves were detached from 4-week-old transgenic and WT plants and immediately weighed. The samples were then placed on dry filter paper at a relative humidity of 40%–45% at room temperature and weighed over a time course. The water loss rate was calculated as previously described [42].
Gene expression analysis by quantitative real-time RT-PCR
Samples were taken from 3-week-old WT and transgenic A. thaliana seedlings after 15 d of drought treatment and 3 d of rehydration.
Total RNA was extracted from Arabidopsis leaves using an RNA prep plant kit (Tiangen Biotech.,Beijing, China) following the manufacturer’s protocols. First-strand cDNA was synthesized using PrimeScriptTMRTase (TaKaRa Biotechnology,Beijing, China) according to the manufacturer’s instructions. The quantitative real-time RT-PCR (qRT-PCR) analysis was conducted using SYBR green (TaKaRa Biotechnology) and an ABI7500 real-time RT-PCR instrument with the following thermal profile: 95°C for 30 s, 40 cycles of 95°C for 5s, and 60°C for 30s. Each reaction was performed in triplicate for each of the three biologically replicated sets of cDNA samples. To perform the melt-curve analysis, the following program was added after the 40 PCR cycles: 95°C for 15 s, followed by a constant increase from 60°C to 95°C. A. thaliana Actin 1 (TAIR3: AT2G37620) was used as the reference gene. Primers used for qRT-PCR are listed in Additional File 1. Relative gene expression values were determined by using the 2-ΔΔCt method [43] The experiment was repeated three times.
Measurements of the soluber sugar, MDA and proline contents and POD activity levels
The values of four physiological traits, soluble sugar content, MDA content, proline content and POD activity level, were determined for the drought-treated transgenic plants. Arabidopsis leaves were collected during the drought treatment. Each trait was determined using the appropriate kit, following the manufacturer’s instructions (Solarbio, Beijing, China).