Myf5 and Myf6 gene expression profiles and their relationship with muscle fiber-type composition of Angora, Hair, Honamlı, and Kilis male kids

doi:10.21203/rs.3.rs-4317561/v1

Download PDF

Research Article

Myf5 and Myf6 gene expression profiles and their relationship with muscle fiber-type composition of Angora, Hair, Honamlı, and Kilis male kids

https://doi.org/10.21203/rs.3.rs-4317561/v1

This work is licensed under a CC BY 4.0 License

You are reading this latest preprint version

In the present study, Myf5 and Myf6 gene expression profiles and their relationship with muscle fiber-type composition and size were evaluated in some skeletal muscles of Angora (n = 6), Hair (n = 6), Honamlı (n = 6), and Kilis (n = 6) weaned male kids. Myf5 and Myf6 gene expression were measurement using real-time PCR. Total RNA amount longissimus-dorsi (LD) and semitendinosus (ST) ST muscles was relatively higher (p < 0.05) in Honamlı kids compared to kids born to other breeds. Kids of Honamlı goats had a more increased (p < 0.05) Myf5 gene expression than other kids’ breeds in LD muscle. Expression of the Myf5 gene in ST muscle was lower in kids of Hair goat than those of Honamlı and Kilis goats (p < 0.05). Myf6 gene expression was lower (p < 0.05) in the LD muscle of Kilis kids than those of other kids. The highest (p < 0.05) Myf6 gene expression was found in the ST muscle of Honamlı and Angora kids. Additionally, significant correlations were observed (p < 0.05) among Myf5 and Myf6 gene expression levels and muscle fiber-type composition at different levels in each breed. Results of the current study indicated that alterations in muscle fiber number, type, and size might be associated with interactive activity of Myf 5 and Myf 6 gene expression during muscle development. Moreover, significantly different breed-specific expressions of Myf5 and Myf6 led to the conclusion that these genes can be used to choose more productive goat breed, especially in fattening.

Indigenous breeds

goat

gene expression

meat production

kid

One crucial red meat production source in Türkiye is goat and kid meat. Angora, Hair, Honamlı, and Kilis indigenous goat breeds constitute approximately 92% of Türkiye's current goat population (Sen et al., 2020). In Türkiye, an extensive system based on pasture conditions is generally practiced for goat breeding, and when additional feeding grazing areas cannot be used, very little (usually wheat straw) is made, and concentrated feed is rarely given (Yilmaz et al., 2012, Sen et al., 2020). In addition, no breeding practices specific to meat production (fattening material selection and indoor kid fattening) are carried out or remain at a limited level in goat breeding in Türkiye. Therefore, there is minimal acknowledgment of the meat production potential of kids in Turkish indigenous goat breeds.

An increase in muscle fibers' size (hypertrophy) and number (hyperplasia) causes the muscle to grow and develop (Siqin et al., 2017). Nutritional level and exercise intensity may affect skeletal muscle mass development or meat quality (Reimers et al., 2014; Sen et al., 2016; Siqin et al., 2017). The composition of skeletal muscle fibers may affect the muscle's metabolic properties, contraction sensitivity, and postnatal meat quality characteristics (Lim et al., 2015; Sen et al., 2016). While muscle fiber number is fixed in the fetal period, differentiation occurs in their diameter and composition without any change in number in the postnatal period (Du et al., 2010). However, the genomic processes underlying fiber type differentiation or transformation remain unclear (Siqin et al., 2017).

Growth rates and carcass yield of livestock are economically important characteristics. Myogenic regulatory factors gene families (MRFs) (Zhong et al., 2013), satellite cells (Bunprajun et al., 2012), and myostatin (Shibata et al., 2006) regulate the growth and development of skeletal muscles. Moreover, MRFs regulate myogenesis from the fetal stage of muscle fiber proliferation, formation, and development to postnatal muscle fiber maturation, differentiation, growth, and function (Zhong et al., 2013; Siqin et al., 2017). In addition, MRFs have an essential role in determining the expression of many different genes and hormones (growth hormone and its receptor, IGF-I, myostatin; MSTN, myosin heavy chain; MyHC isoforms) associated with economic characteristics such as growth, development, fattening performance, and meat yield (Huang et al., 2016). Myf5 is considered the first expressed MRFs gene and is regulated by a 140 kb enhancer complex in its regulatory region (Carvajal et al., 2008). Braun and Arnold (1995) reported that Myf5 is responsible for developing and increasing muscle fibers in the embryonic and fetal periods, and Myf6 is responsible for postnatal muscle maturation and development.

Although previous studies have reported that Hair, Angora, Honamlı, and Kilis indigenous breeds exhibit different phenotypic values in fattening performance, the primary mechanism of this difference has not been revealed; it was based on breed characteristics or environmental factors. Our previous studies determined carcass and meat quality characteristics, muscle fiber characterization, and cellular properties of Angora, Hair, Honamlı, and Kilis kids (Sen et al., 2020; Sirin, 2018; Sen et al., 2021a; Sen et al., 2021b). However, to our knowledge, no reports on Myf5 and Myf6 gene expression profiles in kids of these four goat breeds. Moreover, the relationship between Myf5 and Myf6 gene expression profiles and muscle fiber properties remains to be determined in kids of these four goat breeds. Therefore, determining the expression profiles of the Myf5 and Myf6 genes, which are influential on skeletal muscle development, can provide important information about the meat production potential of Turkish indigenous goat breeds. The current study aimed to determine Myf5 and Myf6 gene expression profiles and their relationship with muscle fiber-type composition and size in some skeletal muscles (longissimus-dorsi; LD and semitendinosus; ST) of 90-day-old weaning-age male kids from Angora, Hair, Honamlı, and Kilis goat breeds.

The current study used − 80°C stored LD and ST muscle samples of 90-day-old weaning-age Angora (n = 6), Hair (n = 6), Honamlı (n = 6), and Kilis (n = 6) male kids were used as experimental material. Information about kids’ raising and muscle sample collection was presented in detail in the materials and methods section of our previous article (Sen et al., 2020).

Isolation of Total RNA and RT-qPCR

Total RNA was isolated from LD and ST muscle samples using a commercial RNA (PureLink ™, RNA Mini Kit, Invitrogen™, 12183018A) isolation kit with the TRIzol Reagent (Thermo Fisher Scientific, USA) as suggested by the manufacturer. Isolated RNase-free DNase was used to remove genomic DNA residue in isolated RNA. Total RNA quantity and quality were examined using a Nanodrop spectrophotometer (Thermo Fisher Scientific, USA) at 260 nm, and RNA integrity was checked by agarose gel electrophoresis 1% (w/v). The isolated RNA samples were diluted to 1µg/µl, and cDNA synthesis was performed by a commercial kit (BIO-RAD iScript cDNA, 1708890) with reverse transcriptase and designed primers. Obtained cDNA samples were stored at − 20°C until analyses of qRT-PCR.

Mfy5 and Mfy6 gene expression levels were examined by RT-qPCR method. Primers were designed using online tools (https://www.ncbi.nlm.nih.gov/tools/primerblast/; accessed on 18 March 2023) for the amplification of genes based on the related gene sequences of caprine (Table 1). Glyceraldehyde-3-phosphate dehydrogenase (GAPDH) was used as reference gene to normalize expression of target gene. Primers were purchased from Sentebiolab Company (Ankara, Türkiye).

Table 1

Primer Sequences for the mRNA expression analysis of genes
Genes	Primer sequence (5′-3′)	Product size (bp)	GenBank
Myf5	F: CACGACCAACCCTAACCAGAG R: TCTCCACCTGTTCCCTTAGCA	129	JF829004
Myf6	F: CGGAGCGCCATTAACTACAT R: AAATCCGCACCCTCAAGATT	113	NM_001285602
GAPDH	F: GCAAGTTCCACGGCACAG R: TCAGCACCAGCATCACCC	79	AF035421

Relative quantification of target genes was performed by qRT-PCR using the CFX96 Touch Real-Time PCR Detection System (Bio-Rad Laboratories, Hercules, CA, USA). qRT-PCR were run with EvaGreen mastermix (5× HOT FIREPol EvaGreen qPCR Mix Plus, Solis BioDyne, Tartu, Estonya). Total volume of reaction mix was 10 µL comprising 5 µL of 5× HOT FIREPol mix, 0.5 µL of forward primer (10 µmol/L), 0.5 µL of reverse primer (10 µmol/L), Dye, 2 µL of DEPC treated water, and 2 µL of template cDNA. Amplification of qRT-PCR was conducted as defined by Huang et al (2016). 2 − ΔΔCt method was used for calculated relative mRNA expression levels of target the genes (Huang et al., 2016).

Statistical Analyses

The completely randomized design for Myf5 and Myf6 gene expression profiles was performed with the SPSS (17.0; licensed by Ondokuz Mayıs University). Duncan's test was used to test significant differences between means at p < 0.05. Correlation coefficients between Myf5 and Myf6 gene expression profiles and muscle fiber-type composition (Type I, IIA, IIB, and cross-sectional area) were calculated using Pearson correlation analysis. The data used in Pearson correlation analysis was obtained from previous studies by one of us (Sirin, 2018) regarding muscle fiber type in muscles.

Total RNA concentrations in both muscles of weaned kids born from four Turkish native goat breeds are presented in Fig. 1. The total RNA amount in LD muscle was highest in kids born to Honamlı and Hair. Also, Kilis kids had lower (p < 0.05) total RNA concentration in LD muscle than in other breeds’ kids. Honamlı kids had lower (p < 0.05) total RNA concentration in ST muscle than other breeds’ kids. Morever, significant differences were detected between muscles regarding total RNA concentration in Angora, Hair, and Kilis kids (p < 0.05).

Myf5 gene expressions in both muscles of weaned kids born from four Turkish native goat breeds are presented in Fig. 2. The study showed statistically significant differences between breeds regarding the Myf5 gene expression level in the both muscles. The highest Myf5 gene expression level in LD muscle was observed in the kids of the Honamlı goat, and the lowest (p < 0.05) gene expression level was observed in the Hair kids. Hair goat kids had lower (p < 0.05) gene expression levels than Honamlı and Kilis goat kids, except for Angora goat kids in ST muscle. Kids of the Honamlı breed expressed the Myf5 gene in the LD muscle approximately 62.6, 67.0, and 117.8 times more (p < 0.05) than Hair, Kilis, and Angora kids, respectively. However kids of the Hair goat breed expressed the Myf5 gene in the ST muscle approximately 38.2, 23.5, and 16.6 times less (p < 0.05) than Honamlı, Kilis, and Angora kids, respectively.

Myf6 gene expressions in both muscles of weaned kids born from four Turkish native goat breeds are presented in Fig. 3. In the current study, there were statistically significant differences between breeds regarding the expression level of the Myf6 gene in the LD and ST muscles. Kilis kids had lower (p < 0.05) gene expression levels than those of the Honamlı, Hair, and Angora goat breeds in LD muscle. Additionally, Kilis kids expressed the Myf6 gene in the LD muscle approximately 32.5, 22.2, and 27.8 times less (p < 0.05) than Honamlı, Hair, and Angora kids, respectively. The highest (p < 0.05) Myf6 gene expression level in the ST muscle was observed in kids of Honamlı and Angora breeds, and the lowest (p < 0.05) gene expression level was observed in kids of Hair and Kilis breeds. Kids of the Honamlı breed expressed the Myf6 gene in the ST muscle approximately 31.8 and 48.1 times more (p < 0.05) than Hair and Kilis kids, respectively. Also, Angora kids expressed the Myf6 gene in the ST muscle approximately 30.9 and 47.2 times more (p < 0.05) than Hair and Kilis kids, respectively.

Correlation coefficients among the muscle fiber number, cross-sectional area (CSA), Myf5 and Myf6 genes expression in weaned kids born from four Turkish native goat breeds are presented in Tables 2, 3, 4, and 5, respectively. The Myf6 gene expression was correlated negatively with the type IIA, IIB, and total fibers number, but correlated positive with the CSA of type I, IIA, IIB fibers as well as average CSA of fibers (p < 0.05) in the ST muscles of Angora kids. The Myf6 gene expression was correlated negatively (p < 0.05) with the type I fiber number, but correlated positive with average and type I muscle fiber CSA in the LD muscle of Hair kids (p < 0.01). While there was a positive correlation between Myf5 gene expression and the number of type I fibers (p < 0.05), a negative correlation was observed between Myf5 gene expressions and type I muscle fibers CSA (p < 0.05) in the ST muscle of Hair kids. Contrast to gene expression level of Myf6 was correlated negative with number fiber numbers (p < 0.05), but positive correlated (p < 0.05) with CSA of type IIA fiber. In the ST muscle of Honamlı kids, a series of significant positive correlations were observed among Myf6 gene expression, type I (p < 0.01), type IIA (p < 0.05), and total fiber number (p < 0.01). There was a negative correlation (p < 0.05) between Myf5 gene expression and type IIA fiber number in the LD muscle of Kilis kids. However, a positive correlation between Myf5 gene expression and CSA of type IIA fiber was calculated in the LD muscle of Kilis kids (p < 0.01). Moreover, while a negative correlation was obtained between Myf5 gene expression and type I fiber number (p < 0.01), a positive correlation was calculated between Myf5 gene expression and CSA of type I fiber in the ST muscle of Kilis kids.

Table 2

Correlation coefficients among the muscle fiber number, CSA, Myf5 and Myf6 gene expression in Angora kids.
Measurements	Gene expression (LD)		Gene expression (ST)
Measurements	Myf5	Myf6	Myf5	Myf6
Type I	-0,419	-0,316	-0,319	-0,435
Type IIA	-0,334	0,129	0,251	-0,677*
Type IIB	0,116	0,521	0,287	-0,896**
Total Fiber	-0,334	0,035	0,207	-0,828**
Type I CSA	0,506	0,173	0,367	0,709*
Type IIA CSA	0,232	-0,393	-0,294	0,954**
Type IIB CSA	-0,180	-0,500	-0,221	0,997**
Average CSA	0,591	0,092	0,032	0,936**
p < 0.05, *p < 0.01, LD = longissimus-dorsi, ST = semitendinosus, CSA = cross-sectional area.

Table 3

Correlation coefficients among the muscle fiber number, CSA, Myf5 and Myf6 gene expression in Hair kids.
Measurements	Gene expression (LD)		Gene expression (ST)
Measurements	Myf5	Myf6	Myf5	Myf6
Type I	-0,180	-0,781*	0,273	0,731*
Type IIA	-0,352	-0,230	-0,513	-0,627*
Type IIB	-0,505	0,361	0,363	-0,362
Total Fiber	-0,426	-0,245	-0,466	-0,526
Type I CSA	0,149	0,947**	-0,378	-0,665*
Type IIA CSA	0,159	-0,130	0,297	0,795*
Type IIB CSA	0,517	-0,398	-0,291	0,349
Average CSA	0,306	0,878**	-0,545	-0,556
p < 0.05, *p < 0.01, LD = longissimus-dorsi, ST = semitendinosus, CSA = cross-sectional area.

Table 4

Correlation coefficients among the muscle fiber number, CSA, Myf5 and Myf6 gene expression in Honamlı kids.
Measurements	Gene expression (LD)		Gene expression (ST)
Measurements	Myf5	Myf6	Myf5	Myf6
Type I	-0,237	0,249	-0,498	0,927**
Type IIA	0,465	0,304	-0,221	0,764*
Type IIB	0,397	0,187	0,456	0,323
Total Fiber	0,347	0,291	-0,261	0,973**
Type I CSA	-0,316	-0,185	0,384	-0,360
Type IIA CSA	-0,476	-0,159	0,064	-0,241
Type IIB CSA	-0,428	-0,284	-0,262	0,162
Average CSA	-0,359	-0,185	0,186	-0,21
p < 0.05, *p < 0.01, LD = longissimus-dorsi, ST = semitendinosus, CSA = cross-sectional area.

Table 5

Correlation coefficients among the muscle fiber number, CSA, Myf5 and Myf6 gene expression in Kilis kids.
Measurements	Gene expression (LD)		Gene expression (ST)
Measurements	Myf5	Myf6	Myf5	Myf6
Type I	-0,038	-0,232	-0,850**	0,014
Type IIA	-0,679*	-0,005	0,076	0,278
Type IIB	-0,390	-0,116	0,169	-0,251
Total Fiber	-0,498	-0,082	0,022	0,240
Type I CSA	-0,096	-0,044	0,935**	0,139
Type IIA CSA	0,876**	-0,278	-0,147	-0,269
Type IIB CSA	0,305	-0,032	-0,235	0,315
Average CSA	0,539	-0,197	0,371	-0,131
p < 0.05, *p < 0.01, LD = longissimus-dorsi, ST = semitendinosus, CSA = cross-sectional area.

This study indicated that Myf5 and Myf6 gene expression patterns, which may influence muscle fiber type composition and size, differ among kids born to Turkish indigenous goat breeds. Moreover, these differences in Myf 5 and Myf 6 gene expression patterns can explain the growth trajectory differences of kids born to Turkish native goat breeds until weaning, which we reported in our previous study (Sen et al., 2021a).

The genetic background underlying the differences in the phenotype of muscle mass development and fattening performance traits, especially in indigenous breeds, has yet to be fully discovered and evaluated. Based on the results of our previous study (Sen et al., 2021a), Honamlı kids had a relatively higher growth rate than Angora, Hair, and Kilis kids. Moreover, Angora goats are a slower-growing breed, whereas kids of Hair and Kilis goats show relatively higher growth rates than Angora kids (Sen et al., 2021a). Our previous studies determined differences in production traits, such as growth and carcass traits (Sen et al., 2021a), and muscle fiber phenotype traits (Sirin, 2018), such as fiber type, fiber numbers, and fiber size, in weaned kids born to four examined goat breeds. Additionally, Sirin (2018) indicated that Honamlı and Hair kids were characterized by hyperplasia due to having more muscle fibers in the LD and ST muscles due to type II muscle fibers numbers; contrary to this, the number of muscle fibers in the same muscles was lower in Ankara and Kilis kids. The origin of such differences may be related to genomic processes involving the proliferation and differentiation of muscle precursor cells (Siqin et al., 2017).

Total RNA concentration is an essential marker of muscle fibers' transcriptional and translational efficiency and capacity (Figueiredo, 2019). Previous studies have reported that small cells of the same type produce less RNA than larger ones, that the size of the cell correlates with its transcriptional activity, and that genetically induced gene expression patterns can regulate cell size (Schmidt and Schibler, 1995). Total RNA concentrations in LD and ST of kids from Turkish native breeds show similarities to the findings of our previous study (Sen et al., 2021b) and Moretti et al. (2014) reported that RNA concentration exhibit differences in the some muscles of kids. Therefore, differences in RNA concentrations in some skeletal muscle masses among kids born from Turkish native breeds may be due to differences in the expression pattern of myogenic genes related to mutually interacting processes during muscle development (Sen et al., 2021b). Therefore, myogenic genes' expression levels may affect muscle fibers' composition and size in kids born from Turkish native breeds. Siqin et al. (2017) reported that myogenic regulatory factor gene expression patterns were associated with changes in muscle fiber-type composition and muscle fiber diameter of some skeletal muscle.

In this study, postnatal expression of Myf5 and Myf6 showed substantial differences in the transcriptional level in the muscles investigated by kids born to Turkish indigenous breeds. Huang et al. (2016) identified essential differences between Myf5 and Myf6 expression levels in kid LD muscles. Also, they found feeding regime influence Myf5 and Myf6 genes expression of a local goat breed (Xiangdong black) in southern China. Also, Pierzchała et al. (2011) reported that expression of Myf5 in porcine skeletal muscle did not differ significantly between pig breeds. In contrast, they found that Myf6 expressed significant differences at the transcriptional level of some skeletal muscles between pig breeds. Also, Ropka-Molik et al. (2010) reported essential differences between pig breeds' Myf6 expression levels of some skeletal muscles. Similarly, our findings indicated that gene expression patterns between examined four goat breeds showed differences consistent with previous studies (Ropka-Molik et al., 2010; Pierzchała et al., 2011). Moreover, results of current study may also suggest that the Honamlı breed's higher Myf5 and Myf6 gene expression may be associated with higher muscularity of post-fattening carcasses.

Previous studies indicated that the MRFs gene family polymorphisms might be required for myotube fusion, maturation, and maintenance of skeletal muscle weight (Wyszynska-Koko et al., 2006). Moreover, previous studies determined that Myf5 and Myf6 genes polymorphisms correlated with growth traits and carcass weight in cattle (Li et al., 2004; Wang et al., 2011), pig (Wyszynska-koko and Kuryl, 2004) and sheep (Siqin et al., 2017). Interestingly, several studies on Myf5 and Myf6 have shown that their polymorphisms do not affect the expression level of these genes (Urbanski and Kuryl, 2004; Wyszynska-Koko et al., 2006). Therefore, the breed-specific differences in the expression level of Myf5 and Myf6 genes observed in the current study may also represent indirect effects of another myogenic regulatory mechanism expressed in goat skeletal muscle. However, the presence of some regulatory elements that may affect the expression profile of Myf5 and Myf6 indicates a very complex pattern of regulation of these genes, suggesting that there may be significant differences between breeds (Maak et al., 2006). In addition, some studies indicate that Myf5 and Myf6 genes may be expressed at low levels in myofibers (Londhe and Davie, 2011). Therefore, the variation observed in the breed-dependent expression of Myf5 and Myf6 genes in goat skeletal muscles in the present study may represent the commonality of transcriptional activity of satellite cells and myofibers.

Expression patterns of MRFs gene exhibit differences in some skeletal muscles due to differences in fiber types (Siqin et al., 2017), nutrition (Vestergaard et al., 2000; Huang et al., 2016), and exercise activity (Reimers et al., 2014) in animals. However, the results of the current study show that alterations in fiber type number and MRF expression levels may have composited effects on muscle hypertrophy in kids from examined four goat breeds during postnatal development. Skeletal muscle development is a highly coordinated process involving a unique signal regulatory mechanism. Various elements, such as some genes, miRNAs, and lncRNAs, were determined to participate in fetal and postnatal muscle growth and development through a lot of signaling pathways. MRFs gene family, paired box protein 3/7 (Pax3/7), Myostatin (MSTN), and myocyte enhancing factor 2 (MEF2) family can be given as examples of the fundamental factors that regulate the growth of muscles (Huang et al., 2016). Although MRFs family genes control the skeletal muscle cells differentiation during fetal and postnatal myogenesis, postnatal expression of these genes can be significantly affected by nutrition and exercise intensity (Vestergaard et al., 2000; Siqin et al., 2017). In the current study, although all kids were raised under similar environmental conditions, significant differences were found in the expression of Myf5 and Myf6 among kids born to four Turkish indigenous goat breeds. The expression patterns of the Myf5 and Myf 6 genes were relatively critical, especially in the LD skeletal muscle of Honamlı kids, suggesting that kids have more muscle mass and live weight by improving the development of muscle fibers. This situation was consistent with the fact that Honamlı kids have more outstanding total edible meat content and heavier carcass parts in their carcasses. This result also revealed low carcass weight and total edible meat content in Angora and Kilis kids, which showed low expression patterns of Myf5 and Myf 6 genes in LD and ST skeletal muscles. qRT-PCR analysis of muscle tissue indicated higher expression levels of Myf5 and Myf6 genes in Honamlı kids' LD muscle. This finding suggests a potential genetic basis for the observed weight differences, with specific genes associated with muscle development showing higher expression levels in the Honamlı kids.

To our knowledge, this is the first study to examine the breed-related relationships of Myf5 and Myf6 genes expressed during the postnatal skeletal muscle growth period, as well as to show a relationship between muscle fiber type composition and size and Myf5 and Myf6 expression patterns in different skeletal muscles of weaned kids born to Angora, Hair, Honalı and Kilis Turkish indigenous goat breeds. This study presented significantly different expressions of Myf5 and Myf6 genes in investigated skeletal muscles among weaned kids from Turkish indigenous goat breeds. Although many reports have addressed how different exercises or stimuli affect myogenic regulatory factors, including Myf5 and Myf6 gene expression, muscle fiber conversion, and compositions (Reimers et al., 2014; Huang et al., 2016; Siqin et al., 2017), the specific molecular mechanisms governing muscle development still need clarification. Significant differences between Myf5 and Myf6 gene expressions may allow us to select both candidate genes for further meat production trait-associated studies. Additionally, since many different molecular mechanisms can regulate the expression activity of specific genes that regulate the growth and development of muscle fibers (Pierzchała et al., 201; Siqin et al., 2017), further defining the causal polymorphism and determining their functional roles is necessary.

The results of this study provide valuable insights into the relationship between gene expression, specifically Myf5 and Myf6, and muscle fiber characteristics in different breeds of kids, focusing on LD and ST muscles. In Angora kids, the expression of the Myf6 gene exhibited intriguing correlations with muscle fiber characteristics in the ST muscle. Similarly, although no significant correlation was observed between gene expression of Myf5 and fiber properties of LD muscle, Myf6 gene expression showed substantial correlations with fiber properties in Hair Kids. In Honamlı kids, Myf6 gene expression correlated with the number of fiber types in the ST muscle, suggesting its involvement in regulating fiber number in this breed. Interestingly, the expression of Myf5 and MYF6 genes in Kilis kids showed varying correlations with fiber type composition in LD and ST muscles, which may suggest a complex regulatory role of the MRFs gene family in fiber type distribution and size in different muscles in this breed. Overall, these results highlight the intricate relationship between Myf5 and Myf6 gene expression and muscle fiber characteristics across different breeds of kids and muscles.

Data Availability

The datasets generated during and/or analyzed during the current study are not publicly available due to some authors' concerns but are available from the corresponding author on reasonable request.

Ethics Approval

The authors confirm that the ethical policies of the journal, as noted on the journal's author guidelines page, have been adhered to. The experimental procedures were approved by the Local Animal Care and Ethics Committee of Kırşehir Ahi Evran University, Kırşehir, Turkey (approval number; 021013.04.1), and ensuring compliance with EC Directive 86/609/EEC for animal experiments.

Acknowledgement

This article was produced from the master's thesis prepared by the first author under the supervision of the second author.

Funding

This work was supported by the Ondokuz Mayis University (Project no.: PYO.ZRT.1904.21.017) and Kırşehir Ahi Evran University (Project no.: ZRT.A4.22.013) Scientific Research Projects Coordination Unit to carry out this study.

Braun, T., Arnold, H.H. 1995. Inactivation of Myf-6 and Myf-5 genes in mice leads to alterations in skeletal muscle development. EMBO Journal, 14(6), 1176–1186.
Bunprajun, T., Yimlamai, T., Soodvilai, S., Muanprasat, C., Chatsudthipong, V. 2012. Stevioside enhances satellite cell activation by inhibiting of NF-jB signaling pathway in regenerating muscle after cardiotoxin-induced injury. Journal of Agricultural and Food Chemistry, 60, 2844–2851.
Carvajal, J.J., Keith, A., Rigby, P.W. 2008. Global transcriptional regulation of the locus encoding the skeletal muscle determination genes Mrf4 and Myf5. Genes and Development, 22, 265–276.
Du, M., Tong, J., Zhao, J., Underwood, K.R., Zhu, M., Ford, S.P., Nathanielsz, P.W. 2010. Fetal programming of skeletal muscle development in ruminant animals. Journal of Animal Science, 88, E51-E60.
Figueiredo, V.C. 2019. Revisiting the roles of protein synthesis during skeletal muscle hypertrophy induced by exercise. American Journal of Physiology Regulatory, Integrative and Comparative Physiology, 317(5), R709-R718.
Huang, J., Jiao, J., Tan, Z.L., He, Z., Beauchemin, K.A., Forster, F., Han, X.F., Tang, S.X., Kang, J., Zhou, C. 2016. Inferring the skeletal muscle developmental changes of grazing and barn-fed goats from gene expression data. Journal of Agricultural and Food Chemistry, 64, 36, 791–800.
Li, C., Basarab, J., Snelling, W.M., Benkel, B., Murdoch, B., Hansen, C. 2004. Assessment of positional candidate genes myf5 and igf1 for growth on bovine chromosome 5 in commercial lines of Bos taurus. Journal of Animal Science, 82, 1–7.
Lim, K.S., Lee, S.H., Lee, E.A., Kim, J.M., Hong, K.C. 2015. Effects of intergenic single nucleotide polymorphisms in the fast myosin heavy chain cluster on muscle fiber characteristics and meat quality in Berkshire pigs. Meat Science, 110: 224–229.
Londhe, P., Davie, J.K. 2011. Sequential association of myogenic regulatory factors and E proteins at muscle-specific genes. Skeletal Muscle, 1(1), 14.
Maak, S., Neumann, K., Swalve, H.H. 2006. Identification and analysis of putative regulatory sequences for the MYF5/MYF6 locus in different vertebrate species. Gene, 66, 141–147.
Moretti, D.B., Nordi, W.M., Lima, A.L., Pauletti, P., Machado-Neto, R. 2014. Enteric, hepatic and muscle tissue development of goat kids fed with lyophilized bovine colostrum. Journal of Animal Physiology and Animal Nutrition, 982, 201–218.
Pierzchała, M., Pareek, P.L., Urbański, P., Goluch, U.C., Kamyczek, M.R., Cooper, J.K. 2011. Expression profile of MYF5 and MYF6 genes in skeletal muscles of young growing gilts of five breeds at different ages, based on the most stable reference genes. Animal Science Papers and Reports, 29, 231–246.
Reimers, E., Tsegaye, D., Colman, J.E., Eftestøl, S. 2014. Activity patterns in reindeer with domestic vs. wild ancestry. Applied Animal Behaviour Science, 150, 74–84.
Ropka-Molik, K., Eckert, R., Piórkowska, K. 2010. The expression pattern of myogenic regulatory factors MyoD, Myf6 and Pax7 in postnatal porcine skeletal muscles. Gene Expression Patterns, 11, 79–83.
Schmidt, E.E., Schibler, U. 1995. Cell size regulation, a mechanism that controls cellular RNA accumulation, consequences on regulation of the ubiquitous transcription factors Oct1 and NF-Y and the liverenriched transcription factor DBP. Journal of Cell Biology, 128, 467–483.
Sen, U., Sirin E, Filik, A.G., Onder, H., Piwczynski D, Kolenda M. 2021a. Growth and slaughter characteristics of weaning male kids of Turkish native goat breeds. Animals, 11(10), 2788.
Sen, U., Sirin, E., Aksoy, Y., Ensoy, U., Ulutas, Z., Kuran, M. 2016. The effect of maternal nutrition level during mid-gestation on post-natal muscle fiber composition and meat quality in lambs. Animal Production Science, 56, 834–843.
Sen, U., Sirin, E., Filik, G., Soydan, E. 2020. The effect of breed on instrumental meat quality traits of weaning kids from Turkish indigenous goat breeds. Large Animal Review, 26(1), 19–24.
Sen, U., Sirin, E., Kuran, M. 2021b. Muscle cellular characteristics of male kids from Turkish indigenous goat breeds. Small Ruminant Research, 202, 106461.
Shibata, M., Matsumoto, K., Aikawa, K., Muramoto, T., Fujimura, S., Kadowaki, M. 2006. Gene expression of myostatin during development and regeneration of skeletal muscle in Japanese Black Cattle. Journal of Animal Science, 84, 2983–2989.
Siqin, Q., Nishiumi, T., Yamada, T., Wang S, Liu W, Wu R, Borjigin G. 2017. Relationships among muscle fiber type composition, fiber diameter and MRF gene expression in different skeletal muscles of naturally grazing Wuzhumuqin sheep during postnatal development. Animal Science Journal, 88(12), 2033–2043.
Sirin, E. 2018. Relationship between muscle fiber characteristics and meat quality parameters in Turkish native goat breeds. Indian Journal of Animal Research, 52, 1526–1530.
Urbanski, P., Kuryl, J. 2004. New SNPs in the coding and 5’ flanking regions of porcine MYOD1, MYF3) and MYF5 genes. Journal of Applied Genetics, 45, 325–329.
Vestergaard, M., Therkildsen, M., Henckel, P., Jensen, L.R., Andersen, H.R., Sejrsen, K. 2000. Influence of feeding intensity, grazing and finishing feeding on meat and eating quality of young bulls and the relationship between muscle fibre characteristics, fibre fragmentation and meat tenderness- development and verification. Meat Science, 54, 187–195.
Yilmaz, O., Kor, A., Ertugrul, M., Wilson, R.T. 2012. The domestic livestock resources of Turkey: goat breeds and types and their conservation status. Animal Genetic Resources, 51, 105–116.

Download PDF

Reviewers invited by journal
03 May, 2024
Editor assigned by journal
25 Apr, 2024
First submitted to journal
24 Apr, 2024

You are reading this latest preprint version

Myf5 and Myf6 gene expression profiles and their relationship with muscle fiber-type composition of Angora, Hair, Honamlı, and Kilis male kids

Status:

Version 1

Abstract

Figures

Introduction

Material and Methods

Isolation of Total RNA and RT-qPCR

Statistical Analyses

Results

Discussion

Declarations

References

Status:

Version 1