Characterization of sexual size dimorphism in mandarin fish and association with igfbp-5a/b regulation

doi:10.21203/rs.3.rs-4327832/v1

Download PDF

Research Article

Characterization of sexual size dimorphism in mandarin fish and association with igfbp-5a/b regulation

https://doi.org/10.21203/rs.3.rs-4327832/v1

This work is licensed under a CC BY 4.0 License

Journal Publication

published 03 Aug, 2024

Read the published version in Fish Physiology and Biochemistry →

You are reading this latest preprint version

Mandarin fish (Siniperca chuatsi) is an important cultured fish in East Asia that shows sexual size dimorphism (SSD), with females growing faster than males when reaching marketable size. However, the regulatory mechanism of SSD is not clear. To characterize SSD of mandarin fish and its association with gh/igf1/igfbp-5expression in female and male, gonadal developmental time-spectra of the females and the males from 1.5 to 4.0 mph were described, and growth parameters, serum levels of E2 and T, as well as the relative expression levels of gh, igf1, and igfbp-5a/b mRNAs were determined. The results showed that the fitting the logistic growth equation of body mass and total length of female and male were W(♀)=667.57/(1+e^(4.19-1.24*t)), W(♂)=582.71/(1+e^(4.07-1.27*t)), L(♀)=31.47/(1+e^1.95-1.08*t)), L(♂)=26.20/(1+e^(2.56-1.5*t)). The month of inflection points for body mass for females and males were 3.37 mph and 3.20 mph, respectively, when the body mass were 333.79 g and 291.36 g. The month of inflection points for total length growth were 1.80 mph and 1.70 mph, respectively, when the total length were 18.52 cm and 16.28 cm. At 1.5-2.0 mph, SSD was not clearly demonstrated. At 3.0 mph, the body mass of the females was significantly higher than that of the males (P < 0.05), E2 content of the females was significantly higher than that of the males (P< 0.05), T content of the males was significantly higher than that of the females (P < 0.05), and the expression level of brain gh and liver igf1 in the females was significantly higher than that of the males (P < 0.05). At 4.0 months of age, the body mass of the females was highly significantly higher than that of the males (P < 0.01), E2 content of the females was highly significantly higher than that of the males (P < 0.05), T content of the males was significantly higher than that of the females (P< 0.05), and the level of liver igf1 expression in the females was significantly higher than that of the males (P < 0.05). With the continuous development of gonads, muscle and liver igfbp-5a and -5b expression generally tends to increase in females and males, while igfbp-5a showed a gradual increasing trend, igfbp-5bexpression showed an "S"-type trend. There was no significant difference in muscle and liver igfbp-5a/b expression between males and females at the age of 1.5-2.0 months (P > 0.05), however, male igfbp-5a/bexpression was significantly higher than female at the age of 3.0-4.0 months (P < 0.05). This work verified that the females had faster growth rate since 3.0 mph compared to the males, which may be related to higher E2 levels in females leading to higher igf1 level, through inhibition of igfbp-5a/b expression.

mandarin fish

sexual size dimorphism (SSD)

steroid hormones

gh/igf1/igfbp-5

Females and males of many fish species exhibit a range of sexual size dimorphism (SSD) (Luo et al., 2021). 21 day-post-hatching (dph) yellow catfish (Pelteobagrus fulvidraco) showed sexual dimorphism, with the males growing 30–40% faster than the females (Ma et al., 2016). Body mass and total length of 9 month-post-hatching (mph) tongue sole (Cynoglossus semilaevis) males are about half that of females (Ji et al., 2011). Sex hormones and the regulation of growth and reproductive energy ratios may be key factors controlling SSD, as this growth difference came to the fore during the gonadal stage of development after sex differentiation in fishes (Niu et al., 2024). The most common sex steroids are Estradiol 2 (E2) and Testosterone (T). E2 regulates the expression of a range of genes by binding to specific receptors, affecting changes in the reproductive cycle, the development of reproductive organs and bone growth (Z. Q. Liu et al., 2022). The gh/igf axis is considered a key pathway downstream of sex hormone regulation. In vitro injection of E2 promotes the massive synthesis of gh in spotted scat (Scatophagus argus) (Shi et al., 2022). In vitro injection of T increases the expression level of gh/igf axis genes in male Nile tilapia (Oreochromis niloticus) for growth promotion (Yue et al., 2018). During gonadal development, gh can increase E2 content in the ovary by stimulating aromatase activity (Devesa et al., 2019). RNA-seq analyses of four representative fish species loach (Misgurnus anguillicaudatus), tongue sole, catfish (Tachysurus fulvidraco), and Nile tilapia, which showed significant differences in the growth of males and females, showed that the gh/igf axis was involved in the formation of dimorphism (Luo et al., 2022). Genomic analysis showed that 78 amplified genes in the hook snout carp (Opsariichthys bidens) are involved in the gonadotropin-releasing hormone signaling pathway, inducing the expression of the gh/igf axis and thus may promoting male growth (D. Liu et al., 2022). Gh and igf1 mRNA expression levels of 4 mph male yellow catfish were significantly higher than those of females (Ma et al., 2016). Gh mRNA levels were significantly higher in females than in males of the 5750A strain of transgenic Coho Salmon (Oncorhynchus kisutch) (Chan et al., 2021).

Igfbp (Insulin like growth factor binding protein) is a direct regulatory protein of Igfs, which regulates the activity of Igfs in various ways including isolation of ligands, hydrolysis of protease, and competitive binding (de la Serrana et al., 2018). The igfbps family has six members (igfbp-1 ~ 6), of which igfbp-5 shows an association with SSD (de la Serrana,Macqueen, 2018). Igfbp-5 exists in 2 isoforms, igfbp-5a and igfbp-5b, which are mainly distributed in liver, muscle (X. L. Yao et al., 2024). The expression of igfbp-5a was significantly increased after overexpression of E2 in tongue sole, and PPI analyses showed that igfbp-5a was associated with dimorphism-related gene such as pappalysin-1 (X. H. Li et al., 2022). Tripathy (Tripathy et al., 2016) proposed that igfbp-5 may be one of the response genes to E2, and that inhibiting E2 content resulted in increased levels of igfbp-5 and reduced activation of igf1r, which led to reduced activation of PI3K and pAkt/PKB levels and inhibited growth.

Mandarin fish (Siniperca chuatsi) is a valuable freshwater economic fish endemic to China. The wild females of mandarin fishes from age 3 to 7 in Liangzi Lake grow faster than the males (Jiang, 1959), and wild females’ mandarin fish from age 1 to 4 in Poyang Lake grow 10–20% faster than the males (D. Li et al., 1998). Under the same culture conditions, there was no significant difference in the body mass of females and males within 2.4 mph mandarin fish; the body mass-growth rate of females was significantly faster than that of males from 170 to 800 g (2.36–8.5 mph), and the males began to grow faster than the females after 8.5 mph (Wang et al., 2006). Transcriptome sequencing of 1 mph and 6 mph mandarin fishes revealed that gh/igf axis genes were expressed at significantly higher levels in the larger than the smaller, and that the differential genes were enriched to the gonadal axis, which included igfbp-5 (Tian et al., 2016). Hence, this study analyzed the growth characteristics of females and males’ mandarin fish at different months of age, and also examined the levels of E2 and T, and the expression levels of gh/igf1/igfbp-5. This study provides preliminary answers to the question of when the growth differences between male and female mandarin fish occur and the expression profiles of gh/igf1/igfbp-5 during gonadal development, which will provide basic information for the understanding of the physiological and molecular mechanisms underlying the growth differences between males and females of mandarin fish.

2.1. Fish rearing and sample collection

Fish samples came from Chuzhou Yangtze aquaculture breeding farm. A pair of male and female fish of the same age were used for artificial fertilization. The fertilized eggs emerged at the same time in the hatching ring and were then fed with blunt snout bream (Megalobrama amblycephala) larvae manually (T: 24.6 ± 0.5 ◦C, pH = 7.5 ± 0.1, OD = 5.0–6.0 mg/L). On the 10 dph, the fries were transferred to a concrete tank (30m×5m×1.8m) for cultivation and fed to satiation with mud carp (Cirrhinus molitorella) fry. On the 40 dph, the fries were transferred to earthen pond, and fed with mud carp. Samples were collected at 1.5, 2.0, 3.0, and 4.0 mph, and 60 tails were randomly selected each time.

2.2. Growth characteristics from male and female mandarin fish

Different methods are used to identify the males and the females according to the development of the gonads. Fish at 1.5 and 2.0 mph were identified by HE staining, fish at 3.0 mph were identified by acid red dyeing method, and fish at 4.0 mph were identified by observation of the appearance of the gonads after dissection. The total length and body mass were measured using vernier calipers (accurate to 0.01 mm) and an electronic balance (accurate to 0.01 g). The total length-body mass relationship was expressed using Taylor's formula: W = aL^b, where “W” is body weight, “L” is total length, and “a” and “b” are parameters. Logistic regression equation was chosen to fit the growth curves of female and male fish: y = A/(1 + e^B−K*t), A, B, and K were the parameters, and the three-point method was used to estimate the initial values of the parameters; the inflection point of the month was B/K; the inflection point of the body mass was A/2.

2.3. Tissue sections

After fixed in 4% PFA for 48 h, the tissue was dehydrated in a series of increasing concentrations of ethanol, embedded in paraffin, and sliced into 7 µm sections. After HE staining of tissue sections, morphological differences were observed and photographed.

2.4. Steroid sex hormone determination

Six tails of each male and female fish were taken at each month of age, and 1–2 mL of blood samples were collected with disposable sterile syringes. After coagulation of blood at room temperature, sera were separated by centrifugation at 3000r/min for 30 min at 4°C. The quantification of E2 and T was performed by means of E2 ELISA kit and T ELISA kit (B. Y. Li et al., 2024) (#ml003452 and #ml037278, Shanghai Enzyme-linked Biotechnology Co., Ltd, Shanghai, China), following the manufacturer’s instructions. The absorbance (OD value) was measured at 450 nm on a Biotek microplate reader (BioTek; Winooski, VT, USA, Synergy LX Multi-Mode Microplate Reader), and the concentration of the standards was used to plot a standard curve, which was carried over to the OD value of the samples to find out the levels of serum steroid sex hormone in female and male fish.

2.5. qPCR

For each time, different tissues and corresponding RNA samples were obtained from three male and three female fishes. Among them, brain, liver, stomach, intestines, pyloric caeca, gonads, and muscle were used for igfbp-5a, -5b tissue expression analysis (only for 3.0 mph), brain were used for gh developmental expression analysis, liver were used for igf1 developmental expression analysis, and liver and muscle were used for igfbp-5a, -5b developmental expression analysis. Total RNA was extracted with the TRIzol method using standard TRIzol RNA extraction protocol. Reverse transcription of RNA to cDNA was performed according to a protocol provided with the PrimeScript RT Reagent Kit (TAKARA, Japan) and using gDNA Eraser (TAKARA) to remove genomic DNA. Primer 5.0 (Premier Biosoft) was used to design primer sequences (Table 1), and the primers were synthesized by Sangon Biotech (Shanghai) Co., Ltd.

Table 1

Nucleotide sequences and annealing temperature of oligonucleotide primers.
Primer	Nucleotide sequence	Annealing temperature	NCBI GenBank
gh	TGGTGGCAGGCCATTAAGAG CCGTGGACGTGTACTGACAA	60	EF205280.1
igf1	TGACTCCGACGGCAACAG GCAGCACTCGTCCACAAT	59	JQ794829.1
igfbp-5a	AAGCGCAAACAGTGTAAGCC GCTCAACGAGTACGACCAGT	60	XM_044188400.1
igfbp-5b	CCCGCCCATAGATCGTGAG GTCTTTGGGAAGGAGTGGCA	60	XM_044216229.1
β-actin	ATCGCCGCACTGGTTGTTGAC CCTGTTGGCTTTGGGGTTC	58	FJ436084.1

qPCR was performed with TB green premix Ex Taq (Takara) in a 20ul volume system according to the manufacturer’s instructions: 95°C for 30s, followed by 40 cycles of 95°C for 5s, 58/59/60°C for 30s, and 72°C for 30s. qPCR amplification of each sample was repeated three times, and β-actin was used as the internal reference gene. The amplification efficiency was close to 1 (100% amplification efficiency), which indicates that the amplification efficiency was close to the ideal state. mRNA relative expression levels were calculated using the 2^−ΔΔCT method.

2.6. Data analysis

The experimental data were analyzed using SPSS 26.0 statistical software, one-way ANOVA for significance testing, T-test and Duncan's multiple comparisons to detect differences in the measures, with P < 0.05 being considered significant and P < 0.01 being considered very significant. Plotting was performed using Origin 2022.

3.1. Growth characteristics from male and female mandarin fish

The information of total length and body weight of fish samples at 1.5-4.0 mph are shown in Table 2. From 1.5 to 2.0 mph, there were no significant differences in total length and body mass between females and males (P > 0.05). At 3.0 mph, the body mass of females was significantly greater than that of males (P < 0.05). At 4.0 mph, females had a highly significant greater body mass than males (P < 0.01).

Table 2

Total length and weight of females and males at different month ages. * means P<0.05. ** means P<0.01.
Month age	Female			Male
Month age	Sample number	Total length (cm)	Weight (g)	Sample number	Total length (cm)	Weight (g)
1.5	28	12.84 ± 3.25	40.13 ± 1.26	32	10.75 ± 3.48	37.16 ± 1.24
2.0	33	17.85 ± 0.65	97.15 ± 6.8	27	16.66 ± 1.05	93.19 ± 8.82
3.0	25	24.32 ± 1.13	235.17 ± 22.98*	35	22.35 ± 0.98	208.09 ± 17.56
4.0	30	28.91 ± 1.56	443.44 ± 56.59**	30	25.73 ± 1.32	385.11 ± 74.51

Scatter plots of measured total length (L) and body mass (W) for males and females of all ages are shown in Fig. 1. The growth regression relationship between body mass and total length was:

W(♀) = 0.0107L^3.1584, R² = 0.9961

W(♂) = 0.0106L^3.166, R² = 0.9943

A “b” value greater than 3 in the growth equation for male and female fish indicates that the growth of female and male mandarin fish from 1.5 to 4.0 mph is isometric.

The parameters and fitting curves of Logistic models for body mass and total length for females and males are shown in Table 3 and Fig. 2. The growth rate of total length and body mass of females and males are shown in Fig. 3. The R² of all fitting equations were greater than 0.99, indicating an excellent fitting effect. With the increase of age, the difference of body mass between females and males gradually increased, and the age at inflection point of total length of females and males was 1.80 and 1.70 mph, when their total length were 18.52 cm and 16.28 cm. The age at inflection point of body mass was 3.37 and 3.20 mph, and their body mass were 333.79 g and 291.36 g.

Table 3

The parameter values and the fit goodness of Logistic models of the female and male mandarin fish.
Sex	Traits	Model parameters			R²	Inflection points of age (mph)	Inflection points of weight (g)	Inflection points of total length (cm)
Sex	Traits	A	B	K	R²	Inflection points of age (mph)	Inflection points of weight (g)	Inflection points of total length (cm)
Female	Weight (g)	667.57 ± 150.98	4.19 ± 0.36	1.24 ± 0.23	0.998	3.37	333.79	—
Female	Total length (cm)	31.47 ± 2.02	1.95 ± 0.27	1.08 ± 0.20	0.997	1.80	—	18.52
Male	Weight (g)	582.71 ± 162.26	4.07 ± 0.41	1.27 ± 0.27	0.997	3.20	291.36	—
Male	Total length (cm)	26.20 ± 1.60	2.56 ± 0.62	1.5 ± 0.40	0.992	1.70	—	16.27

3.2. gender identification and gonad development

The results showed that ovarian cells are larger and more spaced out, and testis cells are smaller and tightly packed together (Fig. 4). It was found by He staining that oocyte development is at phase I at 1.5-2.0 mph, as is spermatocyte development. At 3.0–4.0 mph, oocytes are developing at phase II and spermatocytes have developed to phase IV.

3.3. contents of E2 and T in the serum

At 1.5-4.0 mph, the E2 content of female fish and T content of male fish gradually increased (Table 4). At 1.5-2.0 mph, there was no significant difference between the E2 and T contents of female and male fish (P > 0.05); At 3.0 mph, the females had significantly higher levels of E2 than the males, and the males had significantly higher levels of T (P < 0.05); At 4.0 mph, the females had a highly significant higher E2 content than the males (P < 0.01), the males had a significantly higher T content than the females (P < 0.05).

Table 4

Changes of blood serum T and E2 of the female and male mandarin fish at different month ages. * means P<0.05. ** means P<0.01.
	E2/(pg·ml^− 1)		T/(pg·ml^− 1)
Month	Female	Male	Female	Male
1.5	190.61 ± 14.49	187.8 ± 11.25	204.8 ± 8.51	207.07 ± 9.95
2.0	235.21 ± 8.74	227.1 ± 29.14	214.12 ± 9.28	230.07 ± 29.49
3.0	253.03 ± 9.8*	232.26 ± 85.38	253.92 ± 24.11	282.72 ± 17.78*
4.0	305.09 ± 6.53**	124.16 ± 19.06	295.27 ± 25.89	321.49 ± 11.58*

3.4. Differential expression of gh/igf1/igfbp-5 related genes

At 1.5-4.0 mph, brain gh and liver igf1 expression levels gradually increased in both female and male fish (Fig. 6). At 1.5 mph, there is no significant difference in gh and igf1 expression levels between male and female (P > 0.05). At 2.0 mph, the difference in brain gh expression levels between females and males was still not significant (P > 0.05), while liver igf1 expression levels were higher in females than in males (P < 0.05). At 3.0 mph, brain gh and liver igf1 expression levels were all significantly higher in the females than in the males (P < 0.05). At 4.0 mph, igf1 expression levels was significantly higher in the females than in the males (P < 0.05), while the difference in brain gh expression level was not significant (P > 0.05).

Tissue expression map showed that igfbp-5a and − 5b were significantly highly expressed in liver and muscle (P < 0.05) (Fig. 7).

With the development of gonads, the expression trend of igfbp-5a of the females and the males in liver and muscle showed a gradually increasing trend. In the liver, male igfbp-5a expression level was not significantly different (P > 0.05) at 1.5-2.0 mph and igfbp-5a expression level increased significantly (P < 0.05) at 3.0–4.0 mph, respectively; female igfbp-5a expression was not significantly different (P > 0.05) at 1.5-3.0 mph, and showed significant increase (P < 0.05) at 4.0 mph. Comparison of the differences in liver igfbp-5a expression level between males and females showed that there was no significant difference at 1.5-2.0 mph (P > 0.05), and that igfbp-5a expression level in males was significantly higher than that in females at the 3.0–4.0 mph (P < 0.05). In muscle, male igfbp-5a increased significantly month by month (P < 0.05); female igfbp-5a expression did not differ significantly (P > 0.05) during the period of 1.5-3.0 mph, and increased significantly (P < 0.05) at 4.0 mph; comparing the differences in igfbp-5a expression level between male and female in muscle, the results showed that the igfbp-5a of male and female muscle did not differ significantly (P > 0.05) between the periods of 1.5-2.0 mph, and in the period of 3.0–4.0 mph, male igfbp-5a expression was significantly higher (P < 0.05) than that of females (Fig. 8).

Igfbp-5b expression level in liver and muscle of male and female mandarin fish showed an “S” pattern. In liver, igfbp-5b was significantly lower in both male and male mandarin fish at 2 mph than at the rest of the month (P < 0.05). Comparison of the differences in igfbp-5b expression level in liver of males and females showed that there was no significant difference in igfbp-5b expression level between males and females from 1.5 to 2.0 months of age (P > 0.05), and that the expression of igfbp-5b in males was significantly higher than that of females during the periods of 3.0–4.0 mph (P < 0.05). In muscle, there was no significant difference (P > 0.05) in igfbp-5b expression level in males at 1.5-2.0 mph, and igfbp-5b expression increased significantly (P < 0.05) in males at 3.0–4.0 mph. Igfbp-5b in females and males declined significantly (P < 0.05) in females and males at 2.0 mph and increased significantly (P < 0.05) in females and males at 3.0–4.0 mph. Comparison of the differences in igfbp-5b expression level in male and female muscles showed that there was no significant difference between males and females at 1.5-2.0 mph (P > 0.05), and that igfbp-5b expression level was significantly higher in males than in females (P < 0.05) at both the 3–4 mph (Fig. 8).

Body mass and total length are important parameters for fish growth evaluation. Three types of nonlinear equations, such as Gompertz, Von Bertalanffy and Logistic, have been used to describe the growth process of fish in studies on fish growth (Mull et al., 2022). In this study, the Logistic equation with the best fit (R² > 0.992) was used to describe the growth characteristics of female and male mandarin fish from 1.5 to 4.0 mph. The results show that females grow faster than males in body mass at 1.5-4.0 mph. The inflection point of body mass for females was at 3.37 mph, when the body mass was 333.79g, and for males was at 3.20 mph, when the body mass was 291.36g. After 3.0 mph, females grew faster than males at total length, with the total length inflection point at 1.80 mph for females and 1.70 mph for males. The growth rate of body mass and the period of slowing down of the growth rate of total length in males are earlier than in females, so that the growth rate of females is greater than that of males as the age of the month increases, suggesting that mandarin fish is dimorphic before and after gonadal maturity. At the stage of sexual maturity in tongue sole, males have about half the body mass and total length of females, which is similar to our results (Luo et al., 2022).

In the present study, serum levels of E2 in the females gradually increased and were higher than those in the males at different developmental periods, while serum levels of T in the males gradually increased and were higher than those in the females at different developmental periods. The period of change in the levels of E2 and T coincided with the period of sexual dimorphism exhibited by female and male fish, similar to that of fish with sexual dimorphism, such as spotted scat (Ru et al., 2020), yellow catfish (Liu et al., 2018), and Nile tilapia (Yue et al., 2018). The asynchrony of sexual maturity in fish can lead to growth differences between males and females. If the sexual maturity of males is earlier than that of females, then the growth rate of females is greater than that of males, as in the case of spotted scat (Ru et al., 2020); conversely, males grow faster than females, as in the case of the yellow catfish (Mei et al., 2018). Both female and male mandarin fish in culture can reach sexual maturity in 1 year, but males mature earlier than females (Han et al., 2020). At 4.0 mph, the ovaries of females are in phase II and the spermathecae of males are in phase IV, with some mature sperm in the spermathecae. Males may use more energy for gonadal development relative to females, resulting in smaller growth rates than females.

Sex steroid hormones not only promote growth by increasing the level of intake and food conversion in fish, but also regulate growth and development through the gh/igf growth axis (Johannes et al., 2003). It was found that there was a correlation between differential levels of sex steroid hormones in female and male fish across the sexes and their growth performance, i.e., in females, higher levels of E2 and relatively lower levels of T resulted in faster growth, while the opposite was true for males (Yue et al., 2018). E2 and T have an effect on the expression of the gh/igf axis, and this effect shows difference between female and male (Yue et al., 2018). In the present study, it was found that females and males of mandarin fish produced growth differences at 3.0 mph, and the same time was found when differences in E2 and T content and expression levels of gh and igf1 were produced. At 3.0 mph, E2 level in females were significantly greater than that in males, and T levels were significantly greater in males than in females. The expression levels of gh and igf1 were significantly higher in females than in males. At 4.0 mph, E2 level of females was highly significantly higher than that of males, the T content of males was significantly higher than that of females, E2 decreased in males but not in females because T acts as a precursor substance for E2 (D. Liu et al., 2022), and the expression levels of gh and igf1 were significantly higher in females than in males. Therefore, it is hypothesized that the growth differences between females and males of mandarin fish may be generated by relative levels of E2 and T and their expression levels through the regulation of gh/igf1 growth axis genes.

The vast majority of igf1 can only translocate and function when it forms a complex with igfbps (de la Serrana,Macqueen, 2018). Tissue expression profiles showed that igfbp-5a/b was enriched in liver and muscle, similar to yellowtail kingfish (Seriola aureovittata) (Zheng et al., 2024). Liver and muscle are also tissues with specific expression of igf1. The similar tissue-specific expression of igfbp-5 and igf1 may enhance efficiency for life activity processes and protein functioning within the tissues. Transcriptome analyses showed that differences in individual size of mandarin fish were associated with gonadal differentiation, with differential gene enrichment to the gh/igf axis, including the igfbp-5 (Tian et al., 2016). Rainbow trout (Oncorhynchus mykiss) igfbp-5 was found to be significantly decreased after oocyte maturation, and igfbp-5 expression level was significantly decreased during gonadotropin-induced oocyte maturation in vitro (Kamangar et al., 2006). The results of this study showed that with gonadal development, the expression of female and male igfbp-5a showed a gradual increase in expression, while the expression of igfbp-5b showed an "S" expression trend, indicating that sex steroids can promote the expression of igfbp-5a/b, but igfbp-5a and igfbp-5b are regulated in different ways. E2 and T expression levels of females and males produced significant differences at 3 mph, and the igfbp-5a expression of females and males also showed a significant upward trend at 3 mph, suggesting that sex steroids may regulate gonadal development and total length/body mass through positive regulation of igfbp-5a. It was shown that ventricular injection of igfbp-5 delayed the onset of puberty, and decreased E2 concentration and ovarian weight in mice, suggesting that igfbp-5 is involved in the regulation of sex steroids and gonadal development (Z. Q. Yao et al., 2022), which is similar to this result. Igfbp-5b expression level decreased significantly in 2.0 mph, which may be related to the gonadal differentiation-protective effect of igfbp-5b. Elevated igfbp-5b protects undifferentiated spermatogonia from over differentiation in the zebrafish testis during the late gonadal maturation stage.

When comparing the differences in igfbp-5a/b expression between female and male mandarin fishes at the same age of months, the results showed that both females had significantly lower igfbp-5a/b expression than males from the 3.0 mph. At this time, the E2 content of females was significantly higher than that of males, and the T content of males was significantly higher than that of females, suggesting that the ability of E2 to promote the expression of igfbp-5a/b may be weaker than that of T, resulting in a lower expression of igfbp-5a/b in females than in males. Igfbp-5a/b has the ability to inhibit gh and igf1 expression, and overexpression of igfbp-5 causes a decrease in igf1 expression in the ovary (Z. Q. Yao et al., 2022). Lower igfbp-5a/b expression in females may cause higher expression of gh and igf1 than in males, thereby promoting growth in female individuals.

Growth in mandarin fish is characterized by SSD, with females growing faster than males, which may be related to higher E2 levels in females leading to higher igf1 level, by inhibiting igfbp-5a/b expression. In both male and female mandarin fish, igfbp-5a expression showed a gradual increase in gonadal development, while igfbp-5b expression showed an "S" pattern.

Funding: This work was supported by the China Agriculture Research System with grant number CARS-46.

Data availability: All data were available in the manuscript.

Code availability: It is not applicable.

Ethics approval: All research involving animals was conducted according to the approved protocols of the animal ethics committee of Shanghai Ocean University.

Conflict of interest: The authors declare no competing interests.

Chan MTT, Muttray A, Sakhrani D, Woodward K, Kim JH, Christensen KA, Koop B,Devlin RH (2021) Sexually Dimorphic Growth Stimulation in a Strain of Growth Hormone Transgenic Coho Salmon (Oncorhynchus kisutch). Marine Biotechnology, 23(1), 140-148. http://doi.org/10.1007/s10126-020-10012-5
de la Serrana DG,Macqueen DJ (2018) Insulin-like growth factor-binding proteins of teleost fishes. Frontiers in Endocrinology, 9, 80. http://doi.org/10.3389/fendo.2018.00080
Devesa J,Caicedo D (2019) The role of growth hormone on ovarian functioning and ovarian angiogenesis. Frontiers in Endocrinology, 10. http://doi.org/10.3389/fendo.2019.00450
Han C, Zhu Q, Lu. Hao M, Wang CW, Zhou XN, Peng C, Lin T, Linqiang H, Jiehu C, Shuisheng L, Guifeng L, Haoran L,Yong Z (2020) Screening and characterization of sex-specific markers developed by a simple NGS method in mandarin fish (Siniperca chuatsi). Aquaculture. http://doi.org/10.1016/j.aquaculture.2020.735495
Ji XS, Liu HW, Chen SL, Jiang YL,Tian YS (2011) Growth differences and dimorphic expression of growth hormone (GH) in female and male Cynoglossus semilaevis after male sexual maturation. Marine Genomics, 4(1), 9-16. http://doi.org/10.1016/j.margen.2010.11.002
Jiang YG (1959) Biology of mandarin fish in Liangzi Lake. Acta Hydrobiologica Sinica(3), 375-385.
Johannes DV,Cyril YB (2003) Sex-steroid modulation of growth hormone (GH) secretory control: Three-peptide ensemble regulation under dual feedback restraint by GH and IGF-I. Endocrine Journal. http://doi.org/10.1385/endo:22:1:25
Kamangar BB, Gabillard JC,Bobe J (2006) Insulin-like growth factor-binding protein (IGFBP)-1,-2,-3,-4,-5, and -6 and IGFBP-related protein 1 during rainbow trout postvitellogenesis and oocyte maturation: Molecular characterization, expression profiles, and hormonal regulation. Endocrinology, 147(5), 2399-2410. http://doi.org/10.1210/en.2005-1570
Li BY, Ye LM, Zhang C, Liu RF, Wang C, Zhang XT, Ji H,Yu HB (2024) Effects of glycerol monolaurate on estradiol and follicle-stimulating hormones, offspring quality, and mRNA expression of reproductive-related genes of zebrafish (Danio rerio) females. Fish Physiol Biochem, null. http://doi.org/10.1007/s10695-024-01345-2
Li D, Yang C, Xu Lg,Zhang L (1998) Biology of mandarin fish in Poyang Lake, China. Acta Agriculturae Jiangxi, 10(4), 14-22.
Li XH, Yang Q, Shi R, Xu XW, Chen ZF, Chen SL,Wang N (2022) Genome-wide identification of insulin-like growth factor-binding protein family in Chinese tongue sole (Cynoglossus semilaevis) and their responses to sex steroids. Aquaculture, 557. http://doi.org/10.1016/j.aquaculture.2022.738346
Liu D, Gui L, Zhu YF, Xu C, Zhou WZ,Li MY (2022) Chromosome-level assembly of male genome provides insights into the regulation of the gnrh signaling pathway and genome evolution. Biology-Basel, 11(10). http://doi.org/10.3390/biology11101500
Liu ZH, Chen QL, Chen Q, Li F,Li YW (2018) Diethylstilbestrol arrested spermatogenesis and somatic growth in the juveniles of yellow catfish (Pelteobagrus fulvidraco), a fish with sexual dimorphic growth. Fish Physiology and Biochemistry, 44, 789-803. http://doi.org/10.1007/s10695-018-0469-1
Liu ZQ, Lee HL, Suh JS, Deng P, Lee CR, Bezouglaia O, Mirnia MJ, Chen V, Zhou M,Cui ZK (2022) The ERα/KDM6B regulatory axis modulates osteogenic differentiation in human mesenchymal stem cells. Bone Research, 10(1), 3. http://doi.org/10.1038/s41413-021-00171-z
Luo LF, Xu ZS, Elgazzar EABE, Du H, Li DY, Zhou XY,Gao ZX (2021) Comparative Transcriptome Analysis Revealed Genes Involved in Sexual and Polyploid Growth Dimorphisms in Loach ( Misgurnus anguillicaudatus ). Biology-Basel, 10(9). http://doi.org/10.3390/biology10090935
Luo LF, Xu ZS, Li DY, Hu Z,Gao ZX (2022) Comparative transcriptome profiles of four sexually size dimorphic fish. Scientific Data, 9(1). http://doi.org/10.1038/s41597-022-01887-1
Ma WG, Wu JJ, Zhang J, He Y, Gui JF,Mei J (2016) Sex differences in the expression of GH/IGF axis genes underlie sexual size dimorphism in the yellow catfish (Pelteobagrus fulvidraco). Science China-Life Sciences, 59(4), 431-433. http://doi.org/10.1007/s11427-015-4957-6
Mei J,Gui JF (2018) Sexual size dimorphism, sex determination, and sex control in yellow catfish. Sex control in aquaculture, 495-507. http://doi.org/10.1002/9781119127291.ch24
Mull CG, Pacoureau N, Pardo SA, Ruiz LS, García-Rodríguez E, Finucci B, Haack M, Harry A, Judah AB, VanderWright W, Yin JS, Kindsvater HK,Dulvy NK (2022) Sharkipedia: a curated open access database of shark and ray life history traits and abundance time-series. Scientific Data, 9(1). http://doi.org/10.1038/s41597-022-01655-1
Niu JT, Wang T, Li Z, Wang ZW, Ding M, Wang MT, Lian ZQ, Mei J, Wang Y, Zhou L, Zhang XJ, Gui JF,Li XY (2024) Efficient breeding and growth advantage of all-male population in Lanzhou catfish (Silurus lanzhouensis). Aquaculture, 578. http://doi.org/10.1016/j.aquaculture.2023.740023
Ru XY, Shi HJ, Wang T, Liu QQ, Jiang DN, Peng YH, Huang Y, Zhu CH, Li SS, Dong R,Li GL (2020) Effects of 17β-Estradiol on growth-related genes expression in female and male spotted scat (Scatophagus argus). Comparative biochemistry and physiology. Part B, Biochemistry & molecular biology, 250, 110492. http://doi.org/10.1016/j.cbpb.2020.110492
Shi HJ, Ru XY, Pan SH, Jiang DN, Huang Y, Zhu CH,Li GL (2022) Transcriptomic analysis of pituitary in female and male spotted scat (Scatophagus argus) after 17β-estradiol injection. Comparative Biochemistry and Physiology Part D: Genomics and Proteomics. http://doi.org/10.1016/j.cbd.2021.100949
Tian CX, Li L, Liang XF, He S, Guo WJ, Lv LY, Wang QC,Song Y (2016) Identification of differentially expressed genes associated with differential body size in mandarin fish (Siniperca chuatsi). Genetica, 144(4), 445-455. http://doi.org/10.1007/s10709-016-9913-2
Tripathy S, Asaithambi K,P J (2016) Analysis of 17β-estradiol (E 2) role in the regulation of corpus luteum function in pregnant rats: involvement of IGFBP5 in the E 2-mediated actions. Reproductive Biology and Endocrinology, 14, 1-16. http://doi.org/10.1186/s12958-016-0153-1
Wang XQ, Li CW, Xie ZG, Fan WJ,Zhang JS (2006) Studies on the growth difference of the male and female Siniperca chuatsi. Freshwater Fisheries, 36(3), 34-37. http://doi.org/10.3969/j.issn.1000-6907.2006.03.007
Yao XL, Zheng J, Geletu TT, Zhao Y, Tang SJ,Zhao JL (2024) Genome-wide identification of genes and their different growth expression patterns of mandarin fish. Aquaculture Reports, 35. http://doi.org/10.1016/j.aqrep.2024.101971
Yao ZQ, Lin MS, Lin T, Gong XB, Qin P, Li HL, Kang TZ, Ye J, Zhu YY, Hong QW, Liu Y, Li YS, Wang JH,Fang FG (2022) The expression of IGFBP-5 in the reproductive axis and effect on the onset of puberty in female rats. Reproductive Biology and Endocrinology, 20(1). http://doi.org/10.1186/s12958-022-00966-7
Yue M, Zhao J, Tang S,Zhao Y (2018) Effects of estradiol and testosterone on the expression of growth‐related genes in female and male Nile Tilapia, Oreochromis niloticus. Journal of the World Aquaculture Society, 49(1), 216-228. http://doi.org/10.1111/jwas.12428
Zheng JC, Zhang WJ, Xu YJ, Cui Aj, Jiang Y,Wang B (2024) Insulin-like growth factor binding protein-3 (igfbp-3) and igfbp-5 in yellowtail kingfish (Seriola aureovittata): Molecular identification and expression under different nutritional status and stocking density. Research Square. http://doi.org/10.21203/rs.3.rs-3922682/v1

No competing interests reported.

Download PDF

Journal Publication

published 03 Aug, 2024

Read the published version in Fish Physiology and Biochemistry →

Editorial decision: Revision requested
23 Jun, 2024
Reviews received at journal
11 Jun, 2024
Reviews received at journal
07 Jun, 2024
Reviewers agreed at journal
26 May, 2024
Reviewers agreed at journal
18 May, 2024
Reviewers invited by journal
18 May, 2024
Editor assigned by journal
13 May, 2024
Submission checks completed at journal
08 May, 2024
First submitted to journal
26 Apr, 2024

You are reading this latest preprint version

Characterization of sexual size dimorphism in mandarin fish and association with igfbp-5a/b regulation

Status:

Journal Publication

Version 1

Abstract

Figures

1. Introduction

2. Materials and methods

2.1. Fish rearing and sample collection

2.2. Growth characteristics from male and female mandarin fish

2.3. Tissue sections

2.4. Steroid sex hormone determination

2.5. qPCR

2.6. Data analysis

3. Results

3.1. Growth characteristics from male and female mandarin fish

3.2. gender identification and gonad development

3.3. contents of E2 and T in the serum

3.4. Differential expression of gh/igf1/igfbp-5 related genes

4. Discussion

5. Conclusion

Declarations

References

Additional Declarations

Status:

Journal Publication

Version 1