2.1 Chemicals and Cell culture
AZD5153 was purchased from Selleck, USA. The chemical was dissolved in DMSO (Sigma–Aldrich, USA) and stored at -20 °C. The human pancreatic cancer cell lines BXPC3 and PANC-1 were obtained from Stem Cell Bank, Chinese Academy of Sciences, and routinely maintained in RPMI-1640 medium (HyClone, USA) supplemented with 10% FBS plus 1% penicillin-streptomycin. All cells were incubated at 37 °C in a 5% CO2 atmosphere.
2.2 Cell proliferation assay
Cell viability was measured using a sulforhodamine B (SRB, Sigma Aldrich) assay. Briefly, 3–5×103 cells were cultured in 96-well plates. After 24 h, the cells were treated with the indicated concentrations of AZD5153 and/or GEM, and cell viability was measured at the indicated times. Absorbance was measured at 450 nm using a Multiskan Spectrum spectrophotometer (Thermo Scientific, Rockford, IL, USA).
2.3 Colony formation assay
BXPC3, PANC-1 cells were seeded in 6-well plates at a density of 600 cells/well. After 24 h incubation, the cells were then incubated with AZD5153 and/or GEM. Following another 48 h treatment, the supernatant was replaced regularly for 2 weeks. the cells were finally fixed with crystal violet solution (0.1%), colonies were photographed.
2.4 DAPI staining
BXPC3 and PANC-1 cells were seeded in 6-well plates, exposed to AZD5153 and/or GEM. The cells were harvested, fixed for 30 min (pre-cooled 4% paraformaldehyde), and stained with DAPI for 20 min. 1×PBS were used for washing three times, the cells were photographed using a fluorescence microscope (Nikon, Japan).
2.5 Apoptosis assay
BXPC3 and PANC-1 cells (5×105/ml) were seeded into 6-well plates, treated with AZD5153 and/or GEM for 24 h and harvested. PBS was used to wash. Then Annexin V-FITC (Invitrogen, Carlsbad, CA) and propidium iodide (PI) were added according to the protocol and analyzed by flow cytometry (Becton Dickinson, Franklin, NJ, USA).
2.6 Western blotting analysis
After treatment with AZD5153 and/or GEM, total protein was extracted. A total protein sample (40 μg) was conducted to electrophoresis. The proteins were transferred to a PVDF membrane (Bio-Rad, USA) with indicated time, stained with 5% nonfat milk for 1 h at room temperature. Primary antibodies were stained overnight at 4 °C . The primary antibodies were as follows: p-AKT (Ser473, CST, 12694, 1:1000), AKT (CST, 9272, 1:1000), p-mTOR (Ser2448, CST, 5536, 1:1000), mTOR (CST, 5536, 1:1000), p-p70S6K (Thr389, CST, 9234, 1:1000), p70S6K (CST, 2708, 1:1000), pS6 (Ser240/244, CST, 5364, 1:1000), S6 (CST, 2217, 1:1000), p-ERK1/ERK2 (Abcam, ab50011, 1:5000), ERK1/ERK2 (Abcam, ab17942, 1:5000), Caspase-3 (CST, 9662, 1:1000), Bcl-2 (Abcam, ad324, 1:5000), PARP (CST, 9542p, 1:1000), BRD4 (CST, 13440, 1:1000), MUC2 (ABclonal,A14659,1:1000), β-Tubulin (9F3,CST,2128,1:1000), GAPDH (Santa Cruz, sc-32233, 1:1000), and β-Actin (Santa Cruz, sc-47778, 1:1000). Then, the secondary antibodies were used to stain at room temperature for 1 h. The protein were detected by ECL incubating.
2.7 Animal treatment and drug administration
All animal experiments were conducted according to the Institutional Animal Care and Use Committee (IACUC). BXPC3 cells (4×106) were resuspended, subsequently injected into 4-week-old female nude mice. When the tumors reached ~90 mm3, the mice were randomized into different groups: vehicle, AZD5153 (5 mg/kg), gemcitabine (20 mg/kg) and combination groups. The mice were receive the below drug treatments every two days for 15 days. Tumor volume (TV) was determined from (length × width2)/2.
2.8 RNA-Sequencing analysis
BXPC3 cells were treated with or without GEM, AZD5153, and total RNA was extracted with Trizol reagent following the manufacturer’s procedure. After purification and quantification, the cleaved RNA was reverse transcribed to create the cDNA by SuperScript™ II Reverse Transcriptase (Invitrogen, 1896649), which were next used to synthesise U-labeled second-stranded DNAs and used for the construction of sequencing libraries. The average insert size for the final cDNA library were 300 ± 50 bp. At last, we performed the 2×150 bp paired-end sequencing (PE150) on an Illumina Novaseq™ 6000 (LC Bio Technology Co., Ltd., Hangzhou, China) following the vendor’s recommended protocol. At last GO functions and KEGG pathways were performed.
2.9 Quantitative real-time (qPCR)
Total RNA from cells was extracted using TRIzol reagent (Invitrogen). RNA was reverse transcribed into cDNA. qPCR was performed on a 7500 Fast System using SYBR-Green (Qiagen, Hilden, Germany) and a volume of water to generate a volume of 20 μl. Assays were performed on three independent experiments. The primers used was as follows:
MUC2 Forward: TGTGTTTCAGGCTCCATCAC
MUC2 Reverse: TGCAGCCATTGTAGGAAATC
FGFBP1 Forward: AACTGCAGATGGGCTGCTAC
FGFBP1 Reverse: TCTCCTTCCTGGGCTTTGTG
GSDMC Forward: GAGGGGACAACCTGTACGTG
GSDMC Reverse: TCTGAAGAGTCAGCGCCTTC
2.10 Statistical analysis
The collected data were calculated as the means±SD/SE. at least three independent experiments. Differences between groups were performed with Student’s t-test and *p < 0.05 was defined as significant difference. Graphs were prepared using GraphPad software and SigmaPlot 14.