After the Zika virus (ZIKV) epidemic in Brazil, ZIKV infections were linked to damage to the central nervous system (CNS) and congenital anomalies. Due to the virus’s ability to cross the placenta and reach brain tissue, its effects become severe, leading to Congenital Zika Syndrome (CZS) and resulting in neuroinflammation, microglial activation, and secretion of neurotoxic factors. The presence of ZIKV triggers an inadequate fetal immune response, as the fetus only has the protection of maternal antibodies of the Immunoglobulin G (IgG) class, which are the only antibodies capable of crossing the placenta. Because of limited understanding regarding the long term consequences of ZIKV infection and the involvement of maternal antibodies, this study sought to assess the impact of the ZIKV+IgG⁺complex on murine microglial cells. The cells were exposed to ZIKV, IgG antibodies, and the ZIKV+IgG⁺complex for 24 and 72 hours. Treatment-induced cytotoxic effects were evaluated using the cell viability assay, oxidative stress, and mitochondrial membrane potential. The findings indicated that IgG antibodies exhibit cytotoxic effects on microglia, whether alone or in the presence of ZIKV, leading to compromised cell viability, disrupted mitochondrial membrane potential, and heightened oxidative damage. Our conclusion is that IgG antibodies exert detrimental effects on microglia, triggering their activation and potentially disrupting the creation of a neurotoxic environment. Moreover, the presence of antibodies may correlate with an elevated risk of ZIKV-induced neuroinflammation, contributing to long-term CNS damage.
Research Article
Evaluation of the effects of the Zika Virus-Immunoglobulin G+ complex on murine microglial cells
https://doi.org/10.21203/rs.3.rs-4314197/v1
This work is licensed under a CC BY 4.0 License
You are reading this latest preprint version
Zika virus
Neuroinflammation
Maternal antibodies
Immunoglobulin G
Microglia
Immune response
Zika virus (ZIKV) was initially identified in 1947 in sentinel Rhesus monkeys in Uganda (Dick et al. 1952; Dick 1952). It is an arbovirus belonging to the Flaviviridae family and is transmitted by female mosquitoes of the genus Aedes spp. (Marchette et al. 1969; Musso et al. 2015). ZIKV infection poses significant public health concerns globally and has led to recent outbreaks accompanied by severe clinical neuropathies such as fetal microcephaly and Guillain-Barré Syndrome (GBS). Alongside microcephaly, other harmful manifestations of congenital neurological effects have been documented, collectively termed Congenital Zika Syndrome (CZS) (Mlakar et al. 2016). Evidence suggests that normocephalic children exposed to ZIKV in utero may experience delayed neurological development later in life (Faiçal et al. 2019). ZIKV infection during brain development impacts microglial cells, triggering a robust microglial immune response that fosters a pro-inflammatory environment (Kettenmann et al. 2011), potentially leading to malformations and disruptions in the central nervous system (CNS) (Hanners et al. 2016; Rock et al. 2004).
During pregnancy, only the immunoglobulin G (IgG) antibody class is transferred from the mother to the fetus. It's understood that IgG can traverse both the placental barrier and the blood-brain barrier (BBB) during pregnancy, with studies noting the presence of these antibodies in the developing brain. This suggests that maternal IgG antibodies might facilitate the translocation of the virus to the fetal brain (Leach et al. 1996; Wang et al. 2017). There's limited understanding regarding the nature of the maternal response to ZIKV and its potential impact on fetal development during pregnancy due to acquired antibodies. Furthermore, the anticipated outcomes related to fetal infection in pregnancies with prior viral infections remain unknown, along with how this virus accesses the fetus and instigates severe neuropathies. Therefore, markers associated with neuroinflammation, neuroimmunity, alterations in cell signaling pathways, cytotoxic effects released during neurodevelopment, and the role of the immune response in this process still require elucidation. Therefore, this study aimed to assess the cellular changes induced by the ZIKV+IgG⁺ complex in a BV-2 murine microglial lineage. Additionally, we examined adhesion potential, survival rates, reactive oxygen species (ROS) production, mitochondrial membrane potential, and gene expression in microglial cells exposed to the ZIKV+IgG⁺ complex.
Ethical aspects
The Scientific Committee of the School of Medicine of the Pontifical Catholic University of Rio Grande do Sul (PUCRS) approved this work under number 9545. It was conducted at the Neurosciences Laboratory of the Brain Institute of Rio Grande do Sul (BraIns). This project received approval from the National Research Ethics Committee of PUCRS under number 2,638,760.
Samples
Serum samples from pregnant women diagnosed with ZIKV were utilized to isolate ZIKV IgG⁺ antibodies. This material was obtained through projects resulting from the public call MCTI-CNPq/MEC-CAPES/MS-Decit number 14/2016. All participants were provided with information regarding the experimental procedures and signed the Informed Consent Form (ICF). Samples from four patients with serology were selected: IgG⁺/IgM⁻ for ZIKV; IgG⁻/IgM⁻ for dengue virus (DENV).
For the ZIKV samples, the Brazilian strain was utilized at a concentration of MOI 0.1. The Virology Laboratory of the Federal University of Rio Grande do Sul (UFRGS) supplied this strain, and the current project was registered in the National System for the Management of Genetic Heritage and Associated Traditional Knowledge (SiSGen) under number AE30E11.
Purification of immunoglobulin G present in serum pregnant women with ZIKV
To isolate ZIKV-IgG⁺ antibodies from the serum of pregnant women, we selected samples that tested positive exclusively for ZIKV-IgG⁺ antibodies and pooled four serum samples. Antibody purification was performed using KIT Magne® Protein G Beads (Promega Corporation, Wisconsin, USA), following the manufacturer's instructions. This technique employs high-affinity magnetic beads for isolating immunoglobulin G from biological samples. To isolate the antibodies, we incubated 50 µl of serum with 50 µl of magnetic beads for 60 minutes. Following incubation, we conducted serial washes with PBS (pH 7.4) to eliminate nonspecific proteins. Subsequently, the immunoglobulins G were eluted in a 100 mM glycine solution (GlyHCL pH 2.7) and quantified using a NanoDrop Lite spectrophotometer (Thermo Scientific, Massachusetts, USA) at a wavelength of A280 nm.
Murine microglial lineage culture
Cultures of immortalized murine microglia (BV-2), provided by the Laboratory of Neurotoxins at PUCRS, were cultivated for use in the experiments. These microglial cells exhibit branched and amoeboid phenotypes and are partially activated. The cells were cultured in RPMI culture medium supplemented with 10% inactivated fetal bovine serum (FBS), 1% penicillin/streptomycin, and 0.1% gentamicin, all purchased from Gibco™ (Life Technologies, California, USA). BV-2 cells were maintained in 75 cm² flasks at 37°C in a humidified atmosphere containing 5% CO2. Upon reaching 90% confluence, they were utilized for the experiments. For the experimental tests, the cells were transitioned to RPMI medium with reduced FBS (final concentration 1%) to enhance experimental performance. Cell viability was evaluated before each experiment as part of the standard protocol using the automated cell counter CytoSmart Cell Counter (Corning, New York, USA).
Experimental design
BV-2 murine microglia were seeded in 96-well culture plates for the adhesion assay, 6-well plates for RT-qPCR, and 24-well plates for cell viability assays (MTT), reactive oxygen species production (oxidation of 2′-7′-dichlorofluorescein diacetate (DCFH-DA)), and mitochondrial membrane potential (fluorescent probe 5.5′, 6.6′-tetrachloro-1.1′, 3,3′-tetraethylbenzimidazolyl-carbocyanine iodide (JC-1)). Following adhesion to the substrate, cells were exposed to the following treatments (Table 1): (1) ZIKV (concentration: MOI 0.1); (2) IgG antibodies at a concentration of 100 µg/ml; (3) ZIKV+IgG⁺ complex at the same concentrations as above; (4) 1% FBS control group. Cells were subjected to treatments for 24 and 72 hours and analyzed after each period.
Cell adhesion assay
To evaluate the adhesion capacity of the BV-2 microglial lineage exposed to treatments, a total of 1x104 cells/well were seeded in 96-well plates, in triplicate, and subjected to the different treatments. After 2 hours, the culture medium was aspirated, and the cells were washed three times with PBS (pH 7.4) to remove non-adherent cells. Subsequently, the cells were fixed with 4% paraformaldehyde (PFA) for 10 minutes. Following fixation, they were stained with 0.5% crystal violet (dissolved in 20% methanol) for 10 minutes, followed by three washes with pure water. Finally, the cells were eluted with 10% acetic acid, and the absorbance was measured at 570 nm using a Bio-Rad spectrophotometer (Bio-Rad Laboratories, California, USA).
Cell viability assay
Cell viability was determined using the MTT assay to measure the production of Formazan {[3-(4,5-dimethylthiazol-2yl)-2,5-diphenyl-2H-tetrazolium]} bromide (Sigma Aldrich, Missouri, USA). A total of 1x105 cells/well were seeded, in triplicate, in 24-well plates and exposed to treatments for 24 and 72 hours. Subsequently, they were incubated with a 0.5 mg/ml MTT solution diluted in PBS (pH 7.4) for 3 hours at 37°C and protected from light. After removing the solution, cells were lysed with 300 µl/well of dimethylsulfoxide (DMSO) (Sigma-Aldrich, Missouri, USA). To quantify the absorbance, 200 µl of the lysed solution was transferred to a 96-well plate, and the absorbance was measured at 570 nm using the Bio-Rad spectrophotometer (Bio-Rad Laboratories, California, USA). The absorbance values were converted into percentages using the formula: (mean absorbance of treatments × 100) / (mean absorbance of control).
Determination of the production of reactive oxygen species
To assess the production of ROS, the oxidation test of 2′,7′-Dichlorofluorescein diacetate (DCFH-DA) was conducted. For the assay, performed in triplicate, a total of 1x105 cells/well were seeded in a 24-well plate. Following treatments, BV-2 cells were exposed to DCFH-DA (10 µM) for 30 minutes at 37°C. Cell lysis was carried out with PBS/Triton X-100, and fluorescence was measured using a Spectra Max M2 plate reader (Molecular Devices, California, USA) with excitation at 485 nm and emission at 520 nm. The number of proteins (mg of total proteins) was determined using the NanoDrop Lite spectrophotometer at A280 nm. The results were expressed in fluorescence units/mg protein and converted to a percentage (Quincozes-Santos et al. 2009).
Evaluation of mitochondrial membrane potential
The mitochondrial membrane potential (ΔΨm) was assessed in triplicate using the JC-1 assay. After exposure to treatments, BV-2 cells were incubated with 3 µM of JC-1 diluted in RPMI medium for 30 minutes at 37°C. At the conclusion of the incubation period, the fluorescence emitted by the cells was measured using a Spectra Max M2 plate reader (Molecular Devices, California, USA). Two readings were taken at different wavelengths: the first reading at 490/530 nm and the second at 490/590 nm. The mitochondrial membrane potential was calculated by determining the ratio of 590 nm (red fluorescent J aggregates) to 530 nm (green monomeric) (Quincozes-Santos et al. 2013). The results are presented as a percentage.
RNA extraction and cDNA synthesis
After 24 and 72 hours of exposure to treatments, cells were harvested for intracellular RNA extraction using the SV Total RNA kit (Promega Corporation, Wisconsin, USA), following the manufacturer's instructions. The samples were exposed to a lysis buffer, heated to 70°C for 3 minutes, and then centrifuged at 12,000 x g for 10 minutes at 4°C. The supernatant was collected and 200 µL of 95% ethyl alcohol was added. The mixture was transferred to a silica column and centrifuged at 12,000 x g for 1 minute. Next, 600 µL of buffer was added and centrifuged again at 12,000 x g for 1 minute. The DNase enzyme was diluted in buffer, magnesium chloride was added, and the solution was incubated for 15 minutes at room temperature. The columns were then eluted with 100 µL of RNase-free water by centrifugation at 12,000 x g for 2 minutes.
cDNA synthesis was performed using the GoScript™ Reverse Transcription Mix Oligo(dT) kit (Promega Corporation, Wisconsin, USA), following the manufacturer's instructions. 10 µL of RNA was combined with 10 µL of the master mix and subjected to thermal cycling (25°C for 10 minutes, 42°C for 60 minutes, and 85°C for 5 minutes) using a Verit thermal cycler (Thermo Fisher Scientific Inc., Massachusetts, USA). The DNA complementary to the extracted RNA was quantified using NanoDrop (Thermo Fisher Scientific Inc., Massachusetts, USA) according to the manufacturer's guidelines.
RT-qPCR
Gene expression analysis was conducted using the RT-qPCR technique with the StepOne Plus equipment (Life Technologies, California, USA). Amplifications were performed using 20 ng of cDNA for each sample. Assays were conducted on individual plates for each gene, utilizing the GAPDH gene as an endogenous expression control. Primers complementary to the gene sequences listed in Table 2 were employed. This assay was performed in triplicate for each group and time, with 12 samples for 24 hours and 12 samples for 72 hours, totaling 24 samples. The target genes investigated were ZIKV and Syntaxin 1 (STX1-A).
Table 2 Sequence of used genes
|
Gene |
Forward sequence |
Reverse sequence |
|
GAPDH |
TGAAGGTCGGAGTCAACGGATTTGGT |
CATGTGGGCCATGAGGTCCACCC |
|
STX1-A |
ATCGCAGAGAACGTGGAGGAG |
AGCGTGGAGTGCTGTGTCTTC |
|
ZIKV |
TAATACGACTCACTATAGGGTTGGTCA TGATACTGCTGATTGC |
CCTTCCACAAAGTCCCTATTGC |
Statistical analysis
For molecular analysis, the 2^-ΔΔCT method was employed. Statistical differences between the control group and treatments were determined using one-way analysis of variance (ANOVA), followed by Tukey's post hoc test in GraphPad Prism (version 9, GraphPad Software Inc., USA). The results were presented as mean ± standard error and p values <0.05 were considered statistically significant.
Adherence capacity of BV-2 cells exposed to the ZIKV+IgG⁺complex
No significant difference was observed in the group of cells exposed to ZIKV (Figure 1), with 95.12% of adhered cells, suggesting that the virus does not impact the adhesion of the microglial lineage. However, a notable decrease was observed in the group exposed to IgG⁺ antibodies, with 76.55% of cell adhesion, and in the group exposed to the ZIKV+IgG⁺ complex, with 83.77%. These findings indicate that both the presence of isolated antibodies and the ZIKV+IgG⁺ complex interfere with the cell adhesion process compared to the control and the ZIKV-exposed group. This influence detrimentally affects cell adhesion behavior and potentially compromises the effectiveness of microglia in the microenvironment.
Survival of BV-2 cells exposed to the ZIKV+IgG⁺ complex
Following exposure to treatments for 24 and 72 hours, the MTT assay was conducted to evaluate the cytotoxic effect of the ZIKV+IgG⁺ complex on BV-2 cells (Figure 2). Cells exposed to the ZIKV+IgG⁺ complex exhibited a decrease in viability over time. At 24 hours, BV-2 murine microglia displayed a viability of 95.63%, which decreased to 80.5% at 72 hours. Cells exposed solely to IgG⁺ antibodies also experienced a reduction in viability, albeit to a slightly lesser extent than the aforementioned group, with viabilities of 90.5% at 24 hours and 86.13% at 72 hours of exposure. Microglial exposure to ZIKV did not yield a statistically significant outcome; there was an initial increase in cell viability to 110.13% within 24 hours of treatment, followed by a reduction to 94.76% viable cells at 72 hours. Compared to the other groups, cells exposed to the ZIKV+IgG⁺ complex exhibited the lowest viability percentage over time, indicating that the presence of antibodies linked to the virus could induce deleterious effects on the long-term survival of microglial cells, potentially surpassing the harmful effects of the virus itself.
Production of ROS by BV-2 cells exposed to the ZIKV+IgG⁺ complex
Following exposure to ZIKV, IgG⁺, and ZIKV+IgG⁺ treatments for 24 and 72 hours, the production of ROS by the cells was assessed (Figure 3). It was observed that there was a comparable percentage of ROS produced in cells treated with ZIKV, IgG⁺, and ZIKV+IgG⁺ during the initial 24-hour exposure period, with values of 77.98%, 79.32%, and 96.48% respectively. The percentage of intracellular oxidants produced by these cells was below that of the control group, contrary to the expected increase. Therefore, our results were not considered statistically significant within the initial 24 hours of treatment exposure. However, we noted an elevation in ROS production in cells after 72 hours of exposure, particularly in cells exposed to the ZIKV+IgG⁺ complex. This group exhibited a percentage of 140.12% of oxidants produced compared to the control, followed by 132.47% in the group exposed to IgG⁺ antibodies and 113.4% in the ZIKV-treated group. These findings suggest that prolonged exposure to both antibodies and the ZIKV+IgG⁺ complex leads to increased reactive species production, which may contribute to a chronic inflammatory state and irreversible damage to neighboring cells, particularly neurons, potentially resulting in developmental alterations and cell death.
The mitochondrial membrane potential of BV-2 cells exposed to the ZIKV+IgG⁺ complex
Following exposure to treatments with ZIKV, IgG⁺, and ZIKV+IgG⁺ for 24 and 72 hours, mitochondrial membrane potential was evaluated using the JC-1 fluorescence assay (Figure 4). Similar to the ROS production assay, there was comparability among the groups in terms of the percentage of mitochondrial membrane potential during the initial 24-hour exposure period. The ZIKV-exposed group exhibited 99.94% membrane potential, followed by the ZIKV+IgG⁺ group with 96.26% and the IgG⁺ group with 88.62%, which were not statistically significant. However, cells treated with IgG⁺ and ZIKV+IgG⁺ for 72 hours showed a significant reduction in mitochondrial membrane potential, with values of 53.75% and 54.82% respectively. Both antibody-exposed groups exhibited significant differences compared to the control group, but not significant when compared to the ZIKV-exposed group, which showed 69.77% of cells with intact mitochondrial membrane. With prolonged exposure time, we observed a decrease in mitochondrial membrane potential in cells. Particularly noteworthy was the greater reduction observed in cells exposed to both IgG⁺ and ZIKV+IgG⁺, suggesting that the presence of the antibody may activate microglia through mechanisms that adversely affect mitochondrial membrane permeability.
Gene expression in BV-2 cells exposed to the ZIKV+IgG⁺ complex
Following exposure to treatments with ZIKV, IgG⁺, and the ZIKV+IgG⁺ complex for 24 and 72 hours, the cells were analyzed for the expression of the STX1-A gene (Figure 5). Analysis of the 24-hour exposure period revealed a 2.37-fold reduction in the relative expression of the STX1-A gene in cells exposed to ZIKV and a 1.73-fold reduction in cells exposed to the ZIKV+IgG⁺ complex. Conversely, the group exposed to IgG⁺ antibodies exhibited a 1.09-fold increase in STX1-A gene expression compared to the other groups (p<0.005). Analysis of the same gene after 72 hours of exposure showed a 1.12-fold increase in relative expression in the ZIKV group. In the IgG⁺ group, expression was 4.11 times higher (p<0.05) compared to the ZIKV+IgG⁺ complex group, which exhibited 1.85 times lower STX1-A expression. At both time points, there was no significant difference between the ZIKV groups and the ZIKV+IgG⁺ complex.
Detection of ZIKV in infected cells
Viral particles of ZIKV were detected in the cells of all analyzed groups (Figure 6). The analysis was conducted qualitatively by observing the amplification curves for the ZIKV target sequence.
The primary objective of this study was to assess the impact of the ZIKV+IgG⁺ complex on immune cells of a murine microglial lineage. To achieve this goal, we investigated the production of ROS, the expression of the STX1-A gene, and the mitochondrial membrane potential in BV-2 cells exposed to these treatments over two time periods: 24 hours and 72 hours.
To evaluate potential influences on cell adhesion, BV-2 cells were exposed to ZIKV, IgG⁺ antibodies, and the ZIKV+IgG⁺ complex. We observed minimal interference with cell adhesion in cells exposed to ZIKV alone. In contrast, both groups containing antibodies, the IgG⁺ and ZIKV+IgG⁺ groups, exhibited a reduction in microglial cell adhesion. When exposed to ZIKV, certain cell types, such as leukocytes and glioblastoma cells, demonstrate an increase in the expression of adhesion-related proteins. This enhances the cells' ability to spread to adhere to vessel walls, and transmigrate through the endothelium (Ayala-Nunez et al. 2019; Clé et al. 2020). Essentially, the virus appears to manipulate adhesive properties to facilitate its spread (Ayala-Nunez et al. 2019; Clé et al. 2020).
The BV-2 cells treated with IgG exhibited a higher detachment rate from the culture plate compared to the other groups and the control. This increased detachment may be attributed to the presence of immunoglobulin receptors on microglia, potentially influencing the detachment of cells adhered to the substrate in the IgG⁺ exposed group, possibly due to these receptors present on the cell membrane (Vedeler et al. 1994). Research suggests that pre-existing IgG antibodies to certain viruses have the potential to exacerbate the severity of the ongoing infection (Katzelnick et al. 2017; Salje et al. 2018). For instance, prior exposure to DENV could result in cross-reactivity and might impact the vertical transmission of ZIKV, thereby enhancing fetal infection (Andrade and Harris 2018; Halstead 2017). Although there is no conclusive evidence that IgG antibodies to ZIKV acquired from a previous maternal infection could predispose to abnormal outcomes in newborns, our study observed that IgG⁺ antibodies were cytotoxic to murine microglia culture, whether alone or in association with ZIKV, when compared to the control.
Microglial cells exposed to IgG⁺ antibodies exhibited reduced cell viability during the 24-hour exposure period compared to the control group. There was a further decline in viability within 72 hours compared to the control. Cells exposed to the ZIKV+IgG⁺ complex showed higher viability within 24 hours compared to the group treated with isolated antibodies. However, over extended exposure, these cells displayed decreased viability compared to the control, indicating that the presence of the ZIKV+IgG⁺ complex becomes detrimental to the cells over time. Concerning cells exposed to ZIKV, there was no significant differences in viability either at 24 hours or at 72 hours of exposure. These findings align with those reported by Jhan et al. (2017), where flavivirus infection did not induce significant inhibitory or cytotoxic effects in microglial cells, despite their permissiveness to ZIKV infection and ability to replicate viral particles. Our data suggest a cytopathic effect induced by the ZIKV+IgG⁺ complex in microglial cells, demonstrating greater cytotoxicity in terms of altering cell viability. Consequently, this complex may have deleterious functional effects on extracellular signaling, stress responses, and cell survival (Perry and Holmes 2014).
As detailed in this study, we investigated the production of ROS in murine microglia exposed to ZIKV, IgG⁺ antibodies, and the ZIKV+IgG⁺ complex over 24 and 72-hour periods. During the initial 24-hour exposure, we observed no significant differences between groups, despite a slight elevation in ROS production across all treatments. It's important to note that this lack of discernible effects shouldn't be interpreted as negative, as the microglia already proved to be vulnerable in the first period to infection and activation in the first 24 hours if compared to the time proposed in this study. However, in the 72-hour exposure period, we observed an increase in ROS production across all treated groups, indicating a deleterious impact of the treatments on the cells, prompting an upregulation in intracellular ROS levels. The group exposed to the ZIKV+IgG⁺ complex exhibited the highest rate of oxidant production, followed by the IgG⁺ antibody-treated group and the ZIKV-exposed group. These findings suggest that microglial cells exposed to the antigen-antibody complex responded more vigorously, leading to an increased production of intracellular reactive species. The elevated ROS production is a common outcome of flavivirus infections, and an increase in ROS levels due to ZIKV infection in the brains of infected mice has already been described (Fernandez-Garcia et al. 2009; Nem de Oliveira Souza et al. 2018). Contrary to these previous findings, the cells treated with the virus in our study exhibited the lowest ROS production compared to the groups treated with antibodies.
Microglia play a beneficial role in contributing to neuronal regeneration in the CNS. However, some studies have raised questions about this, as it has been shown that microglia can produce neurotoxic agents in culture (Kristina et al. 2009). The antibodies have shown a greater influence on the cellular activation and microglial response, leading to an increased production of ROS. The mechanisms underlying this phenomenon remain unknown. Previous studies have already reported the expression of FcγR receptors on microglial cells, which bind to IgG and elicit pro-inflammatory responses within the CNS, including the release of cytokines and other mediators such as ROS production (Vedeler et al. 1994). Based on findings in the literature and the data analysis from our study, it can be inferred that the increased ROS generation may coincide with DNA damage, mitochondrial dysfunction, and consequently, a decrease in membrane potential (Carbone et al. 2013; Ledur et al. 2020).
In brain tissue, microglial cells remain in their quiescent state, scanning the environment until some stimulus appears to transform their state (Hanisch and Kettenmann 2007). This transition from resting to the activated state may be accompanied by increased energy consumption of these cells along with changes in the functional state of mitochondria (Banati and Graeber 1994; Banati et al. 2004). Changes in cell metabolism due to pathogenic stimuli, such as congenital ZIKV infection, can lead to harmful alterations in fetal neurodevelopment through the cellular response to cytokines and inflammatory mediators, resulting in inhibition of the mitochondrial respiratory chain, decrease in oxygen metabolism, and alteration in cellular respiratory activity due to dysfunction in mitochondrial membrane potential (Banati and Graeber 1994; Banati et al. 2004). As a consequence of the primary damage to microglia, the inflammatory profile with the presence of oxidative stress and high production of ROS results in damage to other glial cells and neurons, potentially leading to cell death due to toxicity established in the brain (Kristina et al. 2009). Given that studies indicate mitochondrial changes in activated microglia, we evaluated mitochondrial membrane potential in murine microglial cells in this study.
After a 24-hour exposure of murine microglia to ZIKV, IgG⁺ antibodies, and the ZIKV+IgG⁺ complex, we observed minimal changes in mitochondrial membrane potential, with a more noticeable decrease in the group exposed to ZIKV-IgG⁺ antibodies. However, none of the groups showed statistically significant differences regarding the impact of treatments on mitochondrial membrane potential. Based on the results from the 24-hour exposure period, it is plausible to consider that microglia initially receive the stimulus from the pathogenic agent, which may lead to subsequent alterations in mitochondrial membrane potential due to increased energy demand for functionality and secretion of toxic products, as observed in our findings during the longer exposure period.
In the 72-hour exposure period to the same treatments, we observed a significant decrease in mitochondrial membrane potential in cells, particularly in the groups exposed to IgG⁺ antibodies and the ZIKV+IgG⁺ complex, respectively. In an attempt to respond to the stimulus experienced, the energy demand on microglial cells exposed to treatments from these two groups may have overwhelmed the mitochondria, causing stress on these organelles. Although we did not observe effects in the initial 24-hour exposure period, the reduction in mitochondrial membrane potential was significantly more pronounced after 72 hours of exposure to IgG⁺ antibodies and the antigen-antibody complex. Our findings align with studies by Mosser and Edwards (2008) and Mosser (2003), where they discuss the potential interaction between FcγR expressed in microglial cells and IgG that results in the release of ROS due to possible alterations in the mitochondria, acting as potent agents of tissue damage. This suggests that prolonged exposure to IgG may induce stress on mitochondria, which leads to an imbalance in their mitochondrial membrane potential, because the stimulation caused by antibodies consistently impaired microglial cells (Mosser and Edwards 2008; Mosser 2003).
Within 24 hours of exposure, both groups exposed to ZIKV showed a reduction in the relative expression of the STX1-A gene, unlike the group exposed to IgG⁺ antibodies, which exhibited no change in relative expression, similarly to the control group. After 72 hours of exposure, there was an approximately 4-fold increase in the expression of STX1-A in the IgG⁺ exposed group compared to the other groups. In this context, we can suggest that upon entry of ZIKV into cells, the presence of its viral RNA acts as an inhibiting factor in the transcription of STX1-A, a molecule that plays an important role in synaptic signaling and neuronal circuits (Deken et al. 2000). Consequently, our data also indicate that the presence of the antibody in the ZIKV+IgG⁺ complex does not inhibit the entry of the virus into the cell, as there was also a decrease in gene transcription in this group. Studies reveal that in neural precursor cells, ZIKV infection can negatively regulate genes related to the cell cycle and positively regulate genes related to protein transcription and transport (Tang et al. 2016). Regarding IgG antibodies, researchers have found that the presence of IgG for autoimmune diseases such as systemic lupus erythematosus (SLE) induces a high inflammatory response in microglia cultures via IgG binding to microglia through the FcγR receptor present in the cells (Yang et al. 2019), indicating that this binding can activate intracellular mechanisms of gene transcription.
STX1-A directly participates in regulating synaptic signaling through the release of presynaptic vesicles, mechanisms such as phagocytosis, and is shown to be related to the regulation of neurotransmitter uptake and activating their transporters (Dizdaroglu 2012; Fattorini et al. 2020). Given its involvement in various aspects of embryonic development, variations in its expression may contribute to disorders affecting the nervous system, including autism, memory and learning deficits, movement disorders, and epilepsy (Tang 2021).
Evidence demonstrates that, for other flaviviruses, infection is associated with increased viral loads, and the most critical phase of the disease manifests later, when viral titers start to decrease (Hanners et al. 2016). This study corroborates these findings, as the 72-hour exposure period showed the lowest viral load but proved to be the most harmful to microglia in culture. As the entry of DENV and increased expression of its viral protein can be observed within 24 hours after infection in the microglial lineage BV-2 (Jhan et al. 2017), this aligns with our results. We observed a peak in ZIKV viral RNA expression in microglial cells within 24 hours of exposure, followed by a decline in viral presence with longer exposure times. This suggests that ZIKV may utilize the acute phase of infection to invade and replicate its viral proteins in cells, with a possible activation of inhibitory mechanisms of its RNA expression after infection, initiating the microglial immune response (Culshaw et al. 2017; Libraty et al. 2002).
The initial studies on congenital ZIKV infection primarily focused on stem cells and neural progenitors. However, numerous discoveries have confirmed the virus's tropism for glial cells, including microglia (Nem de Oliveira Souza et al. 2018; Simonin et al. 2016), as shown in this study. As they are primary immunosurveillance cells in the brain and respond to ZIKV-induced inflammation, microglial cells become targets for infectious agents invading the CNS (Rock et al. 2004). Antibodies that reach the brain due to BBB dysfunction can exert direct cytotoxic effects on microglia and indirect effects on adjacent cells, such as neurons, resulting in both short and long-term irreversible damage, particularly in the presence of the virus (Rathore et al. 2019). Therefore, a deeper understanding of the role of FcγRs during neurodevelopment is essential, as the antibody-antigen complex is shown to have a significant role in regulating IgG-mediated immune signaling in the CNS (Stamou et al. 2018).
Cellular responses to maternal antibodies can serve as evidence for congenital ZIKV infection. Studies suggest variations in the levels of ZIKV-specific maternal IgG antibody titers in cases of congenital ZIKV infection (Moreira-Soto et al. 2017). Alternatively, these differences could be attributed to a potential prior exposure to a flavivirus that resuls in higher antibody titers with more pronounced outcomes (Moreira-Soto et al. 2017). However, in our studies, we utilized serum samples from individuals who tested positive only for ZIKV-IgG. Another factor to consider is the choice of cell line, viral strain, and assay protocol, which could contribute to variations in results. Therefore, conducting experiments while controlling for these variables would yield more precise and specific results.
By consolidating the findings from this study with existing literature, important questions have emerged regarding the role of maternal antibodies in the severity of microglia-mediated neuroinflammation triggered by ZIKV infection. While there are reports suggesting that specific maternal ZIKV antibodies transferred to the fetus can impact flavivirus infections, antibodies against ZIKV may also have a detrimental impact on virus reinfection. Therefore, it is crucial to continue investigating whether preexisting antibodies might contribute to maternal-fetal transmission and ZIKV pathology. Understanding the mechanisms of the virus's immunobiology and how maternal antibodies might modulate the immune response to ZIKV can provide insights into the underlying causes of the heightened severity of the disease observed in outbreaks involving various neuropathies.
In summary, our study indicates that ZIKV does not elicit significant cytotoxic effects on microglial cell lines compared to uninfected cells or the action of IgG⁺ antibodies, despite its ability to invade and infect cells with its viral particles. Conversely, IgG⁺ antibodies exhibited detrimental effects on microglial cells, as evidenced by exposure to isolated IgG⁺ and the ZIKV+IgG⁺ complex, leading to cytotoxicity, reduced cell viability, increased production of intracellular ROS, and decreased mitochondrial membrane potential of cells. Lastly, our findings suggest that the presence of maternal antibodies to ZIKV may exert a deleterious influence on CNS immune cells, which play crucial roles in brain homeostasis and pathogen elimination. Therefore, the IgG⁺ antibodies potentially act as contributing factors to the neuroinflammation caused by ZIKV infection.
Acknowledgments The authors would like to acknowledge the Conselho Nacional de Desenvolvimento Científico e Tecnológico (CNPq) and the Coordenação de Aperfeiçoamento de Pessoal de Nível Superior (CAPES), Brazilian Federal Agency for Support and Evaluation of Graduate Education (PROEX Program).
Funding This study was financed in part by the Coordenação de Aperfeiçoamento de Pessoal de Nível Superior (CAPES) – Brazil – Finance Code 001.
Conflict of interest The authors declare that this research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest. LSS received scholarships from Conselho Nacional de Desenvolvimento Científico e Tecnológico (CNPq/Brazil). JCC and DRM have nothing to disclose.
- Andrade DV, Harris E (2018) Recent advances in understanding the adaptive immune response to Zika virus and the effect of previous flavivirus exposure. Virus Res 254:27–33. doi: 10.1016/j.virusres.2017.06.019
- Quincozes-Santos A, Nardin P, de Souza DF, Gelain DP, Moreira JC, Latini A, Gonçalves CA, Gottfried C (2009) The Janus Face of Resveratrol in Astroglial Cells. Neurotox Res 16:30–41. doi: 10.1007/s12640-009-9042-0
- Banati RB, Egensperger R, Maassen A, Hager G, Kreutzberg GW, Graeber MB (2004) Mitochondria in activated microglia in vitro. J Neurocytol 33:535–541. doi: 10.1007/s11068-004-0515-7
- Banati RB, Graeber MB (1994) Surveillance, Intervention and Cytotoxicity: Is There a Protective Role of Microglia? Dev Neurosci 16:114–127. doi: 10.1159/000112098
- Carbone F, Nencioni A, Mach F, Vuilleumier N, Montecucco F (2013) Evidence on the pathogenic role of auto-antibodies in acute cardiovascular diseases. Thromb Haemost 109:854–868. doi: 10.1160/th12-10-0768
- Clé M, Desmetz C, Barthelemy J, Martin M-F, Constant O, Maarifi G, Foulongne V, Bolloré K, Glasson Y, De Bock F, Blaquiere M, Dehouck L, Pirot N, Tuaillon E, Nisole S, Najioullah F, Van de Perre P, Cabié A, Marchi N, Gosselet S, Simonin Y, Salinas S (2020) Zika Virus Infection Promotes Local Inflammation, Cell Adhesion Molecule Upregulation, and Leukocyte Recruitment at the Blood-Brain Barrier. mBio 11: doi: 10.1128/mbio.01183-20
- Culshaw A, Mongkolsapaya J, Screaton GR (2017) The immunopathology of dengue and Zika virus infections. Curr Opin Immunol 48:1–6. doi: 10.1016/j.coi.2017.07.001
- Dick GWA (1952) Zika virus (II). Pathogenicity and physical properties. Trans R Soc Trop Med Hyg 46:521–534. doi: 10.1016/0035-9203(52)90043-6
- Dick GWA, Kitchen SF, Haddow AJ (1952) Zika Virus (I). Isolations and serological specificity. Trans R Soc Trop Med Hyg 46:509–520. doi: 10.1016/0035-9203(52)90042-4
- Dizdaroglu M (2012) Oxidatively induced DNA damage: Mechanisms, repair and disease. Cancer Lett 327:26–47. doi: 10.1016/j.canlet.2012.01.016
- Faiçal AV, de Oliveira JC, Oliveira JVV, de Almeida BL, Agra IA, Alcantara LCJ, Acosta AX, de Siqueira IC (2019) Neurodevelopmental delay in normocephalic children with in utero exposure to Zika virus. BMJ Paediatrics Open 3:e000486. doi: 10.1136/bmjpo-2019-000486
- Fernandez-Garcia MD, Mazzon M, Jacobs M, Amara A (2009) Pathogenesis of Flavivirus Infections: Using and Abusing the Host Cell. Cell Host Microbe 5:318–328. doi: 10.1016/j.chom.2009.04.001
- Garaschuk O, Verkhratsky A (2019) Physiology of Microglia. Microglia 2034:27–40. doi: 10.1007/978-1-4939-9658-2_3
- Giorgia Fattorini, Catalano M, Melone M, Serpe C, Bassi S, Limatola C, Conti F (2019) Microglial expression of GAT‐1 in the cerebral cortex. Glia 68:646–655. doi: 10.1002/glia.23745
- Halstead SB (2017) Biologic Evidence Required for Zika Disease Enhancement by Dengue Antibodies. Emerg Infect Dis 23:569–573. doi: 10.3201/eid2304.161879
- Hanners NW, Eitson JL, Usui N, Richardson RB, Wexler EM, Konopka G, Schoggins JW (2016) Western Zika Virus in Human Fetal Neural Progenitors Persists Long Term with Partial Cytopathic and Limited Immunogenic Effects. Cell Rep 15:2315–2322. doi: 10.1016/j.celrep.2016.05.075
- Jhan MK, Tsai TT, Chen CL, Tsai CC, Cheng YL, Lee YC, Ko CY, Lin YS, Chang CP, Lin LT, Lin CF (2017) Dengue virus infection increases microglial cell migration. Sci Rep 7: doi: 10.1038/s41598-017-00182-z
- Katzelnick LC, Gresh L, Halloran ME, Mercado JC, Kuan G, Gordon A, Balmaseda A, Harris E (2017) Antibody-dependent enhancement of severe dengue disease in humans. Science (New York, NY) 358:929–932. doi: 10.1126/science.aan6836
- Kigerl KA, Gensel JC, Ankeny DP, Alexander JK, Donnelly DJ, Popovich PG (2009) Identification of Two Distinct Macrophage Subsets with Divergent Effects Causing either Neurotoxicity or Regeneration in the Injured Mouse Spinal Cord. J Neurosci 29:13435–13444. doi: 10.1523/jneurosci.3257-09.2009
- Leach JL, Sedmak DD, Osborne JM, Rahill B, Lairmore MD, Anderson CL (1996) Isolation from human placenta of the IgG transporter, FcRn, and localization to the syncytiotrophoblast: implications for maternal-fetal antibody transport. J Immunol 157:3317–3322. doi: 10.4049/jimmunol.157.8.3317
- Ledur PF, Karmirian K, Pedrosa CDSG, Souza LRQ, Assis-de-Lemos G, Martins TM, Ferreira JCCG, de Azevedo Reis GF, Silva ES, Silva D, Salerno JA, Ornelas IM, Devalle S, Madeiro da Costa RF, Goto-Silva L, Higa LM, Melo A, Tanuri A, Chimelli L, Murata MM, Garcez PP, Filippi-Chiela EC, Galina A, Borges HL, Rehen SK (2020) Zika virus infection leads to mitochondrial failure, oxidative stress and DNA damage in human iPSC-derived astrocytes. Sci Rep 10: doi: 10.1038/s41598-020-57914-x
- Libraty DH, Endy TP, Houng HS, Green S, Kalayanarooj S, Suntayakorn S, Chansiriwongs W, Vaughn DW, Nisalak A, Ennis FA, Rothman AL (2002) Differing Influences of Virus Burden and Immune Activation on Disease Severity in Secondary Dengue‐3 Virus Infections. J Infect Dis 185:1213–1221. doi: 10.1086/340365
- Marchette NJ, Garcia R, Rudnick A (1969) Isolation of Zika Virus from Aedes Aegypti Mosquitoes in Malaysia. Am J Trop Med Hyg 18:411–415. doi: 10.4269/ajtmh.1969.18.411
- Mlakar J, Korva M, Tul N, Popović M, Poljšak-Prijatelj M, Mraz J, Kolenc M, Resman Rus K, Vesnaver Vipotnik T, Fabjan Vodušek V, Vizjak A, Pižem J, Petrovec M, Avšič Županc T (2016) Zika Virus Associated with Microcephaly. N Engl J Med 374:951–958. doi: 10.1056/nejmoa1600651
- Moreira-Soto A, Sarno M, Pedroso C, Netto EM, Rockstroh A, Luz E, Feldmann M, Fischer C, Bastos FA, Kümmerer BM, de Lamballerie X, Drosten C, Ulbert S, Brites C, Drexler JF (2017) Evidence for Congenital Zika Virus Infection From Neutralizing Antibody Titers in Maternal Sera, Northeastern Brazil. J Infect Dis 216:1501–1504. doi: 10.1093/infdis/jix539
- Mosser DM (2003) The many faces of macrophage activation. J Leukoc Biol 73:209–212. doi: 10.1189/jlb.0602325
- Mosser DM, Edwards JP (2008) Exploring the full spectrum of macrophage activation. Nat Rev Immunol 8:958–969. doi: 10.1038/nri2448
- Musso D, Cao-Lormeau VM, Gubler DJ (2015) Zika virus: following the path of dengue and chikungunya? Lancet 386:243–244. doi: 10.1016/s0140-6736(15)61273-9
- Nem de Oliveira Souza I, Frost PS, França JV, Nascimento-Viana JB, Neris RLS, Freitas L, Pinheiro DJLL, Nogueira CO, Neves G, Chimelli L, De Felice FG, Cavalheiro ÉA, Ferreira ST, Assunção-Miranda I, Figueiredo CP, Da Poian AT, Clarke JR (2018) Acute and chronic neurological consequences of early-life Zika virus infection in mice. Sci Transl Med 10:eaar2749. doi: 10.1126/scitranslmed.aar2749
- Ayala-Nunez NV, Follain G, Delalande F, Hirschler A, Partiot E, Hale GL, Bollweg BC, Roels J, Chazal M, Bakoa F, Carocci M, Bourdoulous S, Faklaris O, Zaki SR, Eckly A, Uring-Lambert B, Doussau F, Cianferani S, Carapito C, Jacobs FMJ, Jouvenet N, Goetz JG, Gaudin R (2019) Zika virus enhances monocyte adhesion and transmigration favoring viral dissemination to neural cells. Nat Commun 10: doi: 10.1038/s41467-019-12408-x
- Perry VH, Holmes C (2014) Microglial priming in neurodegenerative disease. Nat Rev Neurol 10:217–224. doi: 10.1038/nrneurol.2014.38
- Quincozes-Santos A, Bobermin LD, Latini A, Wajner M, Souza DO, Gonçalves CA, Gottfried C (2013) Resveratrol Protects C6 Astrocyte Cell Line against Hydrogen Peroxide-Induced Oxidative Stress through Heme Oxygenase 1. PLoS ONE 8:e64372. doi: 10.1371/journal.pone.0064372
- Rathore APS, Saron WAA, Lim T, Jahan N, St John AL (2019) Maternal immunity and antibodies to dengue virus promote infection and Zika virus–induced microcephaly in fetuses. Sci Adv 5:eaav3208. doi: 10.1126/sciadv.aav3208
- Rock RB, Gekker G, Hu S, Sheng WS, Cheeran M, Lokensgard JR, Peterson PK (2004) Role of Microglia in Central Nervous System Infections. Clin Microbiol Rev 17:942–964. doi: 10.1128/cmr.17.4.942-964.2004
- Salje H, Cummings DAT, Rodriguez-Barraquer I, Katzelnick LC, Lessler J, Klungthong C, Thaisomboonsuk B, Nisalak A, Weg A, Ellison D, Macareo L, Yoon IK, Jarman R, Thomas S, Rothman AL, Endy T, Cauchemez S (2018) Reconstruction of antibody dynamics and infection histories to evaluate dengue risk. Nature 557:719–723. doi: 10.1038/s41586-018-0157-4
- Simonin Y, Loustalot F, Desmetz C, Foulongne V, Constant O, Fournier-Wirth C, Leon F, Molès JP, Goubaud A, Lemaitre JM, Maquart M, Leparc-Goffart I, Briant L, Nagot N, Van de Perre P, Salinas S (2016) Zika Virus Strains Potentially Display Different Infectious Profiles in Human Neural Cells. EBioMedicine 12:161–169. doi: 10.1016/j.ebiom.2016.09.020
- Stamou M, Grodzki AC, van Oostrum M, Wollscheid B, Lein PJ (2018) Fc gamma receptors are expressed in the developing rat brain and activate downstream signaling molecules upon cross-linking with immune complex. J Neuroinflammation 15: doi: 10.1186/s12974-017-1050-z
- Tang BL (2020) SNAREs and developmental disorders. J Cell Physiol 236:2482–2504. doi: 10.1002/jcp.30067
- Tang H, Hammack C, Ogden SC, Wen Z, Qian X, Li Y, Yao B, Shin J, Zhang F, Lee EM, Christian KM, Didier RA, Jin P, Song H, Ming GL (2016) Zika Virus Infects Human Cortical Neural Progenitors and Attenuates Their Growth. Cell Stem Cell 18:587–590. doi: 10.1016/j.stem.2016.02.016
- Vedeler C, Ulvestad E, Grundt I, Conti G, Nyland H, Matre R, Pleasure D (1994) Fc receptor for IgG (FcR) on rat microglia. J Neuroimmunol 49:19–24. doi: 10.1016/0165-5728(94)90176-7
- Wang S, Hong S, Deng YQ, Ye Q, Zhao LZ, Zhang FC, Qin CF, Xu Z (2016) Transfer of convalescent serum to pregnant mice prevents Zika virus infection and microcephaly in offspring. Cell Res 27:158–160. doi: 10.1038/cr.2016.144
- Yang C, Hou X, Feng Q, Li Y, Wang X, Qin L, Yang P (2019) Lupus serum IgG induces microglia activation through Fc fragment dependent way and modulated by B-cell activating factor. J Transl Med 17: doi: 10.1186/s12967-019-02175-0
No competing interests reported.